DONOR
GENE

ABCA4

DISEASES
Cone rod dystrophy
SUMMARY

A rare genetic isolated inherited retinal disorder characterized by primary cone degeneration with significant secondary rod involvement, with a variable fundus appearance. Typical presentation includes decreased visual acuity, central scotoma, photophobia, color vision alteration, followed by night blindness and loss of peripheral visual field.

CLINICAL DESCRIPTION

Cone rod dystrophy (CRD) is characterized by primary cone involvement or, occasionally, by concomitant loss of both cones and rods, explaining the predominant symptoms of CRDs: decreased visual acuity, color vision defects, photoaversion and decreased sensitivity in the central visual field, later followed by progressive loss in peripheral vision and night blindness. The fundus appearance is varaible ranging from normal in the early stages, with only subtle temporal optic nerve pallor, macular pigment migration and atrophy or a bull's-eye maculopathy, to peripheral retinal pigment epithelium atrophy, intra retinal pigmentation migration, arteriolar attenuation, and optic disc pallor as disease progresses. Cone-rod dystrophy (CRD) should be distinguished from rod-cone dystrophy (RCD), also known as retinitis pigmentosa. Unlike RCD, which typically start with night blindness and progressive visual field constriction while central vision is preserved until late stages, CRD is characterized by a primary decrease in central vision leading to earlier legal blindness. At end stage, however, CRDs do not differ from end stage RCDs. CRDs are most frequently nonsyndromic, however they may also be part of several syndromes, such as Alström syndrome, Bardet-Biedl syndrome and Spinocerebellar Ataxia Type 7.

NON RARE IN EUROPE: Age-related macular degeneration
SUMMARY

Age-related macular degeneration-2 (ARMD2) is a complex disorder characterized by the accumulation of drusen in and under the retinal pigment epithelium (RPE) and the progressive atrophy of the macular RPE. These changes result in loss of photoreceptor function and vision impairment. Environmental risk factors include cigarette smoking, diet, and cholesterol level.

CLINICAL DESCRIPTION

Retinitis pigmentosa
SUMMARY

Retinitis pigmentosa (RP) is an inherited retinal dystrophy leading to progressive loss of the photoreceptors and retinal pigment epithelium and resulting in blindness usually after several decades.

CLINICAL DESCRIPTION

Retinitis pigmentosa is slowly progressive but relentless. There is however broad variability in age of onset, rate of progression and secondary clinical manifestations. Affected individuals generally first develop night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and over time loss of central vision, usually at late stages, often around midlife. Central visual acuity loss may occur at any age as a result of cystoid macular edema or photoreceptor loss. Posterior subcapsular cataracts are common and severity is age dependent. Reduced color vision may also be found. Fundus examination reveals bone spicule pigment deposits, attenuated retinal vessels, retinal atrophy and waxy optic nerve pallor. Severity is partly correlated with the pattern of inheritance with X-linked cases having the most severe course, autosomal recessive and single occurrence cases having intermediate severity, and autosomal dominant the most favorable course.

Stargardt disease
SUMMARY

A rare ophthalmic disorder that is usually characterized by a progressive loss of central vision associated with irregular macular and perimacular yellow-white fundus flecks, and a so-called ''beaten bronze'' atrophic central macular lesion.

CLINICAL DESCRIPTION

The disease typically presents within the first two decades of life, even though symptoms can also appear during adulthood and as late as the seventh decade. Although disease progression and severity varies widely, Stargardt disease (STGD1) is usually characterized by a progressive loss of central vision causing blurry vision and, occasionally, an increasing difficulty to adapt in the dark. Peripheral vision is usually normal. Most affected individuals also have impaired color vision. Photophobia may be present.

VARIANTS

NM_000350.2(ABCA4):c.1622T>C ; NM_000350.2(ABCA4):c.1715G>A ; NM_000350.2(ABCA4):c.2588G>C ; NM_000350.2(ABCA4):c.2690C>T ; NM_000350.2(ABCA4):c.2791G>A ; NM_000350.2(ABCA4):c.6148G>C ; NM_000350.2(ABCA4):c.6320G>A ; NM_000350.2(ABCA4):c.1964T>G ; NM_000350.2(ABCA4):c.2300T>A ; NM_000350.2(ABCA4):c.3322C>T ; NM_000350.2(ABCA4):c.3364G>A ; NM_000350.2(ABCA4):c.4457C>T ; NM_000350.2(ABCA4):c.4793C>A ; NM_000350.2(ABCA4):c.52C>T ; NM_000350.2(ABCA4):c.5881G>A ; NM_000350.2(ABCA4):c.5882G>A ; NM_000350.2(ABCA4):c.6089G>A ; NM_000350.2(ABCA4):c.634C>T ; NM_000350.2(ABCA4):c.6449G>A ; NM_000350.2(ABCA4):c.1018T>G ; NM_000350.2(ABCA4):c.1222C>T ; NM_000350.2(ABCA4):c.1225del ; NM_000350.2:c.1755delA ; c.1771del ; NM_000350.2(ABCA4):c.1804C>T ; NM_000350.2(ABCA4):c.1848del ; NM_000350.2(ABCA4):c.1938-1G>A ; NM_000350.2(ABCA4):c.2160+1G>T ; NM_000350.2(ABCA4):c.2616_2617delCT ; NM_000350.2(ABCA4):c.3083C>T ; NM_000350.2(ABCA4):c.3106G>A ; NM_000350.2(ABCA4):c.3210_3211dupGT ; NM_000350.2(ABCA4):c.3539_3554del16 ; NM_000350.2:c.3970delG ; NM_000350.2(ABCA4):c.4139C>T ; NM_000350.2(ABCA4):c.4429C>T ; NM_000350.2(ABCA4):c.4469G>A ; NM_000350.2(ABCA4):c.5461-10T>C ; NM_000350.2:c.5512delC ; NM_000350.2(ABCA4):c.5714+5G>A ; NM_000350.2(ABCA4):c.5819T>C ; NM_000350.2(ABCA4):c.5912T>G ; NM_000350.2(ABCA4):c.6118C>T ; c.6394G>T ; NM_000350.2(ABCA4):c.67-2A>G ; NM_000350.2(ABCA4):c.763C>T

GENE

ACAD9

DISEASES
Acyl-CoA dehydrogenase 9 deficiency
SUMMARY

A rare disorder characterized by neurological dysfunction, hepatic failure and cardiomyopathy due to a deficiency of complex I of the respiratory chain.

CLINICAL DESCRIPTION

Patients present predominantly with neurological, hepatic and /or cardiomyopathic disease with isolated NADH-CoQ reductase deficiency (see this term). Manifestations include failure to thrive, hypertrophic cardiomyopathy, exercise intolerance, liver disease and mild to severe neurological dysfunction.

VARIANTS

NM_014049.4(ACAD9):c.1240C>T ; NM_014049.4(ACAD9):c.1594C>T ; NM_014049.4(ACAD9):c.359delT ; NM_014049.4(ACAD9):c.1249C>T ; NM_014049.4(ACAD9):c.130T>A ; c.23del ; c.453+1G>A ; NM_014049.4(ACAD9):c.797G>A ; NM_014049.4(ACAD9):c.976G>C

GENE

ACADM

DISEASES
Medium chain acyl-CoA dehydrogenase deficiency
SUMMARY

Medium chain acyl-CoA dehydrogenase (MCAD) deficiency (MCADD) is an inborn error of mitochondrial fatty acid oxidation characterized by a rapidly progressive metabolic crisis, often presenting as hypoketotic hypoglycemia, lethargy, vomiting, seizures and coma, which can be fatal in the absence of emergency medical intervention.

CLINICAL DESCRIPTION

MCADD usually presents 3 to 24 months after birth in previously healthy infants. However, neonatal presentations are well described as are those in adults, given sufficient metabolic stress (such as significant alcohol ingestion). Nevertheless, many affected individuals remain asymptomatic throughout life. Typically hypoketotic hypoglycemia, lethargy and vomiting are triggered by an infection, fasting or surgery. Some patients, however, can present with a progressive metabolic crisis despite ketosis and normal blood glucose. Rarely patients may present in crisis with ''paradoxically'' gross ketosis. During a crisis, a patient may manifest with lethargy, emesis, respiratory arrest, seizures, hepatomegaly and rapid progression to cardiac arrest unless emergency treatment is implemented. Potential brain injury occurring during these episodes can lead to an increased risk of long term neurological damage. Sudden unexplained death can sometimes be the first manifestation of this disease. Historically, about 25% of undiagnosed patients die during their first presentation of a crisis.

VARIANTS

NM_000016.5(ACADM):c.127G>A ; NM_000016.5(ACADM):c.362C>T ; NM_000016.5(ACADM):c.447G>T ; NM_000016.5(ACADM):c.683C>A ; NM_001127328.2(ACADM):c.997A>G ; NM_000016.5(ACADM):c.250C>T ; NM_000016.5(ACADM):c.287-2A>G ; NM_000016.5(ACADM):c.449_452delCTGA ; NM_000016.5(ACADM):c.616C>T ; NM_000016.5(ACADM):c.617G>A ; NM_000016.5(ACADM):c.734C>T ; NM_000016.5(ACADM):c.797A>G ; NM_000016.5(ACADM):c.799G>A ; NM_000016.5(ACADM):c.817_829del ; NM_000016.5(ACADM):c.984del ; NM_000016.5(ACADM):c.1102_1105delTTAG ; NM_000016.5(ACADM):c.447G>A

GENE

ACADS

DISEASES
Short chain acyl-CoA dehydrogenase deficiency
SUMMARY

Short-chain acyl-CoA dehydrogenase (SCAD) deficiency is a very rare inborn error of mitochondrial fatty acid oxidation characterized by variable manifestations ranging from asymptomatic individuals (in most cases) to those with failure to thrive, hypotonia, seizures, developmental delay and progressive myopathy.

CLINICAL DESCRIPTION

Most infants with SCAD deficiency identified through newborn screening programs have been well at the time of diagnosis and most have remained asymptomatic. In affected individuals manifestations include seizures, developmental delay (delayed sitting/walking and/or speech/social interaction), failure to grow with poor feeding, and usually muscle weakness and hypotonia.

VARIANTS

NM_000017.2(ACADS):c.1095G>T ; NM_000017.3(ACADS):c.1147C>T ; NM_000017.3(ACADS):c.136C>T ; NM_000017.4(ACADS):c.417G>C ; NM_000017.3(ACADS):c.529T>C ; NM_000017.4:c.319C>T ; c.561_568del

GENE

ACADSB

DISEASES
2-methylbutyryl-CoA dehydrogenase deficiency
SUMMARY

2-Methylbutyryl-CoA dehydrogenase deficiency is an autosomal recessive metabolic disorder of impaired isoleucine degradation. It is most often ascertained via newborn screening and is usually clinically asymptomatic, although some patients have been reported to have delayed development and neurologic signs. Therefore, the clinical relevance of the deficiency is unclear.

CLINICAL DESCRIPTION

A rare organic aciduria characterized by impaired isoleucine degradation with increased plasma or whole blood C5 acylcarnitine levels (typically observed in newborn screening) and increased urinary excretion of N-methylbutyrylglycine. The condition is usually clinically asymptomatic, although patients with muscular hypotonia, developmental delay, and seizures (among others) have been reported.

VARIANTS

NM_001609.3(ACADSB):c.1159G>A ; NM_001609.3(ACADSB):c.443C>T ; NM_001609.3(ACADSB):c.303+1G>A ; NM_001609.3(ACADSB):c.763C>T

GENE

ACADVL

DISEASES
Very long chain acyl-CoA dehydrogenase deficiency
SUMMARY

Very long-chain acyl-CoA dehydrogenase (VLCAD) deficiency (VLCADD) is an inherited disorder of mitochondrial long-chain fatty acid oxidation with a variable presentation including: cardiomyopathy, hypoketotic hypoglycemia, liver disease, exercise intolerance and rhabdomyolysis.

CLINICAL DESCRIPTION

VLCADD is a clinically heterogeneous disease, with 3 major phenotypes. Severe infantile VLCADD has an early onset, usually within the first 3-12 months of life and as early as the neonatal period, with high mortality and a high incidence of hypoketotic hypoglycaemia, liver disease, cardiac arrhythmias and cardiomyopathy. Pericardial effusion is also reported. Moderately severe infantile/childhood VLCADD has a later onset (early neonatal period to early childhood) and usually presents with hypoketotic hypoglycemia, lower mortality and rarely cardiomyopathy. Late-onset myopathic VLCADD presents in older children and young adults (usually >10 years of age) with isolated skeletal muscle involvement, exercise intolerance, myalgia, rhabdomyolysis and myoglobinuria usually triggered by exercise, fasting, cold/heat and/or stress but viral infection can also precipitate/exacerbate this presentation. In rare cases it can lead to renal failure and can be fatal. Some patients presenting with myopathic disease may have a previous history of hypoglycemia in infancy/childhood.

VARIANTS

NM_000018.3(ACADVL):c.1468G>C ; NM_000018.3(ACADVL):c.1844G>A ; NM_000018.3(ACADVL):c.896_898delAGA ; NM_000018.4(ACADVL):c.1097G>A ; NM_000018.3(ACADVL):c.1106T>C ; NM_000018.3(ACADVL):c.1141_1143delGAG ; NM_000018.2(ACADVL):c.1182+1G>A ; NM_000018.3(ACADVL):c.1357C>T ; NM_000018.3(ACADVL):c.1406G>A ; NM_000018.3(ACADVL):c.1837C>T ; NM_000018.3(ACADVL):c.298_299delCA ; NM_000018.3(ACADVL):c.343delG ; NM_000018.4(ACADVL):c.520G>A ; NM_000018.3(ACADVL):c.685C>T ; NM_000018.4:c.1096C>T ; NM_000018.3:c.1375delCinsCC ; NM_000018.3(ACADVL):c.1389dupG ; NM_000018.3(ACADVL):c.1532+1G>A ; c.1816del ; NM_000018.3(ACADVL):c.1843C>T ; NM_000018.3:c.278-1G-A ; c.334C>T ; c.411+1G>C ; NM_000018.3(ACADVL):c.753-2A>C ; NM_000018.3(ACADVL):c.848T>C

GENE

ACAT1

DISEASES
Beta-ketothiolase deficiency
SUMMARY

A rare, genetic organic aciduria affecting ketone body metabolism and the catabolism of isoleucine and characterized by intermittent ketoacidotic episodes associated with vomiting, dyspnea, tachypnoea, hypotonia, lethargy and coma, with an onset during infancy and usually ceasing by adolescence.

CLINICAL DESCRIPTION

Children often appear normal at birth with disease presentation typically between the ages of 5 months to 2 years; however, presentation may occur anywhere between birth and childhood. The onset of symptoms usually occurs in the form of a ketoacidotic crisis, most often brought on by stress, fasting, acute illness and/or infections (i.e. gastroenteritis), and rarely by increased dietary protein intake. An acetone or fruity odor on the breath often signals ketoacidosis. These episodes are associated with vomiting, dyspnea, lethargy and unconsciousness, and can lead to coma and death if not treated. Neurological sequelae (such as developmental delay) following severe episodes are common. Rarely, patients present with signs of metabolic encephalopathy (hypotonia, dysarthria, chorea, developmental delay). The occurrence of developmental delay or neurological manifestations before a first ketoacidotic crisis, however, is rare. The frequency of episodes decreases with age, eventually stopping before adolescence. In between episodes, patients are often asymptomatic.

VARIANTS

NM_000019.3(ACAT1):c.1033_1035del ; NM_000019.3(ACAT1):c.1136G>T ; NM_000019.3(ACAT1):c.1138G>A ; NM_000019.3(ACAT1):c.547G>A ; NM_000019.4(ACAT1):c.1083dup ; NM_000019.3(ACAT1):c.2T>A ; NM_000019.3:c.410_417delCTCAAAGT ; NM_000019.3(ACAT1):c.622C>T ; NM_000019.3(ACAT1):c.905delA

GENE

ACOX1

DISEASES
Peroxisomal acyl-CoA oxidase deficiency
SUMMARY

Peroxisomal acyl-CoA oxidase deficiency is a rare neurodegenerative disorder that belongs to the group of inherited peroxisomal disorders and is characterized by hypotonia and seizures in the neonatal period and neurological regression in early infancy.

CLINICAL DESCRIPTION

Peroxisomal acyl-CoA oxidase deficiency is a disorder of peroxisomal fatty acid beta-oxidation. See also D-bifunctional protein deficiency, caused by mutation in the HSD17B4 gene on chromosome 5q2. The clinical manifestations of these 2 deficiencies are similar to those of disorders of peroxisomal assembly, including Zellweger cerebrohepatorenal syndrome and neonatal adrenoleukodystrophy: neonatal hypotonia, seizures, apneic spells, delayed psychomotor development, and neurologic regression after age 2 years. Brain imaging shows progressive white-matter demyelination without cortical malformations. Biochemical analysis shows accumulation of very long chain fatty acids (VLCFA) resulting from an isolated deficiency of peroxisomal fatty acyl-CoA oxidase.

VARIANTS

NM_004035.6(ACOX1):c.532G>T ; c.591del ; NM_004035.6(ACOX1):c.832A>G

GENE

ADA

DISEASES
Omenn syndrome
SUMMARY

Omenn syndrome (OS) is an inflammatory condition characterized by erythroderma, desquamation, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency (SCID; see this term).

CLINICAL DESCRIPTION

OS presents during the first year of life with features of SCID including chronic diarrhea, pneumonitis and failure to thrive. In addition, patients present with inflammatory symptoms including lymphadenopathy, hepatosplenomegaly and generalized erythroderma, which may often cause alopecia and loss of eyebrows and eyelashes; protein loss may lead to generalized edema and metabolic disturbances. The signs and symptoms of OS can evolve over time and may not appear simultaneously. Some patients present with some but not all of these symptoms and may be described as having atypical Omenn syndrome. OS may also be associated with syndromic disorders including cartilage-hair hypoplasia (CHH), adenosine deaminase (ADA) deficiency, monosomy 22q11, coloboma of the eye, CHARGE syndrome and ligase 4 deficiency (see these terms).

Severe combined immunodeficiency due to adenosine deaminase deficiency
SUMMARY

Severe combined immunodeficiency (SCID) due to adenosine deaminase (ADA) deficiency is a form of SCID characterized by profound lymphopenia and very low immunoglobulin levels of all isotypes resulting in severe and recurrent opportunistic infections.

CLINICAL DESCRIPTION

SCID due to ADA deficiency has a variable clinical presentation. The most common form presents in infancy with severe and recurrent opportunistic infections (including respiratory tract infections and candidiasis), failure to thrive, and usually results in early death. Ten to 15% of patients have a delayed clinical onset by age 6-24 months, and a smaller percentage have a partial form of ADA deficiency with later onset between ages 4 years and adulthood, both types showing less severe infections and gradual immunologic deterioration. Patients may also present with extraimmune manifestations (including neurodevelopmental deficits, behavioral disorders, sensorineural deafness, and skeletal and hepatic abnormalities) as a result of the systemic nature of ADA expression.

VARIANTS

NM_000022.2(ADA):c.320T>C ; NM_000022.2(ADA):c.632G>A ; NM_000022.3(ADA):c.872C>T ; NM_000022.2(ADA):c.956_960delAAGAG ; NM_000022.2(ADA):c.986C>T ; NM_000022.3(ADA):c.890C>A

GENE

ADAMTS2

DISEASES
Dermatosparaxis Ehlers-Danlos syndrome
SUMMARY

A form of Ehlers-Danlos syndrome (EDS) characterized by extreme skin fragility and laxity, a prominent facial gestalt, excessive bruising and, sometimes, major complications due to visceral and vascular fragility.

CLINICAL DESCRIPTION

VARIANTS

NM_014244.4(ADAMTS2):c.2384G>A

GENE

AGA

DISEASES
Aspartylglucosaminuria
SUMMARY

An autosomal recessive lysosomal storage disease belonging to the oligosaccharidosis group (also called glycoproteinosis).

CLINICAL DESCRIPTION

Urea cycle disorders are characterized by the triad of hyperammonemia, encephalopathy, and respiratory alkalosis. Five disorders involving different defects in the biosynthesis of the enzymes of the urea cycle have been described: ornithine transcarbamylase deficiency (311250), carbamyl phosphate synthetase deficiency (237300), argininosuccinate synthetase deficiency, or citrullinemia (215700), argininosuccinate lyase deficiency (207900), and arginase deficiency.

VARIANTS

NM_000027.3(AGA):c.302C>T ; NM_000027.3(AGA):c.755G>A ; NM_000027.4(AGA):c.800dup ; NM_000027.3(AGA):c.214T>C ; NM_000027.3(AGA):c.488G>C ; NM_000027.3(AGA):c.904G>A

GENE

AGL

DISEASES
Glycogen storage disease due to glycogen debranching enzyme deficiency
SUMMARY

Glycogen debranching enzyme (GDE) deficiency, or glycogen storage disease type 3 (GSD 3), is a form of glycogen storage disease characterized by severe muscle weakness and hepatopathy.

CLINICAL DESCRIPTION

GSD 3 commonly occurs in early childhood. Children present with hepatomegaly, growth retardation and occasional seizures related to hypoglycemia. Hepatomegaly may disappear with adulthood. Muscle weakness is slowly progressive. Other frequently associated signs include muscular hypotonia and hypertrophic cardiomyopathy. Symptoms often improve at puberty, except in the few cases where cirrhosis or myopathy appears. Biological findings include hypoglycemia without acidosis, hypertriglyceridemia, and hypertransaminasemia during childhood.

VARIANTS

NM_000642.2(AGL):c.16C>T ; NM_000642.2(AGL):c.18_19delGA ; NM_000642.2(AGL):c.294-2A>T ; NM_000642.2(AGL):c.4260-12A>G ; NM_000642.2(AGL):c.4529dupA ; NM_000642.2(AGL):c.1222C>T ; NM_000642.2(AGL):c.1485delT ; NM_000642.2(AGL):c.1999del ; NM_000642.2(AGL):c.2039G>A ; NM_000642.2(AGL):c.2590C>T ; NM_000642.2(AGL):c.3216_3217delGA ; NM_000642.2(AGL):c.3980G>A ; NM_000642.2:c.4260-1G-T ; NM_000642.2(AGL):c.4342G>C ; NM_000642.3:c.4456delT ; NC_000001.11:g.99880679C>T

GENE

AGPS

DISEASES
Rhizomelic chondrodysplasia punctata type 3
SUMMARY

A rare, primary bone dysplasia characterized by rhizomelic limb shortening, punctate calcifications in cartilage with epiphyseal and metaphyseal abnormalities (chondrodysplasia punctata) and coronal cleft vertebrae associated with profound postnatal growth deficiency, early-onset cataracts, severe intellectual disability and seizures.

CLINICAL DESCRIPTION

Presentation is at birth with severe joint contractures; cataracts may be present or appear in the first few months of life. Respiratory distress nd feeding difficulties are commonly observed after birth. Whilst birth parameters (weight, length, and head circumference) are in the lower range from normal, profound postnatal growth retardation ensues. Rhizomelic limb shortening is typically greater in the humerus than the femur. Other skeletal abnormalities include punctate calcifications in cartilage with epiphyseal and metaphyseal abnormalities (chondrodysplasia punctata) and coronal cleft vertebrae. Intellectual disability is severe, and the majority of children develop seizures.

VARIANTS

NM_003659.3(AGPS):c.1256G>A ; NM_003659.3(AGPS):c.1406T>C ; NM_003659.3(AGPS):c.1703C>T ; NM_003659.3(AGPS):c.926C>T

GENE

AGXT

DISEASES
Primary hyperoxaluria type 1
SUMMARY

A disorder of glyoxylate metabolism characterized by an excess of oxalate resulting in kidney stones, nephrocalcinosis and ultimately renal failure and systemic oxalosis. There are 3 types of PH, types 1-3, all caused by liver-specific enzyme defects.

CLINICAL DESCRIPTION

Hyperoxaluria may lead to kidney stones, nephrocalcinosis and ultimately renal failure and systemic oxalosis. Symptoms can appear at any age and may vary from infantile failure to thrive and cortical nephrocalcinosis with renal failure to hematuria, medullary nephrocalcinosis or sporadic stone disease, even within one family. PH1 is the most severe form; overall, more than 70% of PH1 patients develop end-stage kidney disease over time; this may even occur in patients with sporadic stone disease. Storage of oxalate occurs in severe renal failure and may affect bone, eyes, heart, arteries and peripheral nerves (systemic oxalosis). PH2 has a more benign course; no infantile oxalosis has been described and end-stage kidney disease occurs at relatively late age in about 20% of patients. PH3 is most benign with so far only a few reports of renal impairment and no end-stage kidney disease.

VARIANTS

NM_000030.2(AGXT):c.245G>A ; NM_000030.2(AGXT):c.322T>C ; NM_000030.2(AGXT):c.508G>A ; NM_000030.2(AGXT):c.560C>T ; NM_000030.2(AGXT):c.697C>T ; NM_000030.2(AGXT):c.698G>A ; NM_000030.3:c.121G>A ; c.166-2A>G ; NM_000030.2(AGXT):c.248A>G ; NM_000030.2(AGXT):c.33dupC ; NM_000030.2(AGXT):c.454T>A ; NM_000030.2(AGXT):c.466G>A ; NM_000030.2(AGXT):c.613T>C ; NM_000030.2(AGXT):c.731T>C ; NM_000030.2(AGXT):c.738G>A

GENE

ALDOB

DISEASES
Hereditary fructose intolerance
SUMMARY

Hereditary fructose intolerance (HFI) is an autosomal recessive disorder of fructose metabolism (see this term), resulting from a deficiency of hepatic fructose-1-phosphate aldolase activity and leading to gastrointestinal disorders and postprandial hypoglycemia following fructose ingestion. HFI is a benign condition when treated, but it is life-threatening and potentially fatal if left untreated.

CLINICAL DESCRIPTION

HFI usually presents in infancy at the time of weaning (when fructose is added to the diet), manifesting with hypoglycemia, lactic acidosis, ketosis with recurrent vomiting, abdominal pain and systemic manifestations following consumption of fructose-containing foods. Persistent ingestion of fructose and related sugars (such as sucrose and sorbitol) may lead to growth retardation, hepatomegaly, proximal tubular dysfunction, liver and renal failure, seizures, coma and risk of death. All patients achieve adulthood, develop a natural aversion to fruit/sweets and report a life long history of vomiting and hypoglycemia following fructose ingestion. Dental caries are absent in a significant proportion of adult population with HFI (which may give a clue to the diagnosis). Sometimes, the diagnosis may be made in an adult who has, owing to his aversion to fructose, excluded all fructose-containing food since childhood.

VARIANTS

NM_000035.4(ALDOB):c.1005C>G ; NM_000035.4(ALDOB):c.1013C>T ; NM_000035.4(ALDOB):c.10C>T ; NM_000035.3(ALDOB):c.113-1_115delGGTA ; NM_000035.4(ALDOB):c.178C>T ; NM_000035.3(ALDOB):c.360_363delCAAA ; NM_000035.4(ALDOB):c.612T>A ; c.1067C>A ; NM_000035.3:c.2T-C ; NM_000035.4(ALDOB):c.442T>C ; NM_000035.4(ALDOB):c.448G>C ; NM_000035.4(ALDOB):c.524C>A ; NM_000035.4(ALDOB):c.720C>A

GENE

ALG6

DISEASES
ALG6-CDG
SUMMARY

Congenital disorders of glycosylation, previously called carbohydrate-deficient glycoprotein syndromes (CDGSs), are caused by defects in mannose addition during N-linked oligosaccharide assembly. CDGs can be divided into 2 types, depending on whether they impair lipid-linked oligosaccharide (LLO) assembly and transfer (CDG I), or affect trimming of the protein-bound oligosaccharide or the addition of sugars to it (CDG II).

CLINICAL DESCRIPTION

A form of congenital disorders of N-linked glycosylation characterized by feeding problems, mild-to-moderate neurologic involvement with hypotonia, poor head control, developmental delay, ataxia, strabismus, and seizures, ranging from febrile convulsions to epilepsy. Retinal degeneration has also been reported. A minority of patients show other manifestations, particularly intestinal (such as protein-losing enteropathy) and liver involvement. The disease is caused by loss of function mutations of the gene ALG6 (1p31.3).

VARIANTS

NM_013339.4(ALG6):c.1432T>C ; c.316C>T ; NM_013339.3(ALG6):c.897_899del ; NM_013339.4(ALG6):c.998C>T

GENE

ALMS1

DISEASES
Alström syndrome
SUMMARY

A rare multisystemic disorder characterized by cone-rod dystrophy, hearing loss, obesity, insulin resistance and hyperinsulinemia, type 2 diabetes mellitus, dilated cardiomyopathy (DCM), and progressive hepatic and renal dysfunction.

CLINICAL DESCRIPTION

The clinical features, age of onset, and severity can vary greatly among and within families. Cone-rod retinal dystrophy usually develops within a few weeks after birth, with the first symptoms being nystagmus and extreme photodysphoria or light sensitivity. It is progressive and leads to blindness, usually by the second decade of life. Most patients develop mild-to-moderate slowly progressive bilateral sensorineural hearing loss. There is evidence of multi-organ fibrosis in AS. DCM manifests in approximately 2/3 of patients, either as infants or as adolescents. Patients are at risk of sudden congestive heart failure at any age. Obesity with hyperphagia, insulin resistance and hyperinsulinemia are early and consistent features. Liver dysfunction usually begins in childhood with steatosis (fatty liver). In some cases, cirrhosis, portal hypertension and liver failure can occur. Chronic respiratory illness (bronchitis/pneumonia), pulmonary hypertension, recurrent otitis media, and hypertriglyceridemia are frequent. Slowly progressive nephropathy can lead to end stage renal failure. Patients have distinctive facial characteristics ( thin hair, premature frontal balding, deep-set eyes with a rounded face and thick ears,). Most children have characteristic wide, thick, flat feet, and short stubby fingers and toes with no polydactyly or syndactyly. Hypogonadism in males/hyperandrogenism in females is also reported. Most patients have normal intelligence, although some reports have indicated delayed global development and intellectual disability. As some phenotypes develop slowly over time, non-classical presentations have also been reported.

VARIANTS

ENST00000613296.5:c.10576_10577del ; NM_015120.4(ALMS1):c.10775delC ; NM_015120.4(ALMS1):c.11316_11319delAGAG ; NM_015120.4(ALMS1):c.11449C>T ; ENST00000613296.5:c.11449dup ; ENST00000613296.5:c.11608_11609del ; NM_015120.4(ALMS1):c.11618_11619delCT ; ENST00000613296.5:c.1571_1573delinsT ; NM_015120.4(ALMS1):c.8164C>T ; NM_015120.4(ALMS1):c.8383C>T ; ENST00000613296.5:c.888_904del ; ENST00000613296.5:c.9908-1G>A

GENE

ALPL

DISEASES
Adult hypophosphatasia
SUMMARY

A moderate form of hypophosphatasia (HPP) characterized by adult onset osteomalacia, chondrocalcinosis, osteoarthropathy, stress fractures and dental anomalies.

CLINICAL DESCRIPTION

Adult HPP is clinically very heterogeneous. In its mildest form it is the least severe form of hypophosphatasia (HPP), characterized by non-specific symptoms in later age, such as osteoporosis, musculoskeletal pain, chondrocalcinosis. Most patients present features during middle age but some may have had a history of mild rickets or other musculoskeletal manifestations in childhood. Cardinal features include stress fractures and pseudo-fractures of the lower limbs, along with foot, thigh, and hip pain. The most common fracture types are metatarsal and tibial and femoral pseudofractures. Osteomalacia, chondrocalcinosis, and osteoarthropathy may develop with age. Some patients report history of early loss of primary dentition. Loss of permanent dentition is also common and some cases of enamel hypoplasia and tooth mobility are described. Patients with the adult form of HPP may have had some manifestations in early life between the prenatal period and childhood (prenatal benign HPP or childhood HPP). The presence of bone symptoms (osteomalacia, fractures) distinguish adult HPP from odontohypophosphatasia.

Childhood-onset hypophosphatasia
SUMMARY

A rare, moderate form of hypophosphatasia (HPP) characterized by onset after six months of age and widely variable clinical features from low bone mineral density for age, to unexplained fractures, skeletal deformities, and rickets with short stature and waddling gait.

CLINICAL DESCRIPTION

Patients develop manifestations after six months of age and generally before five years of age. Clinical manifestations cover a wide spectrum. Commonly, patients have rickets leading to short stature, with delay in walking and a waddling gait, and bone and joint pain. Skeletal deformities may include dolichocephalic skull and enlarged joints. Other common features are signs of intracranial hypertension and failure to thrive. Diaphyseal and metaphyseal fractures are common. Some affected children have premature loss of deciduous teeth, starting with incisors and then loss of other teeth with intact roots, before five years of age. The disease may follow an intermittent course with remission and recurrence in later life. There may be some clinical overlap between childhood-onset HPP and moderately severe infantile HPP.

Infantile hypophosphatasia
SUMMARY

A rare, severe, genetic form of hypophosphatasia (HPP) characterized by infantile rickets without elevated serum alkaline phosphatase (ALP) activity and a wide range of clinical manifestations due to hypomineralization.

CLINICAL DESCRIPTION

Individuals with infantile-HPP may be normal at birth. Clinical signs resembling rickets are generally found between birth and six months of age. Initial manifestations may include irritability, poor feeding, failure to thrive, hypotonia, and more rarely seizures. Other clinical features include growth failure, short stature, blue sclerae, bone hypomineralization (softening or thinning of the skull, rachitic ribs, scoliosis, thickening of wrists and ankles and bowing of long bones), craniosynostosis (possibly with increased intracranial pressure), lax ligaments, and hypercalciuria/hypercalcemia. Some patients have premature loss of deciduous teeth. Kidney damage (nephrocalcinosis due to hypercalciuria) is reported in some older infants. Severity is variable but many affected patients are at risk of respiratory failure due to rachitic deformities of the chest within the first year of life. There may be some clinical overlap with the moderate form, classed as childhood-onset HPP.

Odontohypophosphatasia
SUMMARY

A particular form of hypophosphatasia (HPP) characterized by reduced activity of unfractionated serum alkaline phosphatase, premature exfoliation of primary and/or permanent teeth and/or severe dental caries, in the absence of skeletal system abnormalities.

CLINICAL DESCRIPTION

The main feature of odontohypophosphatasia is premature exfoliation of fully rooted primary teeth and/or severe dental caries. The anterior deciduous teeth are most commonly affected along with the incisors. X-rays reveal reduced alveolar bone, reduced thickness of dentin, and enlarged pulp chambers and root canals. Patients with other forms of HPP often have dental manifestations but these are always associated with skeletal abnormalities and other manifestations.

Perinatal lethal hypophosphatasia
SUMMARY

A rare, genetic form of hypophosphatasia (HPP) characterized by markedly impaired bone mineralization in utero due to reduced activity of serum alkaline phosphatase (ALP) and causing stillbirth or respiratory failure within days of birth.

CLINICAL DESCRIPTION

Affected infants may have characteristic skin-covered osteochondral spurs protruding from the forearms or legs and often a small thoracic cavity. They may have hypercalcemia associated with apnea or seizures, and marked shortening of the long bones. Patients rarely survive for more than a few days due to inadequate chest size, hypoplastic lungs and rachitic deformities, leading to respiratory failure.

Prenatal benign hypophosphatasia
SUMMARY

A very rare form of hypophosphatasia characterized by prenatal skeletal manifestations (limb shortening and bowing) that slowly resolve spontaneously and later may develop into the moderate childhood or adult forms of the disease.

CLINICAL DESCRIPTION

PB-HPP may be identified on prenatal ultrasound examination. Patients manifest variable limb shortening and bowing and often have dimples overlaying long bones deformities. Postnatally, skeletal manifestations slowly resolve and patients eventually develop manifestations corresponding to other, non-lethal forms of HPP (either childhood-onset, adult hypophosphatasia or odontohypophosphatasia). Patients display progressive improvement of the skeletal anomalies and mineralization during the third trimester of pregnancy and after birth. Mothers of affected infants generally have biochemical evidence of hypophosphatasia but no clinical manifestations.

VARIANTS

NM_000478.5(ALPL):c.1001G>A ; NM_000478.5(ALPL):c.1250A>G ; NM_000478.5(ALPL):c.211C>T ; NM_000478.4(ALPL):c.346G>A ; NM_000478.6(ALPL):c.407G>A ; NM_000478.5(ALPL):c.526G>A ; NM_000478.5(ALPL):c.535G>A ; NM_000478.4(ALPL):c.571G>A ; NM_000478.4(ALPL):c.1133A>T ; NM_000478.5(ALPL):c.1306T>C ; NM_000478.5(ALPL):c.1366G>A ; NM_000478.5(ALPL):c.212G>C ; NM_000478.5(ALPL):c.323C>T ; NM_000478.5(ALPL):c.620A>C ; NM_000478.5(ALPL):c.814C>T ; NM_000478.5(ALPL):c.881A>C ; NM_000478.5(ALPL):c.892G>A ; NM_000478.5(ALPL):c.98C>T

GENE

AMT

DISEASES
Atypical glycine encephalopathy
SUMMARY

A rare form of glycine encephalopathy presenting disease onset or clinical manifestations that differ from neonatal or infantile glycine encephalopathy.

CLINICAL DESCRIPTION

Symptoms are mostly non-specific and are not similar to the severe neurological symptoms observed in neonatal and infantile GE (see these terms). Some patients have milder disease with onset from late infancy to adulthood, while others have rapidly progressive severe disease often of late onset. It also includes patients with transient hyperglycinemia, whose symptoms in neonatal period resemble those of neonatal form. Manifestations include cognitive decline, behavioral disorders, ataxia, peripheral neuropathy and optic atrophy.

Infantile glycine encephalopathy
SUMMARY

Infantile glycine encephalopathy is a mild to severe form of glycine encephalopathy (GE; see this term), characterized by early hypotonia, developmental delay and seizures.

CLINICAL DESCRIPTION

Patients present with infantile-onset seizures and variable psychomotor delay after initially normal development, and often have a relatively long history of hypotonia. Seizures of any type are found in less than half of patients and some develop choreoathetosis. Developmental delay mostly affects language and behavioral problems are sometimes found including temper tantrums, irritability, aggressiveness and rage. Attention deficit-hyperactivity disorder (AD-HD) is also sometimes found. Patients do not have lethargy or coma in the neonatal period, unlike those with neonatal GE. The course may be mild or severe (50% of patients in each case).

Neonatal glycine encephalopathy
SUMMARY

Neonatal glycine encephalopathy is a frequent, usually severe form of glycine encephalopathy (GE; see this term) characterized by coma, apnea, hypotonia, seizure and myoclonic jerks in the neonatal period, and subsequent developmental delay.

CLINICAL DESCRIPTION

Patients develop disease manifestations within the first hours or days of life. Symptoms include progressive lethargy, hypotonia, myoclonic jerks leading to apnea. In the absence of intubation and ventilation, apnea may be fatal. With supportive measures, most patients regain spontaneous respiration and some show improvement in alertness over time. Subsequently, they have profound intellectual deficit and increasingly intractable seizures over the first year of life, which often require multiple anticonvulsants. In the vast majority of cases (85%), the course is severe, but some patients have a milder course and less severe clinical outcome. In severe cases, patients make little developmental progress and have limited interaction with their environment. Early spasticity, scoliosis and club feet have also been reported. In milder cases, developmental progress is considerably greater with patients learning to walk and interact, and seizures are generally easier to treat.

VARIANTS

NM_000481.3(AMT):c.139G>A ; NM_000481.3(AMT):c.259-1G>C ; NM_000481.3(AMT):c.574C>T ; NM_000481.3(AMT):c.826G>C ; NM_000481.4:c.125A>G ; NM_000481.3(AMT):c.806G>A ; NM_000481.3(AMT):c.959G>A

GENE

AR

DISEASES
Complete androgen insensitivity syndrome
SUMMARY

Complete androgen insensitivity syndrome (CAIS) is a form of androgen insensitivity syndrome (AIS; see this term), a disorder of sex development (DSD), characterized by the presence of female external genitalia in a 46,XY individual with normal testis development but undescended testes and unresponsiveness to age-appropriate levels of androgens.

CLINICAL DESCRIPTION

The typical presentation is primary amenorrhea in an adolescent female. CAIS may also present in infancy or childhood with an inguinal hernia or labial swelling containing a testis. Breast development at puberty is normal, but pubic and axillary hair is absent or scanty. The external genitalia are normal female but internal female genitalia are absent. Adult patients are tall. Other presentations may be serendipitous from a mismatch in prenatal sexing (XY) and birth female phenotype, history of an inguinal hernia repair in an older sister, or development of a pelvic tumor in later adult life.

Kennedy disease
SUMMARY

Kennedy's disease, also known as bulbospinal muscular atrophy (BSMA), is a rare X-linked recessive motor neuron disease characterized by proximal and bulbar muscle wasting.

CLINICAL DESCRIPTION

Disease onset occurs between 30-60 years of age. Initial clinical manifestations include tremor, muscle cramps, muscle twitching, fatigue and slurred speech. With disease progression patients additionally develop weakness and wasting of the limb and bulbar muscles, manifesting as dysarthria, dysphonia, hanging jaw, tongue wasting, chewing difficulty and impaired mobility. Intellectual decline is minimal to none. In the terminal stages of the disease some patients may be unable to swallow or breathe. Non-neurological manifestations include gynecomastia, hypogonadism (leading to infertility and impotence) and in rare cases Dupuytren's contracture, or groin hernia.

Partial androgen insensitivity syndrome
SUMMARY

A disorder of sex development (DSD) distinct from complete AIS (CAIS) characterized by the presence of abnormal genital development in a 46,XY individual with normal testis development and partial responsiveness to age-appropriate levels of androgens.

CLINICAL DESCRIPTION

Patients have a highly variable genital appearance. The prototypic form of presentation is severe hypospadias, micropenis, and bifid scrotum in which the testes may or may not be descended. In the more severe form of PAIS, patients have female external genitalia with clitoromegaly, partial labial fusion and labial swellings comprising testes. A mild end of the spectrum, labeled MAIS (mild or minimal AIS), is a male with gynecomastia at puberty or an adult presenting with male factor infertility.

Posterior hypospadias
SUMMARY

A rare, non-syndromic, congenital, urogenital tract malformation affecting males and characterized by penoscrotal, scrotal or perineal displacement of the urethral meatus, and commonly associated with curvation of the penis. The scrotum might appear bifid in severe cases, and the boy can also have a micropenis.

CLINICAL DESCRIPTION

The consequences of hypospadias, apart from the appearance, include spraying of the urinary stream, inability to urinate in standing position, and later in life curvature, unless corrected, leads to difficulties during intercourse. Fertility problems and decreased satisfaction with genital appearance are more common. Severe hypospadias and concomitant undescended testis, is regarded as a disorder of sex development (DSD) and should be referred to special multidisciplinary teams for molecular and hormonal evaluation.

VARIANTS

NM_000044.4(AR):c.1174C>T ; NM_000044.4(AR):c.2659A>G ; NM_000044.4(AR):c.1685T>C ; NM_000044.4(AR):c.1720G>C ; NM_000044.4(AR):c.1768+2T>C ; NM_000044.4(AR):c.1805G>A ; NM_000044.4(AR):c.1813G>C ; NM_000044.4(AR):c.1823G>A ; NM_000044.4(AR):c.1850T>C ; NM_000044.4(AR):c.1888C>T ; NM_000044.4(AR):c.2053G>A ; NM_000044.4(AR):c.2090C>A ; NM_000044.4(AR):c.2103G>T ; NM_000044.4(AR):c.2105T>A ; NM_000044.4(AR):c.2137C>A ; NM_000044.4(AR):c.2258G>T ; NM_000044.4(AR):c.2395C>G ; NM_000044.4(AR):c.2504A>G ; NM_000044.4(AR):c.2668G>C ; NM_000044.4(AR):c.2698A>T ; NM_000044.4(AR):c.2723T>A ; NM_000044.4(AR):c.2740C>A ; NC_000023.11:g.67717543G>A ; NM_000044.4(AR):c.1022_1025dup ; NM_000044.4(AR):c.1185C>A ; NM_000044.4(AR):c.1451_1454del ; NM_000044.4(AR):c.1605C>A ; NM_000044.4(AR):c.1614dup ; NM_000044.4(AR):c.1645C>T ; NM_000044.4(AR):c.1688G>A ; NM_000044.4(AR):c.1732G>A ; NM_000044.4(AR):c.1739G>A ; NM_000044.4(AR):c.1739G>T ; NM_000044.4(AR):c.1748T>A ; NM_000044.4(AR):c.1771A>T ; NM_000044.4(AR):c.1789G>A ; NM_000044.4(AR):c.178C>T ; NM_000044.4(AR):c.179dup ; NM_000044.4(AR):c.1804T>G ; NM_000044.4(AR):c.1822C>T ; NM_000044.4(AR):c.1826G>A ; NM_000044.4(AR):c.1846C>T ; NM_000044.4(AR):c.1847G>A ; NM_000044.4(AR):c.1886-1G>A ; NM_000044.4(AR):c.1888delC ; NM_000044.4(AR):c.1943G>A ; NM_000044.2(AR):c.1952delG ; NM_000044.4(AR):c.2033T>C ; NM_000044.4(AR):c.2039_2056del ; NM_000044.4(AR):c.2044G>A ; NM_000044.4(AR):c.2069A>C ; NM_000044.4(AR):c.2086G>A ; NM_000044.4(AR):c.2104C>T ; NM_000044.4(AR):c.2117A>G ; NM_000044.4(AR):c.2123T>G ; NM_000044.4(AR):c.2137C>T ; NM_000044.4(AR):c.214C>T ; NM_000044.4(AR):c.2155T>C ; NM_000044.4(AR):c.2157G>A ; NM_000044.4(AR):c.2164G>A ; NM_000044.4(AR):c.2171C>T ; NM_000044.4(AR):c.2176T>C ; NM_000044.4(AR):c.217C>T ; NM_000044.4(AR):c.2180G>T ; NM_000044.4(AR):c.2191G>A ; NM_000044.4(AR):c.220C>T ; NM_000044.4(AR):c.2222C>G ; NM_000044.4(AR):c.2228T>A ; NM_000044.4(AR):c.2231G>A ; NM_000044.4(AR):c.2231G>T ; NM_000044.4(AR):c.2248A>G ; NM_000044.4(AR):c.2257C>T ; NM_000044.4(AR):c.2258G>A ; NM_000044.4(AR):c.2266delA ; NM_000044.4(AR):c.2281_2287delAGGATGCinsTTCGCCCCTGA ; NM_000044.4(AR):c.2291A>G ; NM_000044.4(AR):c.2296G>A ; NM_000044.4(AR):c.2297C>A ; NM_000044.4(AR):c.2299C>G ; NM_000044.2(AR):c.2301delT ; NM_000044.4(AR):c.2314A>C ; NM_000044.4(AR):c.2318+1G>C ; NM_000044.4(AR):c.2323C>T ; NM_000044.4(AR):c.2324G>A ; NM_000044.4(AR):c.2343G>A ; NM_000044.4(AR):c.2343G>T ; NM_000044.4(AR):c.2359C>T ; NM_000044.4(AR):c.2362A>G ; NM_000044.4(AR):c.2391G>A ; NM_000044.4(AR):c.2420G>A ; NM_000044.4(AR):c.2423T>C ; NM_000044.4(AR):c.2438T>C ; NM_000044.4(AR):c.2450-1G>A ; NM_000044.4(AR):c.2450-6C>G ; NM_000044.4(AR):c.2495G>A ; NM_000044.4(AR):c.2521C>T ; NM_000044.4(AR):c.2522G>A ; NM_000044.4(AR):c.2562_2563delAA ; NM_000044.4(AR):c.2566C>T ; NM_000044.4(AR):c.2567G>A ; NM_000044.4(AR):c.2571C>G ; NM_000044.4(AR):c.2593G>A ; NM_000044.4(AR):c.2596T>C ; NM_000044.4(AR):c.2599G>A ; NM_000044.4(AR):c.2599G>T ; NM_000044.4(AR):c.2610T>G ; NM_000044.4(AR):c.2612C>T ; NM_000044.4(AR):c.2613delG ; NM_000044.4(AR):c.2623C>T ; NM_000044.4(AR):c.2632A>G ; NM_000044.4(AR):c.2633C>G ; NM_000044.4(AR):c.2650A>T ; NM_000044.4(AR):c.2667C>T ; NM_000044.4(AR):c.2668G>A ; NM_000044.4(AR):c.2686_2688delATG ; NM_000044.4(AR):c.2708A>G ; NM_000044.4(AR):c.2720_2721delTC ; NM_000044.4(AR):c.292C>T ; NM_000044.4(AR):c.321C>A ; NM_000044.3:c.340C-T ; NM_000044.4(AR):c.393C>A ; NM_000044.4(AR):c.475G>A ; NM_000044.4(AR):c.4G>A ; NM_000044.4(AR):c.521T>G ; NM_000044.4(AR):c.692_696dup ; NM_000044.4(AR):c.743G>T ; NM_000044.4(AR):c.749dup ; NM_000044.4(AR):c.796dup ; NM_000044.4(AR):c.830_845dup ; NM_000044.4(AR):c.865G>T ; NC_000023.11:g.67545902_67545911del ; NC_000023.11:g.67546456_67546457CT[2] ; NC_000023.11:g.67643361_67643362TC[1] ; NC_000023.11:g.67711413A>T ; NC_000023.11:g.67721968G>T ; NC_000023.11:g.67722905T>C ; NC_000023.11:g.67722923dup ; NC_000023.11:g.67723756C>T

GENE

ARG1

DISEASES
Argininemia
SUMMARY

A rare autosomal recessive amino acid metabolism disorder characterized clinically by variable degrees of hyperammonemia, developing from about 3 years of age, and leading to progressive loss of developmental milestones and spasticity in the absence of treatment.

CLINICAL DESCRIPTION

Arginase deficiency is an autosomal recessive inborn error of metabolism caused by a defect in the final step in the urea cycle, the hydrolysis of arginine to urea and ornithine.

VARIANTS

NM_000045.3(ARG1):c.892G>C ; NM_000045.3(ARG1):c.129delA ; NM_000045.3(ARG1):c.130+1G>T ; NM_000045.3(ARG1):c.272dupG ; NM_000045.3(ARG1):c.2T>C ; NM_000045.3(ARG1):c.372dup ; NM_000045.3(ARG1):c.466-2A>G ; NM_000045.3(ARG1):c.58-2A>C ; NM_000045.3(ARG1):c.640_643dup ; NM_000045.3(ARG1):c.693delT ; NM_000045.3(ARG1):c.709G>A ; NM_000045.3(ARG1):c.787G>T ; NM_000045.3(ARG1):c.871C>T ; NM_000045.3(ARG1):c.874delA ; NC_000006.12:g.131573285G>A ; c.130+1G>A ; NM_000045.3(ARG1):c.189delC ; c.287_290del ; NM_000045.3(ARG1):c.32T>C ; NM_000045.3(ARG1):c.365G>A ; NM_000045.3(ARG1):c.383A>G ; NM_000045.3(ARG1):c.413G>T ; NM_000045.3(ARG1):c.466-1G>C ; NM_000045.3(ARG1):c.57+1G>A ; NM_000045.3(ARG1):c.61C>T ; NM_000045.3(ARG1):c.703G>C ; NM_000045.3:c.77delA ; NM_000045.3(ARG1):c.844delC ; NM_000045.3(ARG1):c.869C>G ; NM_000045.3(ARG1):c.938delA

GENE

ARSA

DISEASES
Metachromatic leukodystrophy, adult form
SUMMARY

The metachromatic leukodystrophies comprise several allelic disorders. 7 forms are recognized: 5 allelic forms of MLD: late infantile, juvenile, and adult forms, partial cerebroside sulfate deficiency, and pseudoarylsulfatase A deficiency; and 2 nonallelic forms: metachromatic leukodystrophy due to saposin B deficiency and multiple sulfatase deficiency or juvenile sulfatidosis, a disorder that combines features of a mucopolysaccharidosis with those of metachromatic leukodystrophy.

CLINICAL DESCRIPTION

A subtype of Metachromatic leukodystrophy characterized by progressive psychomotor regression with an insidious onset after the age of 16 years, most often beginning with intellectual and behavioral changes, such as memory deficits or emotional instability. The clinical picture is dominated by gradual cognitive, later also motor, decline, taking a protracted course with periods of waxing and waning. Decerebration and death occur within decades after disease onset.

Metachromatic leukodystrophy, juvenile form
SUMMARY

The metachromatic leukodystrophies comprise several allelic disorders. 7 forms are recognized: 5 allelic forms of MLD: late infantile, juvenile, and adult forms, partial cerebroside sulfate deficiency, and pseudoarylsulfatase A deficiency; and 2 nonallelic forms: metachromatic leukodystrophy due to saposin B deficiency and multiple sulfatase deficiency or juvenile sulfatidosis, a disorder that combines features of a mucopolysaccharidosis with those of metachromatic leukodystrophy.

CLINICAL DESCRIPTION

A subtype of Metachromatic leukodystrophy characterized by progressive psychomotor regression with an onset between 30 months and 16 years of age, often beginning with behavioral abnormalities or deterioration of school performance. Further manifestations are ataxia, gait disturbances, reduced deep tendon reflexes, spasticity, seizures, paralysis, dementia, and loss of speech, vision, and hearing, eventually resulting in complete loss of motor and cognitive skills, and decerebration. The rate of deterioration is variable with possible survival up to the third decade of life.

Metachromatic leukodystrophy, late infantile form
SUMMARY

The metachromatic leukodystrophies comprise several allelic disorders. 7 forms are recognized: 5 allelic forms of MLD: late infantile, juvenile, and adult forms, partial cerebroside sulfate deficiency, and pseudoarylsulfatase A deficiency; and 2 nonallelic forms: metachromatic leukodystrophy due to saposin B deficiency and multiple sulfatase deficiency or juvenile sulfatidosis, a disorder that combines features of a mucopolysaccharidosis with those of metachromatic leukodystrophy.

CLINICAL DESCRIPTION

A subtype of Metachromatic leukodystrophy characterized by rapidly progressive psychomotor regression with an onset before 30 months of age after a period of apparently normal development. Manifestations developing during the course of the disease are impaired feeding and swallowing due to pseudobulbar palsies, seizures, painful spasms, muscle weakness, ataxia, paralysis, dementia, and loss of speech, vision, and hearing, quickly resulting in complete loss of motor and cognitive skills, and decerebration. Death occurs within the first decade of life.

NON RARE IN EUROPE: Pseudoarylsulfatase A deficiency
SUMMARY

The metachromatic leukodystrophies comprise several allelic disorders. Kihara (1982) recognized 5 allelic forms of MLD: late infantile, juvenile, and adult forms, partial cerebroside sulfate deficiency, and pseudoarylsulfatase A deficiency; and 2 nonallelic forms: metachromatic leukodystrophy due to saposin B deficiency and multiple sulfatase deficiency or juvenile sulfatidosis, a disorder that combines features of a mucopolysaccharidosis with those of metachromatic leukodystrophy.

CLINICAL DESCRIPTION

Pseudoarylsulfatase A deficiency refers to a condition of apparent ARSA enzyme deficiency in persons without neurologic abnormalities. Dubois et al. (1977) described very low arylsulfatase A and cerebroside sulfatase activities in leukocytes of healthy members of a metachromatic leukodystrophy family. Langenbeck et al. (1977) proposed a one locus, multiple allele hypothesis to explain the peculiar findings in that kindred

VARIANTS

NM_000487.5(ARSA):c.1174C>T ; NM_000487.5(ARSA):c.1175G>A ; NM_000487.6(ARSA):c.369_374delCGGCAAinsAACCTTGGG ; NM_000487.5(ARSA):c.370G>A ; NM_000487.5(ARSA):c.674A>G ; NM_000487.5(ARSA):c.917C>T ; NM_000487.5(ARSA):c.931G>A ; NM_000487.5(ARSA):c.1010A>T ; NM_000487.5(ARSA):c.1036delG ; NM_000487.5(ARSA):c.109_116del8 ; NM_000487.5(ARSA):c.1107+1delG ; NM_000487.5(ARSA):c.1114C>T ; NM_000487.5(ARSA):c.1150G>A ; NM_000487.5(ARSA):c.1222_1232del11 ; NM_000487.5(ARSA):c.1264delC ; NM_000487.5(ARSA):c.1323delC ; NM_000487.5(ARSA):c.1337delG ; NM_000487.5(ARSA):c.1344dup ; NM_000487.5(ARSA):c.1388delT ; NM_000487.5(ARSA):c.1489_1492dupCCCC ; NM_000487.5(ARSA):c.1492dupC ; NM_000487.5(ARSA):c.185_186dup ; NM_000487.5(ARSA):c.195delC ; NM_000487.5(ARSA):c.206_209delCTCT ; NM_000487.5(ARSA):c.211_212delTG ; NM_000487.5(ARSA):c.224+1G>A ; NM_000487.5(ARSA):c.225-2A>G ; NM_000487.5(ARSA):c.227_228insTA ; NM_000487.5(ARSA):c.240dupC ; NM_000487.5:c.244delC ; NM_000487.5(ARSA):c.293C>T ; NM_000487.5(ARSA):c.295dup ; NM_000487.5(ARSA):c.2T>C ; NM_000487.5(ARSA):c.302G>A ; NM_000487.5(ARSA):c.304delC ; NM_000487.5(ARSA):c.418delC ; NM_000487.5(ARSA):c.418dupC ; NM_000487.5(ARSA):c.421C>T ; NM_000487.5(ARSA):c.465+2T>A ; NM_000487.5(ARSA):c.466-2A>G ; NM_000487.5(ARSA):c.494dupC ; NM_000487.5(ARSA):c.526C>T ; NM_000487.5(ARSA):c.542T>G ; NM_000487.5(ARSA):c.542dup ; NM_000487.5(ARSA):c.545delC ; NM_000487.5(ARSA):c.608A>G ; NM_000487.5(ARSA):c.622delC ; NM_000487.5(ARSA):c.674_675dupAT ; NM_000487.5(ARSA):c.736C>T ; NM_000487.5(ARSA):c.737G>A ; NM_000487.5(ARSA):c.739G>A ; NM_000487.5(ARSA):c.746T>C ; NM_000487.5(ARSA):c.758dup ; NM_000487.5(ARSA):c.763G>A ; NM_000487.5(ARSA):c.827C>T ; NM_000487.5(ARSA):c.868C>T ; NM_000487.5(ARSA):c.869G>A ; NM_000487.5(ARSA):c.877C>T ; NM_000487.5(ARSA):c.883G>A ; NM_000487.5(ARSA):c.891delC ; NM_000487.5(ARSA):c.925dup ; NM_000487.5(ARSA):c.926A>T ; NM_000487.5(ARSA):c.929delG ; NM_000487.5(ARSA):c.938G>A ; NM_000487.5(ARSA):c.979+1G>A ; NM_000487.5(ARSA):c.979_979+3delGGTC ; NM_000487.5(ARSA):c.980-2A>C ; NM_000487.5(ARSA):c.986C>T ; NM_000487.5(ARSA):c.991G>T ; NM_000487.5(ARSA):c.1108-2A>G ; NM_000487.5(ARSA):c.1125_1126delCT ; NM_000487.6:c.1136C>T ; NM_000487.5(ARSA):c.1201_1203delTTC ; NM_000487.5(ARSA):c.1210+1G>A ; NM_000487.5(ARSA):c.1229C>T ; NM_000487.5(ARSA):c.1232C>T ; NM_000487.5:c.1241delC ; NM_000487.5(ARSA):c.1274A>G ; NM_000487.5(ARSA):c.1279C>A ; NM_000487.5(ARSA):c.1283C>T ; NM_000487.5:c.1401_1411delGTTAGACGCAG ; NM_000487.5(ARSA):c.1408_1418del11 ; NM_000487.5(ARSA):c.1462C>T ; NM_000487.5(ARSA):c.229G>C ; NM_001085427.2(ARSA):c.245G>A ; NM_000487.5(ARSA):c.256C>T ; NM_000487.5(ARSA):c.257G>A ; NM_000487.5(ARSA):c.263G>A ; NM_000487.5(ARSA):c.302delG ; NM_000487.5(ARSA):c.346C>T ; NM_000487.5(ARSA):c.34delG ; NM_000487.5(ARSA):c.410T>C ; NM_000487.5(ARSA):c.465+1G>A ; NM_000487.5(ARSA):c.467G>A ; NM_000487.5(ARSA):c.470C>G ; NM_000487.5(ARSA):c.474C>A ; NM_000487.5(ARSA):c.495_501del7 ; NM_000487.5(ARSA):c.506C>G ; NM_000487.5(ARSA):c.545C>G ; NM_000487.5:c.582delC ; NM_000487.5(ARSA):c.583delT ; NM_001085428.2(ARSA):c.632C>A ; NM_000487.5(ARSA):c.641C>T ; NM_000487.5(ARSA):c.697C>A ; NM_000487.5(ARSA):c.769G>C ; NM_000487.5(ARSA):c.852T>A ; NM_000487.5:c.854.1G-A ; NM_000487.5(ARSA):c.862A>C ; NM_000487.5(ARSA):c.899T>C ; NM_000487.5(ARSA):c.905G>T ; NM_000487.5(ARSA):c.937C>T ; NM_000487.5(ARSA):c.960G>A ; NM_000487.5(ARSA):c.979G>A ; NM_000487.5(ARSA):c.98T>C ; NC_000022.11:g.50627623G>A

GENE

ARSB

DISEASES
Mucopolysaccharidosis type 6, rapidly progressing
SUMMARY

Mucopolysaccharidosis type 6 (MPS 6) is a lysosomal storage disease with progressive multisystem involvement, associated with a deficiency of arylsulfatase B (ASB) leading to the accumulation of dermatan sulfate.

CLINICAL DESCRIPTION

The disorder shows a wide spectrum of symptoms from slowly to rapidly progressing forms. The characteristic skeletal dysplasia includes short stature, dysostosis multiplex and degenerative joint disease. Rapidly progressing forms may have onset from birth, elevated urinary glycosaminoglycans (GAG, generally >100 microgram/mg creatinine), severe dysostosis multiplex, short stature, and death before the 2nd or 3rd decades. A more slowly progressing form has been described as having later onset, mildly elevated glycosaminoglycans (generally <100 microgram/mg creatinine), mild dysostosis multiplex, with death in the 4th or 5th decades. Other clinical findings may include cardiac valve disease, reduced pulmonary function, hepatosplenomegaly, sinusitis, otitis media, hearing loss, sleep apnea, corneal clouding, carpal tunnel disease, and inguinal or umbilical hernia. Although intellectual deficit is generally absent in MPS 6, central nervous system findings may include cervical cord compression caused by cervical spinal instability, meningeal thickening and/or bony stenosis, communicating hydrocephalus, optic nerve atrophy and blindness.

Mucopolysaccharidosis type 6, slowly progressing
SUMMARY

Mucopolysaccharidosis type 6 (MPS 6) is a lysosomal storage disease with progressive multisystem involvement, associated with a deficiency of arylsulfatase B (ASB) leading to the accumulation of dermatan sulfate.

CLINICAL DESCRIPTION

The disorder shows a wide spectrum of symptoms from slowly to rapidly progressing forms. The characteristic skeletal dysplasia includes short stature, dysostosis multiplex and degenerative joint disease. Rapidly progressing forms may have onset from birth, elevated urinary glycosaminoglycans (GAG, generally >100 microgram/mg creatinine), severe dysostosis multiplex, short stature, and death before the 2nd or 3rd decades. A more slowly progressing form has been described as having later onset, mildly elevated glycosaminoglycans (generally <100 microgram/mg creatinine), mild dysostosis multiplex, with death in the 4th or 5th decades. Other clinical findings may include cardiac valve disease, reduced pulmonary function, hepatosplenomegaly, sinusitis, otitis media, hearing loss, sleep apnea, corneal clouding, carpal tunnel disease, and inguinal or umbilical hernia. Although intellectual deficit is generally absent in MPS 6, central nervous system findings may include cervical cord compression caused by cervical spinal instability, meningeal thickening and/or bony stenosis, communicating hydrocephalus, optic nerve atrophy and blindness.

VARIANTS

NM_000046.4(ARSB):c.1178A>C ; NM_000046.4(ARSB):c.1214G>A ; NM_000046.4(ARSB):c.1325C>T ; NM_000046.4(ARSB):c.1340G>T ; NM_000046.4(ARSB):c.1449A>T ; NM_000046.4(ARSB):c.1450A>G ; NM_000046.4(ARSB):c.215T>A ; NM_000046.4(ARSB):c.288C>G ; NM_000046.4(ARSB):c.960C>G ; NM_000046.4(ARSB):c.1048A>T ; NM_000046.4(ARSB):c.1052C>T ; NM_000046.4(ARSB):c.1079T>C ; NM_000046.4(ARSB):c.108_120del ; NM_000046.4(ARSB):c.1127T>A ; NM_000046.4(ARSB):c.1130G>A ; NM_000046.4(ARSB):c.1142+2T>A ; NM_000046.4(ARSB):c.1143-8T>G ; NM_000046.4(ARSB):c.114del ; NM_000046.4(ARSB):c.1161dup ; NM_000046.4(ARSB):c.1168G>A ; NM_000046.5(ARSB):c.1197C>G ; NM_000046.4(ARSB):c.1214-2A>G ; NM_000046.4(ARSB):c.1279del ; NM_000046.4(ARSB):c.1286dup ; NM_000046.4(ARSB):c.1289A>G ; NM_000046.4(ARSB):c.1350G>C ; NM_000046.4(ARSB):c.1391C>A ; NM_000046.4(ARSB):c.1394C>G ; NM_000046.4(ARSB):c.1415T>C ; NM_000046.4(ARSB):c.1475del ; NM_000046.4(ARSB):c.1482del ; NM_000046.4(ARSB):c.1493T>C ; NM_000046.4(ARSB):c.149T>A ; NM_000046.4(ARSB):c.1507C>T ; NM_000046.4(ARSB):c.1539C>G ; NM_000046.4(ARSB):c.157G>A ; NM_000046.4(ARSB):c.160G>A ; NM_000046.4(ARSB):c.176A>T ; NM_000046.3(ARSB):c.200T>A ; NM_000046.4(ARSB):c.207_213dup ; NM_000046.4(ARSB):c.215T>G ; NM_000046.5(ARSB):c.219_230delCGCGCTGGCGGCinsG ; NM_000046.4(ARSB):c.219del ; NM_000046.4(ARSB):c.223_232del ; NM_000046.4(ARSB):c.237_243del ; NM_000046.4(ARSB):c.245T>G ; NM_000046.4(ARSB):c.245del ; NM_000046.4(ARSB):c.247_248del ; NM_000046.4(ARSB):c.253T>C ; NM_000046.4(ARSB):c.263dup ; NM_000046.5(ARSB):c.281C>A ; NM_000046.4(ARSB):c.284G>A ; NM_000046.4(ARSB):c.289C>T ; NM_000046.3(ARSB):c.290A>G ; NM_000046.4(ARSB):c.293T>A ; NM_000046.4(ARSB):c.293T>G ; NM_000046.3(ARSB):c.317G>C ; NM_000046.4(ARSB):c.328C>T ; NM_000046.4(ARSB):c.349T>C ; NM_000046.4(ARSB):c.375dup ; NM_000046.4(ARSB):c.395T>C ; NM_000046.4(ARSB):c.430G>A ; NM_000046.4(ARSB):c.438G>A ; NM_000046.4(ARSB):c.479G>A ; NM_000046.4(ARSB):c.509T>G ; NM_000046.4(ARSB):c.511G>A ; NM_000046.4(ARSB):c.532C>G ; NM_000046.4(ARSB):c.533A>T ; NM_000046.4(ARSB):c.574T>C ; NM_000046.4(ARSB):c.630_636del ; NM_000046.4(ARSB):c.659_660del ; NM_000046.4(ARSB):c.667A>G ; NM_000046.4(ARSB):c.691-1G>A ; NM_000046.4(ARSB):c.750_754delATACTinsCCTGAAG ; NM_000046.4(ARSB):c.750_754delATACTinsCCTGAAGTCAAG ; NM_000046.4(ARSB):c.765T>A ; NM_000046.4(ARSB):c.785dup ; NM_000046.4(ARSB):c.883_884dup ; NM_000046.4(ARSB):c.887T>A ; NM_000046.4(ARSB):c.903C>G ; NM_000046.4(ARSB):c.908G>A ; NM_000046.5(ARSB):c.936G>T ; NM_000046.4(ARSB):c.937C>G ; NM_000046.4(ARSB):c.943C>T ; NM_000046.4(ARSB):c.944G>A ; NM_000046.4(ARSB):c.971G>T ; NM_000046.4(ARSB):c.995T>G ; NC_000005.10:g.78780563dup ; NC_000005.10:g.78885744C>G ; NM_000046.4(ARSB):c.1036del ; NM_000046.4(ARSB):c.1059G>A ; NM_000046.4(ARSB):c.1142+1G>T ; NM_000046.4(ARSB):c.1142+2T>C ; NM_000046.4(ARSB):c.1143-1G>C ; NM_000046.4(ARSB):c.116_123delCCGGGGCC ; NM_000046.3(ARSB):c.118_134del17 ; NM_000046.4(ARSB):c.1208C>G ; NM_000046.4(ARSB):c.1208del ; NM_000046.4(ARSB):c.1213+6T>C ; NM_000046.5(ARSB):c.123_139dup ; NM_000046.4(ARSB):c.1261G>T ; NM_000046.4(ARSB):c.1336+2T>G ; NM_000046.4(ARSB):c.1366C>T ; NM_000046.4(ARSB):c.152T>C ; NM_000046.4(ARSB):c.1577del ; NM_000046.4(ARSB):c.189_190insA ; NM_000046.4(ARSB):c.208_215del ; NM_000046.4(ARSB):c.238del ; NM_000046.4(ARSB):c.257delA ; NM_000046.4(ARSB):c.262C>T ; NM_000046.4(ARSB):c.270_274del ; NM_000046.4(ARSB):c.281C>T ; NM_000046.5(ARSB):c.427del ; NM_000046.4(ARSB):c.454C>T ; NM_000046.4(ARSB):c.478C>T ; NM_000046.4(ARSB):c.498del ; NM_000046.4(ARSB):c.571C>T ; NM_000046.4(ARSB):c.589C>T ; NM_000046.4(ARSB):c.629A>G ; NM_000046.4(ARSB):c.743del ; NM_000046.4(ARSB):c.753C>G ; NM_000046.3:c.921delA ; NM_000046.4(ARSB):c.962T>C ; NM_000046.4(ARSB):c.966G>A ; NM_000046.5(ARSB):c.979C>T ; NC_000005.10:g.78955370C>A

GENE

ASL

DISEASES
Argininosuccinic aciduria
SUMMARY

A rare, genetic disorder of urea cycle metabolism typically characterized by either a severe, neonatal-onset form that manifests with hyperammonemia accompanied with vomiting, hypothermia, lethargy and poor feeding in the first few days of life, or late-onset forms that manifest with stress- or infection-induced episodic hyperammonemia or, in some, behavioral abnormalities and/or learning disabilities, or chronic liver disease. Patients often manifest liver dysfunction.

CLINICAL DESCRIPTION

ASA can have a variable clinical picture with either a neonatal-onset or a late-onset (at any age outside the newborn period). Neonates with severe neonatal-onset ASA usually appear normal during the first 24-48 hours after birth but within a few days present with severe hyperammonemia manifesting with lethargy, somnolence, refusal to feed, vomiting, tachypnea and respiratory alkalosis. If untreated, worsening lethargy, seizures, coma and death may occur. Late-onset ASA is usually triggered by an acute infection, stress or after high protein intake. A presentation of late-onset cognitive impairment or learning disabilities in the absence of hyperammonemic episodes has also been reported. Some patients can be clinically asymptomatic despite showing clear biochemical signs of the disease. Long-term complications associated with both forms of ASA include chronic hepatomegaly, liver dysfunction (fibrosis or cirrhosis), neurocognitive deficits (i.e. cognitive impairment, seizures, and developmental delay), brittle hair (i.e. trichorrhexis nodosa), hypokalemia and arterial hypertension.

VARIANTS

NM_000048.3(ASL):c.1045_1057delGTCATCTCTACGC ; NM_000048.3(ASL):c.1135C>T ; NM_001024943.1(ASL):c.1153C>T ; NM_001024943.1(ASL):c.1255_1256delCT ; NM_001024943.1(ASL):c.337C>T ; NM_000048.3(ASL):c.35G>A ; NM_000048.3(ASL):c.539T>G ; NM_000048.3(ASL):c.578G>A ; NM_001024943.1(ASL):c.602+1G>A ; NM_000048.3(ASL):c.1060C>T ; c.1144-2A>G ; NM_000048.3:c.1369dupG ; NM_001024943.2:c.346C>T ; NM_000048.3(ASL):c.446+1G>A ; c.525-2A>T ; NM_000048.3(ASL):c.532G>A ; NM_000048.3(ASL):c.544C>T ; NM_000048.3(ASL):c.857A>G ; NC_000007.14:g.66092883C>T

GENE

ASPA

DISEASES
Mild Canavan disease
SUMMARY

Mild Canavan disease (CD) is a neurodegenerative disorder characterized by mild speech delay or motor development.

CLINICAL DESCRIPTION

Mild CD usually presents in childhood with mild developmental delay or problems with speech or motor development. Head circumference is usually normal. Retinitis pigmentosa (see this term) may be present. .

Severe Canavan disease
SUMMARY

Severe Canavan disease (CD) is a rapidly progressing neurodegenerative disorder characterized by leukodystrophy with macrocephaly, severe developmental delay and hypotonia.

CLINICAL DESCRIPTION

Onset of severe CD is in infancy. Patients have hypotonia, head lag, and macrocephaly. Developmental delay is most frequently noticed between the 3rd and 5th months of life: patients fail to achieve independent sitting, ambulation and speech. The head circumference increases after the age of 6 months and is usually above the 90th percentile by one year of age. With age, hypotonia progresses to spasticity, seizures may occur and optic atrophy is apparent. Children are often irritable and exhibit sleep disturbance. Gastro-esophageal reflux leads to feeding difficulties, requiring nasogastric feeding or permanent feeding gastrostomy.

VARIANTS

NM_000049.2(ASPA):c.212G>A ; NM_001128085.1(ASPA):c.433-2A>G ; NM_001128085.1(ASPA):c.654C>A ; NM_000049.4:c.693C>A ; NM_000049.4:c.854A>C ; NM_000049.2(ASPA):c.914C>A

GENE

ASS1

DISEASES
Acute neonatal citrullinemia type I
SUMMARY

A severe form of citrullinemia type 1 characterized biologically by hyperammonemia and clinically by progressive lethargy, poor feeding and vomiting, seizures and possible loss of consciousness, within one to a few days of birth, with variable signs of increased intracranial pressure. The condition can lead to significant neurologic deficits.

CLINICAL DESCRIPTION

Adult-onset citrullinemia type I
SUMMARY

A form of citrullinemia type I characterized clinically by adult onset of symptoms including variable hyperammonemia and less striking neurological findings which may include intense headache, scotomas, migraine-like episodes, ataxia, slurred speech, lethargy and drowsiness. Serious increased intracranial pressure may occur.

CLINICAL DESCRIPTION

VARIANTS

NM_000050.4(ASS1):c.1088G>A ; NM_000050.4(ASS1):c.470G>A ; NM_000050.4(ASS1):c.805G>A ; NM_000050.4(ASS1):c.919C>T ; NM_000050.4(ASS1):c.1087C>T ; NM_000050.4(ASS1):c.1168G>A ; NM_000050.4(ASS1):c.1194-1G>C ; NM_000050.4(ASS1):c.256C>T ; NM_000050.4(ASS1):c.349G>A ; NM_000050.4(ASS1):c.40G>A ; NM_000050.4(ASS1):c.496-2A>G ; NM_000050.4(ASS1):c.539G>A ; NM_000050.4(ASS1):c.571G>A ; NM_000050.4(ASS1):c.787G>A ; NM_000050.4(ASS1):c.794G>A ; NM_000050.4(ASS1):c.814C>T ; NM_000050.4(ASS1):c.835C>T ; NM_000050.4(ASS1):c.836G>A ; NM_000050.4(ASS1):c.970+5G>A ; NM_000050.4(ASS1):c.970G>A ; NM_000050.4(ASS1):c.1085G>T ; NM_000050.4(ASS1):c.257G>A ; NM_000050.4(ASS1):c.421-2A>G ; NM_000050.4(ASS1):c.535T>C ; NM_000050.4(ASS1):c.793C>T ; NM_000050.4(ASS1):c.910C>T

GENE

ATP7A

DISEASES
Menkes disease
SUMMARY

A rare congenital disorder of copper metabolism with severe multisystemic manifestations that are primarily characterized by progressive neurodegeneration and marked connective tissue anomalies. A pathognomonic feature is the typical sparse, abnormal steely hair.

CLINICAL DESCRIPTION

Menkes disease (MD) manifests in the neonatal period. Most patients are born at term with appropriate birth measurements. Cephalohematomas and spontaneous fractures are occasionally observed at birth. In the early neonatal period, patients may present with prolonged jaundice, hypothermia, hypoglycemia and feeding difficulties. Pectus excavatum and umbilical and inguinal hernias have also been reported. Unusual sparse and dull scalp hair is often the initial observation at the age of 1-2 months. Characteristically, the hair appears hypopigmented/depigmented, resembles steel wool and is friable, especially in the areas of the scalp subjected to friction. Additional symptoms are failure to thrive, poor eating, vomiting, and diarrhea. The appearance of pale skin, frontal or occipital bossing, micrognathia and pudgy cheeks may be observed. Patients develop gradual motor dysfunction and seizures. Muscular hypotonia in early life is replaced later-on by spasticity and weakness of the extremities. The clinical course is usually severe. Variable forms exist with occipital horn syndrome (OHS) being the mildest recognized form, which further presents with prominent bony exostoses and bladder diverticula.

Occipital horn syndrome
SUMMARY

A rare congenital disorder of copper metabolism that is principally characterized by bony exostoses (including the pathognomonic occipital horns), and connective tissue manifestations with cutis laxa and bladder diverticula. Central nervous system involvement is variable.

CLINICAL DESCRIPTION

Age of onset ranges from infancy to childhood. Observations at birth may include cephalhematoma (12% of cases), loose and wrinkled skin, and umbilical or inguinal hernias. About one third of all patients primarily present with central nervous system involvement (hypotonia, developmental delay and/or seizures). Initial clinical presentation may occur later with bladder diverticula or skeletal manifestations. Bladder diverticula affects the majority of patients (>80%) and may manifest through recurrent urinary tract infections or pollakisuria. The most typical skeletal manifestation (present in 96% of all patients) is an exostosis on the occiput at the insertion of the trapezoid muscle (occipital horn), but exostoses may also occur on the tibia and radius. Other, more variable, skeletal features are hammer-shaped claviculae, scoliosis, pectus deformity, coxa valga, genua valga as well as dislocations of the radial head. Less frequently reported skeletal manifestations include bowing of the long bones, mid-diaphyseal broadening, metaphyseal spurring, rounding of the iliac wings and, rarely, osteopenia. Facial features become distinctive with age and includes a long face (46%), large ears (38%), sagging cheeks (45%) and coarse hair (74%). Trichoscopy may show pili torti. The skin is often hyperextensible and soft with fine wrinkling on the hands and feet. Skin redundancy is remarkable on the belly. Vascular tortuosity is common in the intracranial arteries (65%), but may also affect the cervical, splenic and splanchnic circulation and imposes a risk for aneurysm formation. Aortic root dilatation and dissection may rarely occur. Dysautonomia with postural orthostatic hypotension, temperature instability and chronic diarrhea is present in most patients (>90%). About half of all patients show a delayed motor development due to muscle hypotonia and joint hypermobility, and may report unusual clumsiness. Distal motor neuropathy has been recorded in at least one patient. About half of all patients have intellectual disability (ID) which is usually mild, but moderate to severe impairment may occur.

X-linked distal spinal muscular atrophy type 3
SUMMARY

X-linked distal spinal muscular atrophy type 3 is a rare distal hereditary motor neuropathy characterized by slowly progressive atrophy and weakness of distal muscles of hands and feet with normal deep tendon reflexes or absent ankle reflexes and minimal or no sensory loss, sometimes mild proximal weakness in the legs and feet and hand deformities in males.

CLINICAL DESCRIPTION

The disorder was transmitted in an X-linked recessive pattern of inheritance. In 6 of 9 patients who were examined, age at onset ranged from 1 to 10 years, and the first detected symptom was foot deformity (pes cavus or pes varus); gait instability was reported in 2 other individuals. Subsequently, distal lower limb weakness and atrophy were observed, and finally, the hands were affected. Despite the large clinical variability, the disease progression was very slow and independent gait was maintained even late in life. There was no cognitive, pyramidal, or sensory impairment. EMG showed chronic denervation, muscle biopsy showed a neurogenic pattern, and sural nerve biopsy was normal.

VARIANTS

NM_000052.6(ATP7A):c.2903A>G ; NM_000052.6(ATP7A):c.2981C>T ; NM_000052.6(ATP7A):c.3002C>T ; NM_000052.6(ATP7A):c.4156C>T ; NM_000052.6(ATP7A):c.1885G>C ; NM_000052.6(ATP7A):c.1996G>A ; NM_000052.6(ATP7A):c.2172G>T ; NM_000052.6(ATP7A):c.2183G>A ; NM_000052.6(ATP7A):c.2750T>A ; NM_000052.6(ATP7A):c.2781G>C ; NM_000052.6(ATP7A):c.2972C>A ; NM_000052.7(ATP7A):c.3013G>A ; NM_000052.6(ATP7A):c.3111+1G>A ; NM_000052.4(ATP7A):c.3137C>T ; NM_000052.6(ATP7A):c.3140G>A ; NM_000052.6(ATP7A):c.3294+1G>T ; NM_000052.6(ATP7A):c.3352G>T ; NM_000052.6(ATP7A):c.3800A>T ; NM_000052.6(ATP7A):c.3801+4A>G ; NM_000052.4(ATP7A):c.3812delC ; NM_000052.6(ATP7A):c.4006-1G>A ; NM_000052.6(ATP7A):c.4123G>A ; NM_000052.6(ATP7A):c.4187C>T ; NM_000052.6(ATP7A):c.1006G>T ; NM_000052.6(ATP7A):c.1020_1024dupGGGGC ; NM_000052.6(ATP7A):c.1205delA ; NM_000052.6(ATP7A):c.1225C>T ; NM_000052.6(ATP7A):c.1355delT ; NM_001282224.1(ATP7A):c.1435C>T ; NM_000052.6(ATP7A):c.1460C>A ; NM_000052.6(ATP7A):c.1537G>T ; NM_000052.6(ATP7A):c.1544-1G>A ; NM_000052.6(ATP7A):c.1639C>T ; NM_000052.6(ATP7A):c.1667_1668delTA ; NM_000052.6(ATP7A):c.1707+1G>A ; NM_000052.4(ATP7A):c.1707+6_1707+9delTAAG ; NM_000052.6(ATP7A):c.1782C>G ; NM_000052.6(ATP7A):c.1831G>T ; NM_000052.6(ATP7A):c.1870-1G>C ; NM_000052.6(ATP7A):c.1874T>G ; NM_000052.6(ATP7A):c.1910C>T ; NM_000052.7(ATP7A):c.1933C>T ; NM_000052.6(ATP7A):c.1946+1G>C ; NM_000052.6(ATP7A):c.1946+5G>A ; NM_000052.6(ATP7A):c.1947-1G>A ; NM_000052.6(ATP7A):c.1947-1G>C ; NM_000052.6:c.1947-1_1947insATAAG ; NM_000052.6(ATP7A):c.1950G>A ; NM_000052.6(ATP7A):c.1974_1977dupGTTT ; NM_000052.6(ATP7A):c.1978_2008dup31 ; NM_000052.6(ATP7A):c.1996G>C ; NM_000052.6(ATP7A):c.2160T>A ; NM_000052.6(ATP7A):c.2172+5G>C ; NM_000052.6(ATP7A):c.2173-2A>G ; NM_000052.6(ATP7A):c.2179G>A ; NM_000052.6(ATP7A):c.2179G>T ; NM_000052.6(ATP7A):c.2187G>A ; NM_000052.6(ATP7A):c.2248_2251dupATTG ; NM_000052.6(ATP7A):c.2302delG ; NM_000052.6(ATP7A):c.2357T>G ; NM_000052.4(ATP7A):c.2383C>T ; NM_000052.6(ATP7A):c.2395_2405delCATATAGCAAAinsAGCATC ; NM_000052.6(ATP7A):c.2405_2406+1delinsT ; NM_000052.6(ATP7A):c.2467delG ; NM_000052.6(ATP7A):c.2498+2T>A ; NM_000052.6(ATP7A):c.2499-1G>A ; NM_000052.6(ATP7A):c.2499-1_2504dupGTGAAGA ; NM_000052.6(ATP7A):c.2555C>T ; NM_000052.6(ATP7A):c.2645dupC ; NM_000052.6(ATP7A):c.2694delG ; c.2743C>T ; NM_000052.6(ATP7A):c.2867G>A ; NM_000052.6(ATP7A):c.2916+3_2916+6del ; NM_000052.6(ATP7A):c.2938C>T ; NM_000052.6(ATP7A):c.2956C>T ; NM_000052.6(ATP7A):c.3049G>A ; NM_000052.6(ATP7A):c.3056G>A ; NM_000052.6(ATP7A):c.3068_3082delGCATACTAATAAAAG ; NM_000052.6(ATP7A):c.3112-1G>A ; NM_000052.6(ATP7A):c.3124delG ; NM_000052.6(ATP7A):c.3127_3131delTTTGAinsAGTACAGG ; NM_000052.6(ATP7A):c.3132T>G ; NM_000052.6(ATP7A):c.31dup ; NM_000052.5:c.3257_3258delAC ; NM_000052.6(ATP7A):c.3285T>G ; NM_000052.6(ATP7A):c.3288C>A ; c.3294+2T>G ; NM_000052.6(ATP7A):c.3340delG ; NM_000052.6(ATP7A):c.3379G>T ; NM_000052.6(ATP7A):c.3466C>T ; NM_000052.6(ATP7A):c.3473C>A ; NM_000052.6(ATP7A):c.3502C>T ; NM_000052.6:c.3511.1G-A ; NM_000052.6(ATP7A):c.3537delA ; NM_000052.6(ATP7A):c.3764G>A ; NM_000052.6(ATP7A):c.3774delTinsATGACTGG ; NM_000052.6(ATP7A):c.3775_3776delAAinsTTAC ; NM_000052.6(ATP7A):c.3801+1G>T ; NM_000052.6(ATP7A):c.3802-1G>T ; NM_000052.6(ATP7A):c.3911A>G ; NM_000052.6(ATP7A):c.3915_3921delCTCCCCA ; NM_000052.6(ATP7A):c.3920C>G ; NM_000052.6(ATP7A):c.3920delC ; NM_000052.6(ATP7A):c.3943G>A ; NM_000052.6(ATP7A):c.4005+1G>T ; NM_000052.6(ATP7A):c.4014_4016delTCT ; NM_000052.6(ATP7A):c.408_415del ; NM_000052.6(ATP7A):c.4123+1G>A ; NM_000052.6(ATP7A):c.4132dupA ; NM_000052.6(ATP7A):c.421_422delGA ; NM_000052.6(ATP7A):c.4226+5G>A ; NM_000052.6(ATP7A):c.4352delG ; NM_000052.6(ATP7A):c.598C>T ; NM_000052.6(ATP7A):c.601C>T ; NM_000052.6(ATP7A):c.876delG ; NC_000023.11:g.77988574del ; NC_000023.11:g.78031538dup ; NC_000023.11:g.78031583G>A ; NC_000023.11:g.78042651C>T

GENE

ATP7B

DISEASES
Wilson disease
SUMMARY

A rare genetic disorder of copper metabolism presenting with non-specific hepatic, neurologic, psychiatric or ophthalmologic manifestations due to impaired biliary copper excretion and consecutive excessive copper deposition in the body.

CLINICAL DESCRIPTION

The clinical spectrum is very wide, even within affected families. Likewise, age of onset is highly variable. Some patients remain asymptomatic for decades while few present symptoms before age 3 to 5. The disease can be observed in children after 3 years and most cases develop by 40 years of age. Late-onset cases after the fifth decade of life have also been described. Clinical presentation depends on gender and age. In children, at an average age of 10 years, hepatic manifestations typically prevail, most often commencing with liver damage. In general, hepatic manifestations (hepatomegaly, subacute or chronic hepatitis, acute liver failure or cirrhosis with portal hypertension) commonly precedes neurologic symptoms. Neurological manifestations (dystonia, intention tremor, dysarthria, coordination difficulties, chorea, choreoathetosis, and gait disorders) can be found in conjunction with hepatic symptoms or might also be the first clinical symptoms. Isolated psychiatric disorders (depression, phobias, compulsive behavior, personality changes, aggressiveness, or emotional instability) are rare and more commonly observed in conjunction with hepatic or neurologic disease. A wide range of other manifestations may also be present in affected patients: acute hemolytic episodes, delayed puberty, amenorrhea, repetitive miscarriage, Kayser-Fleischer rings due to copper deposits in the Descemet membrane, bone pain, arthralgia and osteoporosis, arrythmia, myocardiopathy, hematuria, nephrotic syndrome and renal lithiasis. Hepatocellular carcinoma has been reported in rare cases.

VARIANTS

NM_000053.3(ATP7B):c.1934T>G ; NM_000053.3(ATP7B):c.19_20delCA ; NM_000053.3(ATP7B):c.2605G>A ; NM_000053.3(ATP7B):c.2621C>T ; NM_000053.3(ATP7B):c.2755C>T ; NM_000053.3(ATP7B):c.2972C>T ; NM_000053.3(ATP7B):c.3688A>G ; NM_000053.3(ATP7B):c.1145_1151delCCCAACT ; NM_000053.3(ATP7B):c.1512dupT ; NM_000053.3(ATP7B):c.1745_1746delTA ; NM_000053.3(ATP7B):c.2071G>A ; NM_000053.3(ATP7B):c.2755C>G ; NM_000053.3(ATP7B):c.2804C>T ; NM_000053.3(ATP7B):c.3694A>C ; NM_000053.3(ATP7B):c.3955C>T ; NM_000053.3(ATP7B):c.4058G>A ; NM_000053.3(ATP7B):c.4088C>T ; NM_000053.3(ATP7B):c.562C>T ; NM_000053.3(ATP7B):c.2123T>C ; NM_000053.3(ATP7B):c.2297C>G ; NM_000053.3(ATP7B):c.2305A>G ; c.2356-2A>G ; NM_000053.3(ATP7B):c.2532delA ; NM_000053.3(ATP7B):c.2795C>A ; NM_000053.3:c.2807T-A ; NM_000053.3(ATP7B):c.2906G>A ; NM_000053.3(ATP7B):c.2930C>T ; NM_000053.3(ATP7B):c.2975C>T ; NM_000053.3:c.3083delA ; NM_000053.4:c.3207C>A ; NM_000053.3:c.3359T-A ; NM_001005918.2:c.3369_3372delTTAT ; NM_000053.3(ATP7B):c.3796G>A ; NM_000053.3(ATP7B):c.3809A>G ; NM_000053.3(ATP7B):c.915T>A

GENE

BCKDHA

DISEASES
Classic maple syrup urine disease
SUMMARY

Classic maple syrup urine disease (classic MSUD) is the most severe and probably common form of MSUD (see this term) characterized by a maple syrup odor in the cerumen at birth, poor feeding, lethargy and focal dystonia, followed by progressive encephalopathy and central respiratory failure if untreated.

CLINICAL DESCRIPTION

Onset of classic MSUD occurs in the neonatal period (usually 12 hours after birth) with the presence of a maple syrup odor in the cerumen and later in urine, poor feeding and drowsiness. Progressive encephalopathy with lethargy, intermittent apnea, stereotyped movements (described as "fencing" and bicycling") and opisthotonus occur in the first few days of life. Without treatment, coma and central respiratory failure occur by days 7 to 10. Later, catabolic stress, infection or injury may cause acute, potentially fatal, leucine intoxication with vomiting, altered consciousness, ataxia and acute dystonia in toddlers and hallucinations, hyperactivity, focal dystonia, ataxia and choreoathetosis in children and adults.

Intermediate maple syrup urine disease
SUMMARY

Intermediate maple syrup urine disease (intermediate MSUD) is a milder form of MSUD (see this term) characterized by persistently raised branched-chain amino acids (BCAAs) and ketoacids, but fewer or no acute episodes of decompensation.

CLINICAL DESCRIPTION

Symptom onset of intermediate MSUD varies between the early months and the early years of childhood. Infants may have feeding problems, poor growth, maple syrup odor in urine and developmental delay. Older children usually present with learning difficulties. Like classic MSUD (see this term), catabolic stress can result in acute decompensation with anorexia, vomiting, ataxia (in infants/toddlers), cognitive impairment, sleep disturbances, hallucinations, hyperactivity, mood swings, acute dystonia, choreoathetosis (in adults), stupor, coma and cerebral edema, if untreated.

Intermittent maple syrup urine disease
SUMMARY

Intermittent maple syrup urine disease (intermittent MSUD) is a mild form of MSUD (see this term) where patients (when well) are asymptomatic with normal levels of branched-chain amino acids (BCAAs) but with catabolic stress are at risk of acute decompensation with ketoacidosis, which can lead to cerebral edema and coma if untreated.

CLINICAL DESCRIPTION

Unlike classic MSUD (see this term), patients with intermittent MSUD show normal growth and intellectual development during infancy and childhood. They may develop symptoms (mainly in childhood) with any catabolic stress (i.e. fasting, dehydration, fever, infections or pregnancy (in adults)). These precipitating factors can lead to a potentially fatal episode of acute decompensation with anorexia, nausea, vomiting, lethargy, ataxia (in infants/toddlers), cognitive impairment, sleep disturbances, hallucinations, hyperactivity, mood swings, acute dystonia, and choreoathetosis (in adults), that can progress to stupor, coma and cerebral edema. Intelligence and development are not usually affected by these episodes.

Thiamine-responsive maple syrup urine disease
SUMMARY

Thiamine-responsive maple syrup urine disease (thiamine-responsive MSUD) is a less severe variant of MSUD (see this term) that manifests with a phenotype similar to intermediate MSUD (see this term) but that responds positively to treatment with thiamine.

CLINICAL DESCRIPTION

Thiamine-responsive MSUD is poorly characterized. It appears to usually present after infancy with a phenotype very similar to that seen in intermediate MSUD (see this term). Manifestations include feeding problems, poor growth, maple syrup odor in urine and developmental delay. Older children usually present with learning difficulties. Like classic MSUD (see this term), physiological stress can result in acute decompensation with anorexia, nausea, vomiting (at all ages), ataxia (in infants/toddlers), cognitive impairment, sleep disturbances, hallucinations, hyperactivity, mood swings, acute / focal dystonia and choreoathetosis (in adults) that can progress to stupor, coma and cerebral edema, if untreated. Thiamine (doses of 10-1000 mg per day) has improved the leucine tolerance in the few reported cases of this MSUD subtype, but some dietary branched-chain amino-acid (BCAA) restriction remains necessary.

VARIANTS

NM_000709.3(BCKDHA):c.1037G>A ; NM_000709.3(BCKDHA):c.761C>A ; NM_000709.3(BCKDHA):c.1036C>T ; NM_000709.3(BCKDHA):c.1234G>A ; NM_000709.3(BCKDHA):c.632C>T ; NM_000709.3(BCKDHA):c.659C>T ; NM_000709.3(BCKDHA):c.853G>C ; NM_000709.3(BCKDHA):c.868G>A ; NM_000709.3(BCKDHA):c.979G>A ; NM_000709.3(BCKDHA):c.14delT ; NM_000709.3(BCKDHA):c.740_741insT ; NM_000709.3:c.796delA ; NM_000709.3(BCKDHA):c.905A>C ; NM_000709.3(BCKDHA):c.909_910delGT ; NM_000709.3(BCKDHA):c.917delT ; NM_000709.3(BCKDHA):c.929C>G ; NM_000709.3(BCKDHA):c.964C>T

GENE

BCKDHB

DISEASES
Classic maple syrup urine disease
SUMMARY

Classic maple syrup urine disease (classic MSUD) is the most severe and probably common form of MSUD (see this term) characterized by a maple syrup odor in the cerumen at birth, poor feeding, lethargy and focal dystonia, followed by progressive encephalopathy and central respiratory failure if untreated.

CLINICAL DESCRIPTION

Onset of classic MSUD occurs in the neonatal period (usually 12 hours after birth) with the presence of a maple syrup odor in the cerumen and later in urine, poor feeding and drowsiness. Progressive encephalopathy with lethargy, intermittent apnea, stereotyped movements (described as "fencing" and bicycling") and opisthotonus occur in the first few days of life. Without treatment, coma and central respiratory failure occur by days 7 to 10. Later, catabolic stress, infection or injury may cause acute, potentially fatal, leucine intoxication with vomiting, altered consciousness, ataxia and acute dystonia in toddlers and hallucinations, hyperactivity, focal dystonia, ataxia and choreoathetosis in children and adults.

Intermediate maple syrup urine disease
SUMMARY

Intermediate maple syrup urine disease (intermediate MSUD) is a milder form of MSUD (see this term) characterized by persistently raised branched-chain amino acids (BCAAs) and ketoacids, but fewer or no acute episodes of decompensation.

CLINICAL DESCRIPTION

Symptom onset of intermediate MSUD varies between the early months and the early years of childhood. Infants may have feeding problems, poor growth, maple syrup odor in urine and developmental delay. Older children usually present with learning difficulties. Like classic MSUD (see this term), catabolic stress can result in acute decompensation with anorexia, vomiting, ataxia (in infants/toddlers), cognitive impairment, sleep disturbances, hallucinations, hyperactivity, mood swings, acute dystonia, choreoathetosis (in adults), stupor, coma and cerebral edema, if untreated.

Intermittent maple syrup urine disease
SUMMARY

Intermittent maple syrup urine disease (intermittent MSUD) is a mild form of MSUD (see this term) where patients (when well) are asymptomatic with normal levels of branched-chain amino acids (BCAAs) but with catabolic stress are at risk of acute decompensation with ketoacidosis, which can lead to cerebral edema and coma if untreated.

CLINICAL DESCRIPTION

Unlike classic MSUD (see this term), patients with intermittent MSUD show normal growth and intellectual development during infancy and childhood. They may develop symptoms (mainly in childhood) with any catabolic stress (i.e. fasting, dehydration, fever, infections or pregnancy (in adults)). These precipitating factors can lead to a potentially fatal episode of acute decompensation with anorexia, nausea, vomiting, lethargy, ataxia (in infants/toddlers), cognitive impairment, sleep disturbances, hallucinations, hyperactivity, mood swings, acute dystonia, and choreoathetosis (in adults), that can progress to stupor, coma and cerebral edema. Intelligence and development are not usually affected by these episodes.

Thiamine-responsive maple syrup urine disease
SUMMARY

Thiamine-responsive maple syrup urine disease (thiamine-responsive MSUD) is a less severe variant of MSUD (see this term) that manifests with a phenotype similar to intermediate MSUD (see this term) but that responds positively to treatment with thiamine.

CLINICAL DESCRIPTION

Thiamine-responsive MSUD is poorly characterized. It appears to usually present after infancy with a phenotype very similar to that seen in intermediate MSUD (see this term). Manifestations include feeding problems, poor growth, maple syrup odor in urine and developmental delay. Older children usually present with learning difficulties. Like classic MSUD (see this term), physiological stress can result in acute decompensation with anorexia, nausea, vomiting (at all ages), ataxia (in infants/toddlers), cognitive impairment, sleep disturbances, hallucinations, hyperactivity, mood swings, acute / focal dystonia and choreoathetosis (in adults) that can progress to stupor, coma and cerebral edema, if untreated. Thiamine (doses of 10-1000 mg per day) has improved the leucine tolerance in the few reported cases of this MSUD subtype, but some dietary branched-chain amino-acid (BCAA) restriction remains necessary.

VARIANTS

NM_183050.3(BCKDHB):c.1046G>A ; NM_183050.2(BCKDHB):c.509G>A ; NM_183050.3(BCKDHB):c.1114G>T ; NM_000056.4(BCKDHB):c.302G>A ; NM_183050.3(BCKDHB):c.342T>G ; NM_000056.4(BCKDHB):c.479T>G ; NM_000056.4(BCKDHB):c.508C>A ; NM_000056.4(BCKDHB):c.508C>G ; NM_183050.3(BCKDHB):c.508C>T ; NM_183050.2(BCKDHB):c.547C>T ; NM_183050.3(BCKDHB):c.752T>C ; NM_183050.3(BCKDHB):c.799C>T ; NM_183050.3(BCKDHB):c.832G>A ; NM_183050.3(BCKDHB):c.853C>T ; NM_000056.4(BCKDHB):c.902T>G ; NM_183050.2(BCKDHB):c.970C>T ; NM_000056.4(BCKDHB):c.344-1G>A ; NM_000056.4(BCKDHB):c.356T>G ; NM_000056.4(BCKDHB):c.488A>T ; NM_000056.4(BCKDHB):c.526A>T ; NM_183050.4:c.548G>C ; NM_000056.4(BCKDHB):c.748G>T ; c.885del ; NM_000056.4(BCKDHB):c.952-1G>A

GENE

BCS1L

DISEASES
Björnstad syndrome
SUMMARY

Björnstad syndrome is characterized by congenital sensorineural hearing loss and pili torti.

CLINICAL DESCRIPTION

The hearing loss usually becomes evident very early in life, often in the first year. Pili torti, a condition in which the hair shaft is flattened and twisted, makes the hair very brittle and patients develop hair loss in the first two years of life.

GRACILE syndrome
SUMMARY

An inherited lethal mitochondrial disorder characterized by fetal growth restriction (GR), aminoaciduria (A), cholestasis (C), iron overload (I), lactacidosis (L), and early death (E).

CLINICAL DESCRIPTION

Fetal growth restriction appears early during the pregnancy without signs of chronic hypoxia. Because of small fetal size, the pregnancies are usually interrupted a few weeks before the estimated due date (median 38 gestational weeks). The newborn infant is small for gestational age (birth weight approximately 1,700 g) and develops fulminant lactic acidosis (median pH 7.02, lactate 12.8 mmol/l) during the first day of life. In metabolic screening, marked aminoaciduria is found due to renal proximal tubulopathy of Fanconi type. Iron overload is illustrated by increased plasma ferritin and decreased transferrin concentrations and accumulation of iron in the liver. Further signs of hepatopathy are cholestasis with steatosis, fibrosis and cirrhosis. No dysmorphic features are noted. No distinct cerebral abnormalities have so far been found, however in some infants, EEG has been abnormal, maybe as a result of severe metabolic acidosis. The hearing response assessed with BAEP has been abnormal.

Isolated complex III deficiency
SUMMARY

Isolated complex III deficiency is a rare, genetic, mitochondrial oxidative phosphorylation disorder characterized by a wide spectrum of clinical manifestations ranging from isolated myopathy or transient hepatopathy to severe multisystem disorder (that may include hypotonia, failure to thrive, psychomotor delay, cardiomyopathy, encephalopathy, renal tubulopathy, hearing impairment, lactic acidosis, hypoglycemia and other signs and symptoms).

CLINICAL DESCRIPTION

Autosomal recessive mitochondrial complex III deficiency is a severe multisystem disorder with onset at birth of lactic acidosis, hypotonia, hypoglycemia, failure to thrive, encephalopathy, and delayed psychomotor development. Visceral involvement, including hepatopathy and renal tubulopathy, may also occur. Many patients die in early childhood, but some may show longer survival.

Renal tubulopathy-encephalopathy-liver failure syndrome
SUMMARY

Renal tubulopathy - encephalopathy - liver failure describes a spectrum of phenotypes with manifestations similar but milder than those seen in GRACILE syndrome (see this term) and that can be associated with encephalopathy and psychiatric disorders.

CLINICAL DESCRIPTION

Disease presentation is variable. Most of the characteristics of GRACILE syndrome are present (fetal growth restriction, proximal tubulopathy and hepatopathy, as well as lactic acidosis) but they are often less severe. Signs of disturbances in iron metabolism have been described, such as increased serum ferritin levels, but it is unclear whether severe liver iron overload is present. Most infants die during the neonatal period. In those who survive, encephalopathy and psychiatric disorders have been described.

VARIANTS

NM_004328.4(BCS1L):c.547C>T ; NM_004328.4(BCS1L):c.550C>T ; NM_004328.4(BCS1L):c.166C>T ; NM_004328.4(BCS1L):c.103G>C ; NM_004328.4(BCS1L):c.1057G>A ; NM_004328.4(BCS1L):c.133C>T ; NM_004328.4(BCS1L):c.148A>G ; NM_001257342.1(BCS1L):c.232A>G ; NM_004328.4(BCS1L):c.548G>A ; c.696del ; NM_004328.4(BCS1L):c.830G>A

GENE

BRIP1

DISEASES
Fanconi anemia
SUMMARY

A rare genetic multisystem disorder characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors.

CLINICAL DESCRIPTION

The first signs of Fanconi anemia (FA) are typically non-hematological features. Limb anomalies typically affect the extremities, are unilateral or (usually asymmetric) bilateral. Minor anomalies can also be present such as low birth length and weight, microcephaly and/or microphthalmia. Skin pigmentation abnormalities (café-au-lait spots) and hypoplastic thenar eminence are frequent. Almost 20% of patients have ear malformations with or without hearing loss. Congenital malformations may involve other organ systems and vary within families. Short stature is syndromic and/or associated to endocrinopathies. Fertility is frequently impaired in males, and is highly disturbed in half of females. When congenital malformations are not prominent, diagnosis may be delayed until the onset of hematological anomalies. Bone marrow failure (BMF) occurs at a median age of 7 years, developing in 90% of patients by 40 years of age. The first manifestations are macrocytosis (very early) and thrombocytopenia. In patients with somatic mosaïcism, blood counts may stay normal until occurrence of hematological malignancy. In general, patients are highly predisposed to solid tumors (most frequently head and neck or anogenital regions).

Hereditary breast and ovarian cancer syndrome
SUMMARY

Breast cancer (BC) is the most common cancer in women, accounting for 25% of all new cases of cancer. Most BC cases are sporadic, while 5-10% are estimated to be due to an inherited predisposition.

CLINICAL DESCRIPTION

HBC is not associated with specific phenotypic features.

VARIANTS

NM_032043.2(BRIP1):c.2392C>T ; NM_032043.2(BRIP1):c.3209C>A ; NM_032043.2(BRIP1):c.1045G>C ; NM_032043.2(BRIP1):c.1702_1703delAA ; NM_032043.2(BRIP1):c.2990_2993delCAAA ; NM_032043.2(BRIP1):c.2237_2240delTCAA ; NM_032043.2:c.502C-T

GENE

BSND

DISEASES
Autosomal recessive non-syndromic sensorineural deafness type DFNB
SUMMARY

Deafness is the most frequent form of sensorial deficit. In the vast majority of cases, the deafness is termed nonsyndromic or isolated and the hearing loss is the only clinical anomaly reported. In developed counties, 60-80% of cases of early-onset hearing loss are of genetic origin.

CLINICAL DESCRIPTION

The majority of cases presenting at birth concern perceptive deafness (with a neurosensory origin associated with the inner ear) rather than conductive deafness (anomalies in the amplification of sound waves between the middle ear - tympanum and auditory ossicles - and the outer ear). Autosomal dominant forms are characterised by very early onset and bilateral hearing loss with varying degrees of severity (ranging from mild to profound). No malformations of the inner ear can be detected by CT scan. Mutations in the PDS gene are responsible for 7% of cases of childhood deafness. In these cases, the deafness is marked by early-onset, usually bilateral (but sometimes asymmetric) hearing loss with autosomal recessive transmission. This form of deafness is always associated with malformations of the inner ear that can be detected by CT scan. In rare cases, thyroid gland disease may also be present. For the autosomal dominant forms of deafness, mutations in the COCH gene result in progressive postlingual deafness associated with severe attacks of vertigo and subjective tinnitus. This form of deafness should be distinguished from Meniere's disease (see this term). Autosomal dominant mutations in the WFS1 gene cause either a form of hearing loss affecting mainly low frequency sounds or deafness associated with optic atrophy.

Infantile Bartter syndrome with sensorineural deafness
SUMMARY

Infantile Bartter syndrome with deafness, a phenotypic variant of Bartter syndrome (see this term) is characterized by maternal polyhydramnios, premature delivery, polyuria and sensorineural deafness and is associated with hypokalemic alkalosis, increased levels of plasma renin and aldosterone, low blood pressure, and vascular resistance to angiotensin II.

CLINICAL DESCRIPTION

Infantile Bartter syndrome with deafness is a severe type of Bartter syndrome manifesting prenatally with maternal polyhydramnios (due to fetal polyuria) usually evident by the end of 2nd trimester, often leading to preterm labour and prematurity. Postnatally patients present with polyuria, isosthenuria/hyposthenuria and are at high risk of dehydration, hypovolemic hypotension and shock. Patients are found to have complete sensorineural deafness. Recurrent vomiting, muscle cramps, spasms and failure to thrive are observed. Progression to renal failure is frequent. Hypokalemic alkalosis, hypomagnesemia, hyperprostaglandin E-uria and hypochloremia are noted (hypercalciuria is only transient).

VARIANTS

NM_057176.3(BSND):c.3G>A ; NM_057176.3(BSND):c.10G>T ; NM_057176.3(BSND):c.139G>A ; NM_057176.3(BSND):c.1A>T ; NM_057176.3(BSND):c.22C>T ; NM_057176.3(BSND):c.23G>T

GENE

BTD

DISEASES
Biotinidase deficiency
SUMMARY

A late-onset form of multiple carboxylase deficiency, an inborn error of biotin metabolism that, if untreated, is characterized by seizures, breathing difficulties, hypotonia, skin rash, alopecia, hearing loss and delayed development.

CLINICAL DESCRIPTION

Symptoms of BD deficiency typically appear within the first few months of life, but later onset has also been reported. Individuals with untreated profound deficiency (less than 10 % of mean normal serum biotinidase activity) have variable clinical findings including seizures, hypotonia, eczematoid rash, alopecia, ataxia, hearing loss, fungal infections, and developmental delay. Metabolically, untreated children can exhibit ketolactic acidosis, organic acidemia (-uria) and mild hyperammonemia. Individuals with untreated partial BD (10% to 30% of mean normal biotinidase activity) may be asymptomatic, but during periods of stress, such as illness, fever or fasting, may develop symptoms similar to those of individuals with profound BD. Multiple adults with optic neuropathy and/or peripheral neuropathy, that is often mistakenly diagnosed as multiple sclerosis, have been shown to have profound biotinidase deficiency.

VARIANTS

NM_001281723.2(BTD):c.517G>A ; NM_001281723.2(BTD):c.589A>G ; NM_001281724.2(BTD):c.670G>A ; NM_001281725.2(BTD):c.1279C>T ; NM_000060.4(BTD):c.1324del ; NM_001281723.2(BTD):c.1495C>T ; NM_001281723.2(BTD):c.340G>C ; NM_001281723.2(BTD):c.449G>A ; NM_001281723.2(BTD):c.534G>T ; NM_001281723.2(BTD):c.563G>A ; NM_001281723.2(BTD):c.601G>A ; NM_001281723.2(BTD):c.635A>G ; NM_000060.2(BTD):c.933delT ; NM_001281725.2(BTD):c.1292G>A ; NM_001281724.2(BTD):c.1374A>C ; NM_000060.4(BTD):c.1508_1512delGGATG ; NM_001281723.2(BTD):c.1601C>T ; NM_001281723.2(BTD):c.1618C>T ; NM_001281723.2(BTD):c.190G>A ; NM_001281723.2(BTD):c.241C>T ; NM_001281723.2(BTD):c.637C>T ; NM_001281723.2(BTD):c.649C>T ; NM_001281723.2(BTD):c.761A>G ; NM_001281723.2(BTD):c.800A>T

GENE

BTK

DISEASES
Short stature due to isolated growth hormone deficiency with X-linked hypogammaglobulinemia
SUMMARY

IGHD3 is characterized by agammaglobulinemia and markedly reduced numbers of B cells, short stature, delayed bone age, and good response to treatment with growth hormone.

CLINICAL DESCRIPTION

X-linked agammaglobulinemia is an immunodeficiency characterized by failure to produce mature B lymphocytes and associated with a failure of Ig heavy chain rearrangement. The defect in this disorder resides in BTK, also known as BPK or ATK, a key regulator in B-cell development. The X-linked form accounts for approximately 85 to 90% of cases of the disorder.

X-linked agammaglobulinemia
SUMMARY

A clinically variable form of isolated agammaglobulinemia, an inherited immunodeficiency disorder, characterized in affected males by recurrent bacterial infections during infancy.

CLINICAL DESCRIPTION

Affected individuals are usually healthy in the first few months of life due to residual maternal immunoglobulins. The majority of patients develop recurrent or persistent bacterial infections, most commonly caused by S. pneumoniae and H. influenzae, within the first two years of life,: otitis media, conjunctivitis, sinusitis, respiratory infections, diarrhea and skin infections (impetigo, cellulitis, abscesses, and furuncles). Other severe infections may include empyema, meningitis, sepsis, or septic arthritis. Pyoderma or cellulitis (associated with neutropenia) and pseudomonas or staphylococcal sepsis are frequent presenting findings, particularly in patients less than 12 months of age. Lymph nodes, tonsils, and other lymphoid tissues are unusually small or absent. Rare patients are reported to have vitiligo, erythematous rash, or alopecia totalis. Infections tend to persist throughout adulthood. Affected patients are reported to have a higher susceptibility to severe and chronic enteroviral infections. Growth and development are usually normal. Some patients have a less severe clinical presentation and are not recognized as immunodeficient until 10 years of age or later. Complications of X-linked agammaglobulinemia (XLA) include progressive lung disease, chronic sinusitis, inflammatory bowel disease, arthritis , as well as neurological changes.

VARIANTS

NM_000061.2(BTK):c.1697C>T ; NM_000061.2:c.179_181delAGA ; NM_000061.2(BTK):c.-31+5G>T ; NM_000061.2(BTK):c.1138C>T ; NM_000061.2(BTK):c.121G>A ; NM_000061.2(BTK):c.1441T>A ; NM_000061.2(BTK):c.1442G>C ; NM_000061.2(BTK):c.1511A>T ; NM_000061.2(BTK):c.164C>A ; NM_000061.2(BTK):c.1673_1680delAATTTCCA ; NM_000061.2(BTK):c.1688G>T ; NM_000061.2(BTK):c.1757T>C ; NM_000061.2(BTK):c.1760T>C ; NM_000061.2(BTK):c.1771delT ; NM_000061.2(BTK):c.1773C>A ; NM_000061.2(BTK):c.1805C>T ; NM_000061.2(BTK):c.1888A>C ; NM_000061.2(BTK):c.1978T>G ; NM_000061.2(BTK):c.240G>A ; NM_000061.2(BTK):c.370T>C ; NM_000061.2(BTK):c.371G>A ; NM_000061.2(BTK):c.472_475delACAG ; NM_000061.2(BTK):c.588+1G>T ; NM_000061.2(BTK):c.588+2T>A ; NM_000061.2(BTK):c.777-2A>G ; NM_000061.2(BTK):c.799_806delAACTATGT ; NM_000061.2(BTK):c.840-1G>A ; NM_000061.2(BTK):c.862C>T ; NM_000061.2(BTK):c.895-2A>G ; NM_000061.2(BTK):c.906_908delAGG ; NM_000061.2(BTK):c.998A>G ; NC_000023.11:g.101353919T>G ; NC_000023.11:g.101353924G>A ; NC_000023.11:g.101356780T>A ; NM_000061.2(BTK):c.-31+5G>A ; NM_000061.2(BTK):c.1001A>C ; NM_000061.2(BTK):c.1004T>A ; NM_000061.2(BTK):c.1064T>A ; NM_000061.2(BTK):c.1082A>G ; NM_000061.2(BTK):c.1103G>A ; NM_000061.2(BTK):c.1116G>C ; NM_000061.2(BTK):c.1125T>G ; NM_000061.2(BTK):c.1185G>A ; NM_000061.2(BTK):c.119A>G ; NM_000061.2(BTK):c.1223T>C ; NM_000061.2(BTK):c.1275C>A ; NM_000061.2(BTK):c.1288A>G ; NM_000061.2(BTK):c.141+3_141+4del ; NM_000061.2(BTK):c.141+3_141+6del ; NM_000061.2(BTK):c.1455C>A ; NM_000061.2(BTK):c.1489C>T ; NM_000061.2(BTK):c.1506C>A ; NM_000061.2(BTK):c.1516T>C ; NM_000061.2(BTK):c.1526T>C ; NM_000061.2(BTK):c.1558C>T ; NM_000061.2(BTK):c.1559G>A ; NM_000061.2(BTK):c.1567-2A>T ; NM_000061.2(BTK):c.1573C>T ; NM_000061.2(BTK):c.1574G>A ; NM_000061.2(BTK):c.1580G>C ; NM_000061.2(BTK):c.1581_1584delTTTG ; NM_000061.2(BTK):c.161delG ; NM_000061.2(BTK):c.1625T>C ; NM_000061.2(BTK):c.1630_1631+3delinsGAAA ; NM_000061.2(BTK):c.1631+1G>T ; NM_000061.2(BTK):c.1632-2A>G ; NM_000061.2(BTK):c.1684C>T ; NM_000061.2(BTK):c.1685G>C ; NM_000061.2(BTK):c.1688G>A ; NM_000061.2(BTK):c.1706T>C ; NM_000061.2(BTK):c.1741T>C ; NM_000061.2(BTK):c.1750+5G>A ; NM_000061.2(BTK):c.1766A>G ; NM_000061.2(BTK):c.1780G>A ; NM_000061.2(BTK):c.1820C>A ; NM_000061.2(BTK):c.1838G>A ; NM_000061.2(BTK):c.1889T>A ; NM_000061.2(BTK):c.1906G>T ; NM_000061.2(BTK):c.1946delG ; NM_000061.2(BTK):c.1955T>C ; NM_000061.2(BTK):c.215dupA ; NM_000061.2(BTK):c.228_231delAAGA ; NM_000061.2(BTK):c.278C>A ; NM_000061.2(BTK):c.2T>C ; NM_000061.2(BTK):c.307C>T ; NM_000061.2(BTK):c.310-1G>C ; NM_000061.2(BTK):c.310-2A>G ; NM_000061.2(BTK):c.338T>A ; NM_000061.2(BTK):c.37C>T ; NM_000061.2(BTK):c.389del ; NM_000061.2(BTK):c.41C>A ; NM_000061.2(BTK):c.435C>A ; NM_000061.2(BTK):c.43C>T ; NM_000061.2(BTK):c.469C>T ; NM_000061.2(BTK):c.46C>T ; NM_000061.2(BTK):c.557dupA ; NM_000061.2(BTK):c.588_588+1insCTACATAG ; NM_000061.2(BTK):c.642_643delTG ; NM_000061.2(BTK):c.653delA ; NM_000061.2:c.655delG ; NM_000061.2(BTK):c.669T>A ; NM_000061.2(BTK):c.718G>T ; NM_000061.2(BTK):c.726dup ; NM_000061.2(BTK):c.755G>A ; NM_000061.2(BTK):c.763C>T ; NM_000061.2(BTK):c.839+1G>A ; NM_000061.2(BTK):c.83G>A ; NM_000061.2(BTK):c.863G>A ; NM_000061.2(BTK):c.894+1G>A ; NM_000061.2(BTK):c.919A>G ; NM_000061.2(BTK):c.953C>T ; NM_000061.2(BTK):c.97A>C ; NC_000023.11:g.101353339C>T ; NC_000023.11:g.101353352C>G ; NC_000023.11:g.101353906_101353907TA[3] ; NC_000023.11:g.101353923G>C ; NC_000023.11:g.101356072G>A ; NC_000023.11:g.101356812C>A ; NC_000023.11:g.101356871C>T ; NC_000023.11:g.101360151C>T ; NC_000023.11:g.101360588C>T ; NC_000023.11:g.101360665del ; NC_000023.11:g.101362198del ; NC_000023.11:g.101371672del ; NC_000023.11:g.101374544G>A

GENE

CAPN3

DISEASES
Calpain-3-related limb-girdle muscular dystrophy R1
SUMMARY

A subtype of autosomal recessive limb girdle muscular dystrophy characterized by a variable age of onset of progressive, typically symmetrical and selective weakness and atrophy of proximal shoulder- and pelvic-girdle muscles (gluteus maximus, thigh adductors, and muscles of the posterior compartment of the limbs are most commonly affected) without cardiac or facial involvement. Clinical manifestations include exercise intolerance, a waddling gait, scapular winging and calf pseudo-hypertrophy.

CLINICAL DESCRIPTION

Autosomal recessive limb-girdle muscular dystrophy-1 affects primarily the proximal muscles, resulting in difficulty walking. The age at onset varies, but most patients show onset in childhood, and the disorder is progressive. Other features may include scapular winging, calf pseudohypertrophy, and contractures.

VARIANTS

NM_000070.2(CAPN3):c.2257G>A ; NM_000070.2(CAPN3):c.956C>T ; NM_000070.2(CAPN3):c.133G>A ; NM_000070.2(CAPN3):c.1466G>A ; NM_000070.2(CAPN3):c.1468C>T ; NM_000070.2(CAPN3):c.1469G>A ; NM_000070.2(CAPN3):c.1715G>A ; NM_000070.2(CAPN3):c.2120A>G ; NM_000070.2(CAPN3):c.2243G>A ; NM_000070.2(CAPN3):c.580delT ; NM_000070.2(CAPN3):c.1322delG ; NM_000070.2:c.1599_1602delGAGC ; NM_000070.2(CAPN3):c.1795dupA ; NM_000070.2(CAPN3):c.1838delA ; c.217C>T ; NM_000070.2(CAPN3):c.223dupT ; NM_000070.2(CAPN3):c.2251_2254dupGTCA ; NM_000070.2(CAPN3):c.2306G>A ; NM_000070.2(CAPN3):c.2362_2363delAGinsTCATCT ; NM_000070.2(CAPN3):c.257C>T ; NM_000070.2(CAPN3):c.328C>T ; NM_000070.3(CAPN3):c.549delA ; NM_000070.2(CAPN3):c.598_612delTTCTGGAGTGCTCTG ; NM_000070.2(CAPN3):c.855_864dupGTTGATTGCA

GENE

CBS

DISEASES
Classic homocystinuria
SUMMARY

Classical homocystinuria due to cystathionine beta-synthase (CbS) deficiency is characterized by the multiple involvement of the eye, skeleton, central nervous system, and vascular system.

CLINICAL DESCRIPTION

Patients are normal at birth and, if left untreated, the disease course is progressive. Eye anomalies include ectopia lentis (85% of the cases), with high myopia. Skeletal changes include genu valgum and pes cavus, followed by dolichostenomelia, pectus excavatum or carinatum and kyphosis, or scoliosis and osteoporosis. Thromboembolism, affecting both large and small arteries and veins, is the most striking cause of morbidity and mortality. Intellectual deficiency rarely manifests before the first to second year of life. Clinically significant psychiatric illness is found in 51% of cases. Involvement of the liver, hair, and skin has also been reported.

VARIANTS

NM_000071.2(CBS):c.162G>A ; NM_000071.2(CBS):c.502G>A ; NM_000071.2(CBS):c.904G>A ; NM_000071.2(CBS):c.1058C>T ; NM_000071.2(CBS):c.1136G>A ; NM_000071.2(CBS):c.1330G>A ; NM_000071.2(CBS):c.146C>T ; NM_000071.2(CBS):c.325T>C ; NM_000071.2(CBS):c.341C>T ; NM_000071.2(CBS):c.374G>A ; NM_000071.2(CBS):c.430G>A ; NM_000071.2(CBS):c.434C>T ; NM_000071.2(CBS):c.676G>A ; NM_000071.2(CBS):c.689delT ; NM_000071.2(CBS):c.797G>A ; NM_000071.2(CBS):c.959T>C ; NM_000071.2(CBS):c.992C>A ; NM_000071.2(CBS):c.1006C>T ; NM_000071.2(CBS):c.1150A>G ; NM_000071.2(CBS):c.1280C>T ; NM_000071.2(CBS):c.415G>A ; NM_000071.2:c.526G-T ; NM_000071.2(CBS):c.572C>T ; NM_000071.2(CBS):c.833T>C ; NM_000071.2(CBS):c.919G>A ; NM_000071.2(CBS):c.969G>A

GENE

CDH23

DISEASES
Autosomal recessive non-syndromic sensorineural deafness type DFNB
SUMMARY

Deafness is the most frequent form of sensorial deficit. In the vast majority of cases, the deafness is termed nonsyndromic or isolated and the hearing loss is the only clinical anomaly reported. In developed counties, 60-80% of cases of early-onset hearing loss are of genetic origin.

CLINICAL DESCRIPTION

The majority of cases presenting at birth concern perceptive deafness (with a neurosensory origin associated with the inner ear) rather than conductive deafness (anomalies in the amplification of sound waves between the middle ear - tympanum and auditory ossicles - and the outer ear). Autosomal dominant forms are characterised by very early onset and bilateral hearing loss with varying degrees of severity (ranging from mild to profound). No malformations of the inner ear can be detected by CT scan. Mutations in the PDS gene are responsible for 7% of cases of childhood deafness. In these cases, the deafness is marked by early-onset, usually bilateral (but sometimes asymmetric) hearing loss with autosomal recessive transmission. This form of deafness is always associated with malformations of the inner ear that can be detected by CT scan. In rare cases, thyroid gland disease may also be present. For the autosomal dominant forms of deafness, mutations in the COCH gene result in progressive postlingual deafness associated with severe attacks of vertigo and subjective tinnitus. This form of deafness should be distinguished from Meniere's disease (see this term). Autosomal dominant mutations in the WFS1 gene cause either a form of hearing loss affecting mainly low frequency sounds or deafness associated with optic atrophy.

Cushing disease
SUMMARY

Cushing disease (CD) is the most common cause of endogenous Cushing syndrome (CS; see this term) and is due to pituitary chronic over-secretion of ACTH by a pituitary corticotroph adenoma.

CLINICAL DESCRIPTION

The female-to-male ratio of CD is 4-5:1, except in prepubertal patients, in which a strong male predominance is observed. The peak incidence is at 25-40 years of age. The disease manifests with signs of CS (truncal and facial obesity and signs of hypercatabolism) as well as skin hyperpigmentation and/or neurological complications in some cases of corticotroph macro-adenoma.

Familial isolated pituitary adenoma
SUMMARY

A rare, hereditary endocrine tumor characterized by a benign pituitary adenoma that is either secreting (e.g. prolactin, growth hormone, thyroid stimulating hormone) or non-secreting. Symptoms may occur due to either the hormonal hypersecretion and/or the mass effect of the lesion on local structures in the brain.

CLINICAL DESCRIPTION

In FIPA, pituitary adenomas can be of any secretory type (e.g. prolactinoma, acromegaly, Cushing's disease, TSH-secreting) or can be non-secreting. FIPA kindreds usually have 2-4 members affected with pituitary adenomas, while larger numbers of affected patients per family can occur infrequently. In FIPA, pituitary adenomas generally begin at a younger age and are larger than corresponding sporadic non-FIPA cases. Pituitary adenomas in FIPA can cause symptoms due to hormonal hypersecretion and/or due to the mass effect of the pituitary adenoma on local structures in the brain (e.g. visual disturbance). In FIPA families with AIP mutations pituitary adenoma growth characteristics are often aggressive and hormonal hypersecretion may be marked.

Prolactinoma
SUMMARY

A rare, usually benign, neoplasm of the anterior pituitary gland that results in hyperprolactinemia. The most common clinical manifestations are amenorrhea and infertility in women; and impotence, decreased libido and infertility in men.

CLINICAL DESCRIPTION

Disease onset is usually in the second to fourth decades of life with galactorrhea, amenorrhea and infertility presenting in women and impotence, decreased libido and infertility in men. In male patients prolactinoma may exhibit more aggressive clinical course. Prolactinoma can also cause mass effects (visual field defects, headaches) or psychiatric manifestations (anxiety, depression).

TSH-secreting pituitary adenoma
SUMMARY

Both familial and sporadic pituitary adenomas have been found to be caused by germline mutation in the CDH23 gene. Familial pituitary adenoma types include growth hormone (GH)-secreting and nonfunctional tumors. Sporadic pituitary adenoma types include GH-secreting, nonfunctional, prolactin (PRL)-secreting, adrenocorticotropin (ACTH)-secreting, thyroid-stimulating hormone (TSH)-secreting, and plurihormonal (GH and TSH) tumors.

CLINICAL DESCRIPTION

A rare, functioning, pituitary adenoma characterized by the presence of a pituitary mass associated with high levels of circulating, free, thyroid hormones in conjunction with normal to high levels of TSH and unresponsiveness of TSH levels to TRH stimulation and T3 suppression tests, typically manifesting with signs and symtoms of mild to moderate hyperthyroidism (e.g. goiter (most frequently observed), palpitation, excessive sweating, arrhythmia, weight loss, tremor) and/or tumor mass effect (such as headache, visual field defects, hypopituitarism). Occasionally, cosecretion of prolactin and/or growth hormone may cause galactorrhea and/or acromegaly.

Usher syndrome type 1
SUMMARY

Usher syndrome type I is an autosomal recessive condition characterized by profound congenital hearing impairment with unintelligible speech, early retinitis pigmentosa (usually evident within the first decade), and constant vestibular dysfunction. Type I is distinguished from type II on the basis of severity of hearing loss and the extent of vestibular involvement. Type I patients are profoundly deaf, whereas type II patients are 'hard of hearing.' Vestibular function is defective in type I patients, whereas type II patients have normal vestibular function. Patients with type III (USH3) have progressive hearing loss.

CLINICAL DESCRIPTION

A rare ciliopathy characterized by profound congenital deafness, retinitis pigmentosa and vestibular dysfunction. Retinitis pigmentosa results in visual loss and generally manifests as night blindness, progressively constricted visual fields, and impaired visual acuity. Vestibular dysfunction a defining feature of this form, manifests as delayed motor development with affected infants taking longer to sit independently and to walk. Later on, vestibular dysfunction results in difficulty with activities requiring balance.

VARIANTS

NM_022124.5(CDH23):c.6442G>A ; NC_000010.11:g.71740837C>T ; NM_022124.5(CDH23):c.146-2A>G ; NM_022124.5:c.1858.2T-G ; NM_022124.5(CDH23):c.193delC ; c.288+1G>A ; c.3141C>A ; NM_022124.5:c.3516_3519delATCC ; NM_022124.5:c.3579.2T-C ; NM_022124.5(CDH23):c.5237G>A ; NM_022124.5(CDH23):c.5663T>C ; NM_022124.5(CDH23):c.6050-9G>A ; NM_022124.5:c.6392delC ; NM_022124.5:c.9319.1_9319.4delGTAA

GENE

CEP290

DISEASES
Bardet-Biedl syndrome
SUMMARY

Bardet-Biedl syndrome (BBS) is a ciliopathy with multisystem involvement.

CLINICAL DESCRIPTION

This disorder is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course. Pigmentary retinopathy is the only constant clinical sign after childhood. BBS may also be associated with several other manifestations including diabetes, hypertension, congenital cardiopathy and Hirschsprung disease (see this term).

Joubert syndrome with oculorenal defect
SUMMARY

A rare subtype of Joubert syndrome (JS) and related disorders (JSRD) characterized by the neurological features of JS associated with both renal and ocular disease.

CLINICAL DESCRIPTION

Patients present retinal involvement (manifesting with either Leber congenital amaurosis (LCA, see this term), or progressive retinal dystrophy) and nephronophthisis (NPH, usually juvenile). Retinal involvement is present at birth (LCA) or may manifest later in life. Juvenile NPH usually becomes clinically symptomatic towards the late first decade or the early second decade of life.

Leber congenital amaurosis
SUMMARY

Leber congenital amaurosis (LCA) is a retinal dystrophy defined by blindness and responses to electrophysiological stimulation (Ganzfeld electroretinogram (ERG)) below threshold, associated with severe visual impairment within the first year of life.

CLINICAL DESCRIPTION

LCA is characterized by severely reduced visual acuity (less or equal 20/400) or blindness within in the first year of life. Sluggish pupillary responses, roving eye movement, photophobia, high hyperopia, nystagmus, convergent strabismus, or keratoconus may occur depending on the genetic cause. The Franceschetti's oculo-digital sign, comprising eye poking, pressing, and rubbing is pathognomonic. LCA may be associated with mutations in genes linked to syndromes presenting with neurodevelopmental delay, intellectual disability, oculomotor apraxia-type behavior (difficulty moving the eye) and renal dysfunction.

Meckel syndrome
SUMMARY

A rare, lethal, genetic, multiple congenital anomaly disorder characterized by the triad of brain malformation (mainly occipital encephalocele), large polycystic kidneys, and polydactyly, as well as associated abnormalities that may include cleft lip/palate, cardiac and genital anomalies, central nervous system (CNS) malformations, liver fibrosis, and bone dysplasia.

CLINICAL DESCRIPTION

Fetuses affected by Meckel syndrome (MKS) survive only a few days to a few weeks at the most, or die in utero. The main CNS features include occipital encephalocele, hydrocephalus, anencephaly, holoprosencephaly, as well as Dandy-Walker. Large polycystic kidneys with cystic dysplasia are a constant feature of Meckel syndrome. Hepatic dysgenesis and liver fibrosis are frequent. Polydactyly may affect all four extremities and is typically postaxial (80%) or very rarely preaxial. Affected individuals have pulmonary hypoplasia secondary to oligohydramnios. Cleft lip and palate, microphthalmia and micrognathia may be observed. Cardiac malformations may include atrial septal defect, aorta coarctation, patent arterial duct, and valvular pulmonary stenosis. Incomplete development of internal and external genitalia, and cryptorchidism in males are common.

Senior-Loken syndrome
SUMMARY

A rare autosomal recessive oculo-renal ciliopathy characterized by the association of nephronophthisis (NPHP), a chronic kidney disease, with retinal dystrophy.

CLINICAL DESCRIPTION

The disease typically presents in the first two decades of life as a combination of nephronophthisis (NPH) with retinal degeneration. Depending on the genetic background either the visual disorder or chronic kidney disease determine the clinical picture. NPH typically presents with symptoms such as polyuria, polydipsia, secondary enuresis and anemia. Chronic kidney disease usually slowly progresses to end-stage kidney disease (ESKD). Ocular features include congenital or early-onset severe visual loss due to retinal dystrophy (Leber congenital amaurosis) or a milder phenotype determined by a slowly progressing tube-like restriction of visual fields and night blindness (tapeto-retinal degeneration). Funduscopy reveals various degrees of atrophic and pigmentary retinal alterations. In rare occasions, other additional clinical signs may be observed like liver fibrosis, obesity and neurologic disorders.

VARIANTS

NM_025114.3(CEP290):c.6645+1G>A ; NM_025114.3(CEP290):c.4705-1G>T ; c.1501G>T ; NM_025114.3(CEP290):c.164_167delCTCA ; NM_025114.3(CEP290):c.1665_1666delAA ; c.1681C>T ; NM_025114.3(CEP290):c.21G>T ; NM_025114.3(CEP290):c.2249T>G ; NM_025114.3(CEP290):c.3185delT ; NM_025114.3(CEP290):c.384_387delTAGA ; NM_025114.3(CEP290):c.4393C>T ; NM_025114.3(CEP290):c.4723A>T ; c.4916C>A ; NM_025114.3(CEP290):c.4962_4963delAA ; NM_025114.3(CEP290):c.5611_5614delCAAA ; NM_025114.3(CEP290):c.5668G>T ; NM_025114.3(CEP290):c.613C>T ; c.6448_6455del ; c.6624del ; NM_025114.3(CEP290):c.6798G>A ; c.7324G>T ; c.7341del

GENE

CERKL

DISEASES
Retinitis pigmentosa
SUMMARY

Retinitis pigmentosa (RP) is an inherited retinal dystrophy leading to progressive loss of the photoreceptors and retinal pigment epithelium and resulting in blindness usually after several decades.

CLINICAL DESCRIPTION

Retinitis pigmentosa is slowly progressive but relentless. There is however broad variability in age of onset, rate of progression and secondary clinical manifestations. Affected individuals generally first develop night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and over time loss of central vision, usually at late stages, often around midlife. Central visual acuity loss may occur at any age as a result of cystoid macular edema or photoreceptor loss. Posterior subcapsular cataracts are common and severity is age dependent. Reduced color vision may also be found. Fundus examination reveals bone spicule pigment deposits, attenuated retinal vessels, retinal atrophy and waxy optic nerve pallor. Severity is partly correlated with the pattern of inheritance with X-linked cases having the most severe course, autosomal recessive and single occurrence cases having intermediate severity, and autosomal dominant the most favorable course.

VARIANTS

NM_201548.4(CERKL):c.1012C>T ; NM_201548.4:c.1553_1569dupTTATCAGTCTTTATGGA ; NM_201548.4:c.312delA ; NM_201548.4(CERKL):c.769C>T ; NM_201548.4(CERKL):c.780del

GENE

CFTR

DISEASES
Aquagenic palmoplantar keratoderma
SUMMARY

A rare skin disease characterized by transient wrinkling of the skin, edema, formation of whitish papules, pruritus, burning sensation, or pain, on the palms and/or soles in response to contact with water. Duration of exposure and water temperature affect the rate of development and intensity of the lesions. The condition is more common in females than in males and frequently occurs in patients with cystic fibrosis.

CLINICAL DESCRIPTION

Congenital bilateral absence of vas deferens
SUMMARY

Congenital bilateral absence of the vas deferens (CBAVD) is a condition leading to male infertility.

CLINICAL DESCRIPTION

Infertile patients with CBAVD produce small volumes of acidic sperm (<1 ml with a pH<7.0).

Cystic fibrosis
SUMMARY

A rare, genetic pulmonary disorder characterized by sweat, thick mucus secretions causing multisystem disease, chronic infections of the lungs, bulky diarrhea and short stature.

CLINICAL DESCRIPTION

CF is chronic and usually progressive. Symptoms often start at birth and involve the lungs and gastrointestinal tract. A common presentation might include thick secretions and chronic infections in the lung, bulky diarrhea and short stature. Abnormal airway secretions, inflammation and infections lead to bronchiectasis and early death. CF-related diabetes (CFRD) occurs at high frequency, rising to nearly 50% of patients surviving to age 50. Male sterility is common. Individuals with mild phenotypes may have mild or absent respiratory symptoms in childhood, but some may have infertility or may develop bronchiectasis or pancreatitis later in life. These individuals are typically diagnosed by newborn screening, but may be diagnosed later in life.

Hereditary chronic pancreatitis
SUMMARY

A rare gastroenterologic disease characterized by recurrent acute pancreatitis and/or chronic pancreatitis in at least 2 first-degree relatives, or 3 or more second-degree relatives in 2 or more generations, for which no predisposing factors are identified. This rare inherited form of pancreatitis leads to irreversible damage to both exocrine and endocrine components of the pancreas.

CLINICAL DESCRIPTION

Onset of HCP is typically early in life, during childhood and adolescence. The clinical presentation is highly variable and includes chronic or intermittent mild to severe abdominal pain associated with exocrine pancreatic insufficiency, leading to maldigestion and/or pancreatic endocrine insufficiency (glucose intolerance progressing to diabetes mellitus type 3c) in some cases. The disease is slowly progressive. The risk of developing pancreatic carcinoma after the age of 50 is elevated in patients with HCP. However, the exact risk increase is difficult to assess.

Idiopathic bronchiectasis
SUMMARY

Idiopathic bronchiectasis(IB) is a progressive lung disease characterized by chronic dilation of the bronchi and destruction of the bronchial walls in the absence of any underlying cause (such as post infectious disease, aspiration, immunodeficiency, congenital abnormalities and ciliary anomalies).

CLINICAL DESCRIPTION

Male infertility with azoospermia or oligozoospermia due to single gene mutation
SUMMARY

Male infertility with azoospermia or oligospermia due to single gene mutation is a rare, genetic male infertility due to sperm disorder characterized by the absence of a measurable amount of spermatozoa in the ejaculate (azoospermia), or a number of sperm in the ejaculate inferior to 15 million/mL (oligozoospermia), resulting from a mutation in a single gene known to cause azoo- or oligo-spermia. Sperm morphology may be normal.

CLINICAL DESCRIPTION

Congenital bilateral aplasia of the vas deferens (CBAVD), which leads to male infertility, may occur in isolation or as a manifestation of cystic fibrosis. It has been found that males with cystic fibrosis are infertile because of failure of normal development of the vas deferens. Others concluded that the changes in the transport ducts of the male genital system are responsible for infertility and are not a developmental anomaly but a degenerative change due to obstruction similar to that which occurs in the pancreas and salivary glands in cystic fibrosis.

VARIANTS

NM_000492.3(CFTR):c.-165G>A ; NM_000492.3(CFTR):c.1046C>T ; NM_000492.3(CFTR):c.1052C>G ; NM_000492.3(CFTR):c.1054C>T ; NM_000492.3(CFTR):c.1210-11T>G ; NM_000492.3(CFTR):c.1327G>T ; NM_000492.3(CFTR):c.137C>T ; NM_000492.3(CFTR):c.1399C>T ; NM_000492.3(CFTR):c.1517T>C ; NM_000492.3(CFTR):c.1523T>G ; NM_000492.3(CFTR):c.164+2dup ; NM_000492.3(CFTR):c.1684G>C ; NM_000492.3(CFTR):c.1766G>A ; NM_000492.3(CFTR):c.1826A>T ; NM_000492.3(CFTR):c.2249C>T ; NM_000492.3(CFTR):c.2252G>T ; NM_000492.3(CFTR):c.2421A>G ; NM_000492.3(CFTR):c.2506G>T ; NM_000492.3(CFTR):c.2758G>A ; NM_000492.3(CFTR):c.2813T>G ; NM_000492.3(CFTR):c.2855T>C ; NM_000492.3(CFTR):c.2856G>C ; NM_000492.3(CFTR):c.2900T>C ; NM_000492.3(CFTR):c.2909-15T>G ; NM_000492.3(CFTR):c.2936A>C ; NM_000492.3(CFTR):c.2939T>A ; NM_000492.3(CFTR):c.2991G>C ; NM_000492.3(CFTR):c.3200C>T ; NM_000492.3(CFTR):c.3485G>T ; NM_000492.3(CFTR):c.3737C>T ; NM_000492.3(CFTR):c.3873G>C ; NM_000492.3(CFTR):c.4056G>T ; NM_000492.3(CFTR):c.410T>C ; NM_000492.3(CFTR):c.4357C>T ; NM_000492.3(CFTR):c.443T>A ; NM_000492.3(CFTR):c.509G>A ; NM_000492.3(CFTR):c.571T>G ; NM_000492.3(CFTR):c.592G>A ; NM_000492.3(CFTR):c.601G>A ; NM_000492.3(CFTR):c.772A>G ; NM_000492.3(CFTR):c.794T>G ; NM_000492.3(CFTR):c.869+5G>A ; NM_000492.3(CFTR):c.941G>A ; NM_000492.3(CFTR):c.100_117delTTGTCAGACATATACCAA ; NM_000492.3(CFTR):c.1045G>C ; NM_000492.3(CFTR):c.1117-2A>G ; NM_000492.3(CFTR):c.1117G>A ; NM_000492.3(CFTR):c.1135G>T ; NM_000492.3(CFTR):c.114C>G ; NM_000492.3(CFTR):c.1209+1G>T ; NM_000492.3(CFTR):c.1210-2_1210-1delAG ; NM_000492.3(CFTR):c.1219G>T ; NM_000492.3(CFTR):c.1239dup ; NM_000492.3(CFTR):c.1301C>G ; NM_000492.3(CFTR):c.1315C>T ; NM_000492.3(CFTR):c.1330_1331delAT ; NM_000492.3:c.1347_1350del ; NM_000492.3(CFTR):c.1370_1378delCTGGATCCA ; NM_000492.3(CFTR):c.1408_1417del10 ; NM_000492.3(CFTR):c.1415dup ; NM_000492.3(CFTR):c.1438G>T ; NM_000492.3(CFTR):c.1469del ; NM_000492.3(CFTR):c.1505T>G ; NM_000492.3(CFTR):c.1525G>C ; NM_000492.3(CFTR):c.1559T>A ; NM_000492.3(CFTR):c.164+1G>C ; NM_000492.3(CFTR):c.1654C>A ; NM_000492.3(CFTR):c.1680-1G>C ; NM_000492.3(CFTR):c.1680-883A>G ; NM_000492.3(CFTR):c.1700A>C ; NM_000492.3(CFTR):c.1703T>A ; NM_000492.3(CFTR):c.1760T>C ; NM_000492.3(CFTR):c.1766+2T>A ; NM_000492.3(CFTR):c.1766+2T>C ; NM_000492.3(CFTR):c.1767-1G>A ; NM_000492.3(CFTR):c.1853T>C ; NM_000492.3(CFTR):c.1979C>G ; NM_000492.3(CFTR):c.1990G>T ; NM_000492.3(CFTR):c.2036G>A ; NM_000492.3(CFTR):c.2044delA ; NM_000492.3(CFTR):c.2184_2185insA ; NM_000492.3(CFTR):c.2395C>T ; NM_000492.3(CFTR):c.2429delG ; NM_000492.3(CFTR):c.2475_2478dup ; NM_000492.3(CFTR):c.2483dupA ; NM_000492.3(CFTR):c.2490+2T>C ; NM_000492.3(CFTR):c.2491-2A>C ; NM_000492.3(CFTR):c.2552G>T ; NM_000492.3(CFTR):c.2554dupT ; NM_000492.3:c.2573delG ; NM_000492.3(CFTR):c.2644_2645dup ; NM_000492.3(CFTR):c.273G>C ; NM_000492.3(CFTR):c.2768C>A ; NM_000492.3(CFTR):c.2805_2810delACCACTinsTCAGA ; NM_000492.3(CFTR):c.2822delT ; NM_000492.3(CFTR):c.2854delA ; NM_000492.3(CFTR):c.2908+1G>A ; NM_000492.3(CFTR):c.2909_2924dup ; NM_000492.3(CFTR):c.2932A>T ; NM_000492.3(CFTR):c.2982_2988+2del ; NM_000492.3(CFTR):c.2986dup ; NM_000492.3(CFTR):c.2988+1G>C ; NM_000492.3(CFTR):c.2988+1G>T ; NM_000492.3(CFTR):c.2989-2A>T ; NM_000492.3(CFTR):c.2993delT ; NM_000492.3(CFTR):c.2997_3000delAATT ; NM_000492.3(CFTR):c.2T>C ; NM_000492.3(CFTR):c.3014T>G ; NM_000492.3(CFTR):c.3022delG ; NM_000492.3(CFTR):c.3038C>A ; NM_000492.3(CFTR):c.3067_3072delATAGTG ; NM_000492.3(CFTR):c.3095A>G ; NM_000492.3(CFTR):c.3103C>T ; NM_000492.3(CFTR):c.3139+1delG ; NM_000492.3(CFTR):c.3140-1G>A ; NM_000492.3(CFTR):c.3254A>G ; NM_000492.3(CFTR):c.325T>C ; NM_000492.3(CFTR):c.327T>A ; NM_000492.3(CFTR):c.328G>T ; NM_000492.3(CFTR):c.3324delC ; NM_000492.3(CFTR):c.3368-2A>T ; NM_000492.3(CFTR):c.3468+1G>A ; NM_000492.3(CFTR):c.346G>A ; NM_000492.3(CFTR):c.3495delG ; NM_000492.3(CFTR):c.3529A>T ; NM_000492.3(CFTR):c.3533C>A ; NM_000492.3(CFTR):c.3536_3539delCCAA ; NM_000492.3(CFTR):c.3546C>G ; NM_000492.3(CFTR):c.3617C>G ; NM_000492.3(CFTR):c.370G>C ; NM_000492.3(CFTR):c.3712C>T ; NM_000492.3(CFTR):c.3739G>A ; NM_000492.3(CFTR):c.380_382dupTAT ; NM_000492.3(CFTR):c.3841C>T ; NM_000492.3(CFTR):c.3851_3852dupAA ; NM_000492.3(CFTR):c.3873+1G>T ; NM_000492.3(CFTR):c.3874-2A>G ; NM_000492.3(CFTR):c.3922G>T ; NM_000492.3(CFTR):c.3929G>A ; NM_000492.3(CFTR):c.3944_3951del8 ; NM_000492.3(CFTR):c.3957_3958insAGGG ; NM_000492.3(CFTR):c.3963+1G>C ; NM_000492.3(CFTR):c.3963+2T>G ; NM_000492.3(CFTR):c.3988_3989delCA ; NM_000492.3(CFTR):c.3997G>T ; NM_000492.3(CFTR):c.4035_4038dup ; NM_000492.3(CFTR):c.405_406dup ; NM_000492.3(CFTR):c.4078del ; NM_000492.3(CFTR):c.4143C>G ; NM_000492.3(CFTR):c.4199delG ; NM_000492.3(CFTR):c.4242+2T>C ; NM_000492.3(CFTR):c.4242+5G>A ; NM_000492.3(CFTR):c.4243-2A>G ; NM_000492.3(CFTR):c.4252G>T ; NM_000492.3(CFTR):c.4252delG ; NM_000492.3(CFTR):c.4272C>A ; NM_000492.3(CFTR):c.4272C>G ; NM_000492.3(CFTR):c.4280T>C ; NM_000492.3(CFTR):c.4297G>T ; NM_000492.3:c.4307_4320del14 ; NM_000492.3(CFTR):c.4329delC ; NM_000492.3(CFTR):c.4339delG ; NM_000492.3(CFTR):c.4364C>A ; NM_000492.3(CFTR):c.4417G>T ; NM_000492.3(CFTR):c.445G>T ; NM_000492.3(CFTR):c.476T>C ; NM_000492.3(CFTR):c.488delA ; NM_000492.3(CFTR):c.489+2T>C ; NM_000492.3(CFTR):c.490-1G>A ; NM_000492.3(CFTR):c.506dup ; NM_000492.3(CFTR):c.56G>A ; NM_000492.3(CFTR):c.619C>T ; NM_000492.3(CFTR):c.657dup ; NM_000492.3(CFTR):c.739_742dupTACA ; NM_000492.3(CFTR):c.743+1G>C ; NM_000492.3(CFTR):c.744-2A>G ; NM_000492.3(CFTR):c.811delT ; NM_000492.3(CFTR):c.835G>T ; NM_000492.3(CFTR):c.865A>T ; NM_000492.3(CFTR):c.869+3A>T ; NM_000492.3(CFTR):c.870-1G>C ; NM_000492.3(CFTR):c.888_889dupTC ; NM_000492.3(CFTR):c.950T>A ; NM_000492.3(CFTR):c.997C>T ; NC_000007.14:g.117535413T>C ; NC_000007.14:g.117540346G>T ; NC_000007.14:g.117559618_117559619delGA ; NC_000007.14:g.117667065delT ; NM_000492.3(CFTR):c.*8753C>T ; NM_000492.4:c.-9_14delCGAGAGACCATGCAGAGGTCGCC ; NM_000492.4:c.1000C>T ; NM_000492.3(CFTR):c.1001G>T ; NM_000492.3(CFTR):c.1006_1007insG ; NM_000492.4:c.1007T>A ; NM_000492.4:c.1013C>T ; c.1018del ; NM_000492.4:c.1021T>C ; NM_000492.4:c.1021_1022dupTC ; NM_000492.3:c.1029_1030insG ; NM_000492.4:c.1029delC ; NM_000492.3(CFTR):c.1037T>C ; NM_000492.4:c.1040G>A ; NM_000492.4:c.1040G>C ; NM_000492.3:c.1053_1054delTC ; NM_000492.4:c.1055G>A ; c.1057C>T ; c.1068G>A ; NM_000492.4:c.1075C>A ; NM_000492.4:c.1079C>A ; NM_000492.4:c.1081delT ; NM_000492.3(CFTR):c.1083delG ; NM_000492.3(CFTR):c.1084_1088dup ; NM_000492.3(CFTR):c.1093_1094delCT ; NM_000492.4:c.1116+1G>A ; NM_000492.3(CFTR):c.1116+1G>T ; NM_000492.4:c.1117-1G>A ; NM_000492.3(CFTR):c.1126C>T ; NM_000492.4:c.1128dupA ; NM_000492.3(CFTR):c.1141A>T ; NM_000492.3:c.1155_1156dup ; NM_000492.4:c.1155_1156dupTA ; c.1155_1156insTA ; c.1159_1160del ; NM_000492.4:c.115C>T ; c.1162_1168del ; c.1192dup ; NM_000492.4:c.11C>A ; NM_000033.4:c.1202G>A ; NM_000492.4:c.1203G>A ; NM_000492.4:c.1209+1G>A ; NM_000492.3(CFTR):c.1211delG ; NM_000492.3(CFTR):c.1234_1238delGCAAA ; NM_014049.5:c.1240C>T ; NM_000492.3(CFTR):c.1297_1303delTTCTCAC ; NM_000492.3(CFTR):c.1301C>A ; NM_000492.4:c.1327_1330dupGATA ; NM_000492.3(CFTR):c.1329_1350del ; NM_000492.4:c.1340delA ; NM_000492.4:c.1364C>A ; NM_000492.3(CFTR):c.1367T>C ; NM_000492.3(CFTR):c.1373G>T ; NM_000492.3(CFTR):c.1373delG ; NM_000492.4:c.137C>A ; NM_000492.4:c.1393-1G>A ; NM_000492.4:c.1393-2A>G ; NM_000492.4:c.1397C>A ; NM_000492.4:c.1397C>G ; NM_000492.4:c.1400T>C ; NM_000492.4:c.1418delG ; c.1433_1434del ; c.1435G>T ; NM_000492.4:c.1439G>A ; c.1439del ; NM_000492.3(CFTR):c.143_146ATCT[1] ; c.1456G>T ; NM_000492.4:c.1466C>A ; c.1470_1471del ; NM_000492.4:c.1475C>T ; NM_000492.4:c.1477C>T ; NM_000492.4:c.1477_1478delCA ; c.1482_1483del ; NM_000492.4:c.1487G>A ; NM_000492.3(CFTR):c.148T>C ; NM_000492.3(CFTR):c.1505T>C ; NM_000492.3(CFTR):c.1510G>T ; NM_000492.3(CFTR):c.1518C>G ; NM_000492.4:c.1519_1521delATC ; NM_000492.4:c.1521_1523delCTT ; NM_000492.3:c.1526delG ; c.1528del ; NM_000492.3(CFTR):c.1538A>G ; NM_000492.4:c.1545_1546delTA ; NM_000492.3(CFTR):c.1550A>G ; NM_000492.3:c.156_163dupATTGGAAA ; NM_000492.3:c.156delA ; NM_000492.4:c.1572C>A ; NM_000492.4:c.1573C>T ; NM_000492.4:c.1584+1G>A ; c.1584+2T>C ; NM_000492.3:c.1584.1G-T ; NM_000492.4:c.1585-1G>A ; NM_000492.3(CFTR):c.1585-2A>G ; NM_000492.4:c.1585-8G>A ; c.1616_1617dup ; NM_000492.4:c.1624G>T ; NM_000492.4:c.164+1G>A ; NM_000492.4:c.164+1G>T ; NM_000492.4:c.164+2T>C ; NM_000492.3(CFTR):c.164+3_164+4insT ; NM_000492.3:c.164.2T-G ; NM_000492.3:c.1642_1643delCT ; NM_000492.4:c.1645A>C ; NM_000492.3:c.1645_1648delAGTG ; NM_000492.4:c.1646G>A ; NM_000492.3(CFTR):c.1646G>T ; NM_000492.3(CFTR):c.1647T>A ; NM_000492.4:c.1647T>G ; NM_000492.4:c.1648G>T ; NM_000492.4:c.165-1G>A ; NM_000492.3:c.165-2A-G ; NM_000492.3(CFTR):c.165-3C>T ; NM_000492.4:c.1650delA ; NM_000492.4:c.1651G>A ; NM_000492.4:c.1652G>A ; NM_000492.4:c.1654C>T ; NM_000492.3(CFTR):c.1656delA ; NM_000492.4:c.1657C>T ; NM_000492.4:c.166G>A ; NM_000492.3(CFTR):c.166G>T ; NM_000492.4:c.1670delC ; NM_000492.4:c.1673T>C ; c.1674del ; NM_000492.4:c.1675G>A ; NM_000492.4:c.1679+1643G>T ; NM_000492.4:c.1679+1G>A ; NM_000492.4:c.1679+1G>C ; c.1679+2T>C ; NM_000492.4:c.1679G>A ; NM_000492.4:c.1679G>C ; NM_000492.4:c.1680-1G>A ; NM_000492.4:c.1680-886A>G ; NM_000492.3(CFTR):c.1680A>C ; NM_000492.4:c.1682C>A ; c.1682dup ; NM_000492.3(CFTR):c.1687T>A ; NM_000492.3(CFTR):c.1687T>C ; NM_000492.3(CFTR):c.1687T>G ; NM_000492.4:c.1692delA ; NM_000492.3(CFTR):c.169T>G ; NM_000492.4:c.1703delT ; NM_000492.4:c.1705T>G ; NM_000492.3(CFTR):c.1706A>G ; NM_000492.4:c.170G>A ; NM_000492.4:c.171G>A ; NM_000492.4:c.1721C>A ; NM_000492.3:c.1731C-A ; NM_000492.3:c.1733_1734del ; NM_000492.4:c.174_177delTAGA ; NM_000492.4:c.1753G>T ; NM_000492.4:c.175dupA ; NM_000492.4:c.1766+1G>A ; NM_000492.3(CFTR):c.1766+3A>C ; NM_000492.4:c.1766+3A>G ; NM_000492.4:c.1766+5G>T ; NM_000492.4:c.178G>T ; c.1792A>T ; NM_000492.4:c.1792_1798delAAAACTA ; NM_000492.3:c.1800delG ; NM_000492.4:c.1826A>G ; NM_000492.3(CFTR):c.1837G>A ; c.1871_1878del ; NM_000492.3(CFTR):c.1882G>A ; NM_000492.3(CFTR):c.1882G>C ; NM_000492.3:c.1900C-T ; NM_000492.4:c.1911delG ; c.1920_1921dup ; NM_000492.4:c.1923_1931delCTCAAAACTinsA ; NM_000492.3(CFTR):c.1936G>T ; NM_000492.3(CFTR):c.1943A>T ; NM_000492.3:c.1970delG ; NM_000492.4:c.1973_1985delGAAATTCAATCCTinsAGAAA ; NM_000492.3:c.1973delGAAATTCAATCCTinsAGAAA ; NM_000492.4:c.1986_1989delAACT ; NM_000492.3(CFTR):c.19G>T ; NM_000492.3:c.1A-C ; NM_000492.4:c.1A>G ; NM_000492.4:c.200C>T ; NM_000492.3:c.2010dupA ; NM_000492.4:c.2012delT ; NM_000492.4:c.2017G>T ; NM_000492.4:c.2051_2052delAAinsG ; c.2051_2052insT ; NM_000492.4:c.2052delA ; NM_000492.4:c.2052dupA ; NM_000492.4:c.2053C>T ; NM_000492.4:c.2053dupC ; c.2058_2061dup ; NM_000492.3:c.2062A-T ; NM_000492.3:c.2065C-T ; NM_000492.3(CFTR):c.2083_2084insG ; NM_000492.3:c.2089_2090insA ; NM_000492.3:c.2108delA ; NM_000492.4:c.2125C>T ; NM_000492.4:c.2128A>T ; NM_000492.4:c.2143C>T ; NM_000492.3(CFTR):c.2146A>T ; NM_000492.4:c.2158C>T ; NM_000492.4:c.2175dupA ; NM_000492.3:c.217delC ; NM_000492.4:c.2195T>G ; NM_000492.4:c.2215delG ; NM_000492.3:c.2233G-T ; NM_000492.4:c.223C>T ; NM_000492.4:c.2241_2248del8 ; c.2249_2256del ; c.2276_2277del ; NM_000492.3:c.2276_2277delCC ; NM_000492.4:c.2290C>T ; NM_000492.3(CFTR):c.2291delG ; NM_000492.3:c.2324_2325delAC ; c.233del ; NM_000492.4:c.233dupT ; NM_000492.3:c.2341C-T ; NM_000492.3:c.234delC ; NM_000492.4:c.2353C>T ; NM_000492.4:c.2374C>T ; c.2380del ; NM_000492.4:c.2423_2424dupAT ; NM_000492.3:c.2435dupT ; NM_000492.3(CFTR):c.2443G>T ; NM_000492.4:c.2453delT ; NM_000492.4:c.2463_2464delTG ; NM_000492.4:c.2464G>T ; NM_000492.3:c.2467G-T ; NM_000492.3(CFTR):c.2476G>T ; NM_000492.3(CFTR):c.2479G>T ; NM_000492.3:c.248dupT ; NM_000492.4:c.2490+1G>A ; NM_000492.3:c.2490.1G-T ; c.2491-2A>G ; NM_000492.4:c.2491G>T ; c.2502del ; NM_000492.3:c.2502delT ; NM_000492.3:c.2508delT ; NM_000492.4:c.2537G>A ; NM_000492.3(CFTR):c.2538G>A ; NM_000492.4:c.2547C>A ; NM_000492.4:c.254G>A ; NM_000492.4:c.2551C>T ; c.2556T>G ; c.2562del ; NM_000492.3:c.2566_2567insT ; NM_000492.4:c.2583delT ; NM_000492.4:c.2589_2599delAATTTGGTGCT ; NM_000492.3:c.2600T-A ; NM_000492.4:c.2601dupA ; NM_000492.3:c.2615delC ; NM_000492.4:c.2619+1G>A ; NM_000492.3:c.2619.2dupT ; NM_000492.3:c.2620-1G-T ; NM_000492.3(CFTR):c.2620-2A>G ; NM_000492.4:c.262_263delTT ; NM_000492.4:c.263T>A ; NM_000492.4:c.263T>G ; NM_000492.4:c.2645G>A ; NM_000492.3(CFTR):c.2657+1_2657+2insA ; NM_000492.4:c.2657+5G>A ; NM_000492.3:c.2658-1G-T ; NM_000492.4:c.2658-1G>C ; NM_000492.3(CFTR):c.2658-2A>G ; NM_000492.4:c.2668C>T ; NM_000492.3:c.2686_2687insT ; NM_000492.3(CFTR):c.2700T>A ; NM_000492.4:c.271G>A ; NM_000492.4:c.273+1G>A ; NM_000492.4:c.273+3A>C ; NM_000492.3(CFTR):c.273+4A>G ; NM_000492.4:c.2735C>A ; NM_000492.4:c.2737_2738insG ; NM_000492.3(CFTR):c.2738A>G ; NM_000492.4:c.2739T>A ; NM_000492.4:c.274-1G>A ; NM_000492.3(CFTR):c.274-2A>C ; NM_000492.4:c.274-2A>G ; NM_000492.4:c.274G>A ; NM_000492.4:c.274G>T ; NM_000492.4:c.2763_2764dupAG ; NM_000492.4:c.2780T>C ; NM_000492.4:c.2810dupT ; NM_000492.3(CFTR):c.2812dup ; NM_000492.4:c.2825delT ; NM_000492.4:c.2834C>T ; c.2836A>T ; NM_000492.3(CFTR):c.2845C>T ; NM_000492.4:c.2859_2890delACATTCTGTTCTTCAAGCACCTATGTCAACCC ; NM_000492.3:c.2869_2870insG ; NM_000492.4:c.2875delG ; NM_000492.3:c.2876delC ; NM_000492.4:c.2896delA ; c.2908+2T>C ; NM_000492.4:c.2908G>C ; c.2909-1G>A ; NM_000492.3(CFTR):c.2909G>A ; NM_000492.3:c.2924_2925delGA ; NM_000492.4:c.292C>T ; NM_000492.3(CFTR):c.2936A>T ; NM_000492.3(CFTR):c.293A>G ; c.2947_2948del ; NM_000492.3:c.2968dupA ; NM_000492.3(CFTR):c.296C>T ; NM_000492.4:c.2988+1G>A ; c.2988+2T>C ; NM_000492.4:c.2988G>A ; NM_000492.4:c.2989-1G>A ; NM_000492.4:c.2989-2A>G ; NM_000492.3(CFTR):c.2T>G ; NM_000492.4:c.3002_3003delTG ; NM_000492.4:c.3017C>A ; NM_000492.3(CFTR):c.3032T>G ; NM_000492.4:c.3039delC ; NM_000492.4:c.3039dupC ; NM_000492.3(CFTR):c.303_304insA ; NM_000492.3:c.3042_3043delCA ; NM_000492.3(CFTR):c.305T>G ; c.3068_3072del ; c.307G>T ; NM_000492.3:c.3103C-T ; NM_000492.3(CFTR):c.3107C>A ; NM_000492.4:c.310delA ; NM_000492.3(CFTR):c.3110C>A ; NM_138477.4:c.3124C>T ; c.3139+1G>A ; NM_000492.4:c.3139_3139+1delGG ; NM_000492.4:c.313delA ; NM_000492.4:c.3140-26A>G ; NM_000492.4:c.3160C>G ; NM_000492.3(CFTR):c.3161delA ; NM_000492.4:c.3181G>C ; NM_000492.3(CFTR):c.3184_3188dupCTATG ; NM_000492.3(CFTR):c.3188G>A ; NM_000492.4:c.3194T>C ; NM_000492.4:c.3196C>T ; NM_000492.4:c.3197G>A ; NM_000492.3:c.3211C-T ; NM_000492.3(CFTR):c.3212A>C ; NM_000492.3(CFTR):c.3217dup ; NM_000492.4:c.3230T>C ; NM_000492.4:c.325_327delTATinsG ; NM_000492.4:c.3266G>A ; NM_000492.3(CFTR):c.326A>G ; NM_000492.4:c.3276C>A ; NM_000492.4:c.3276C>G ; NM_000492.3:c.3287delT ; NM_000492.4:c.328G>C ; c.3291del ; NM_000492.4:c.3292T>C ; NM_000492.4:c.3293G>A ; NM_000492.4:c.3294G>A ; NM_000492.3(CFTR):c.3294G>C ; NM_000492.3(CFTR):c.3294G>T ; NM_000492.3:c.3294delG ; NM_000492.4:c.3299A>C ; NM_000492.4:c.3302T>A ; NM_000492.4:c.3304A>T ; NM_000492.4:c.3310G>T ; NM_000492.3(CFTR):c.3343dup ; NM_000492.3(CFTR):c.3353C>T ; NM_000492.3:c.3364delA ; NM_000492.3(CFTR):c.3367+1G>A ; NM_000492.3(CFTR):c.3367+2T>A ; NM_000492.3:c.3367.2T-C ; NM_000492.3:c.3368-1G-A ; NM_000492.4:c.3368-2A>G ; NM_000492.3:c.3382A-T ; c.340A>T ; NM_000492.3(CFTR):c.3421_3424dupAGTA ; c.3430C>T ; NM_000492.3:c.3434G-A ; NM_000492.4:c.3435G>A ; NM_000492.3:c.343G-T ; NM_000492.3:c.3445delT ; NM_000492.4:c.3454G>C ; NM_000492.3(CFTR):c.3468+2dup ; NM_000492.3(CFTR):c.3468+5G>A ; NM_000492.3:c.3468.2T-C ; NM_000492.3(CFTR):c.3468G>A ; NM_000492.4:c.3469-2A>G ; NM_000492.4:c.3472C>T ; NM_000492.3(CFTR):c.3475T>C ; NM_000492.3(CFTR):c.3476C>T ; NM_000492.4:c.3484C>T ; NM_000492.3(CFTR):c.3485_3486delGA ; NM_000492.3(CFTR):c.3492dup ; c.3497del ; NM_000492.4:c.349C>T ; NM_000492.4:c.3528delC ; NM_000492.3(CFTR):c.3530delA ; NM_000492.3(CFTR):c.3532_3535dupTCAA ; c.3540del ; c.3556C>T ; c.357del ; NM_000492.4:c.3587C>G ; NM_000492.3:c.35_36insTATCA ; NM_000492.3:c.3600delA ; NM_000492.4:c.3605delA ; NM_000492.4:c.3611G>A ; NM_000492.4:c.3612G>A ; NM_000492.3:c.3617C-A ; c.3623del ; c.3658dup ; NM_000492.4:c.3659delC ; NM_000492.3:c.3664_3665insTCAA ; NM_000492.4:c.366T>A ; NM_000492.4:c.3691delT ; NM_000492.4:c.3700A>G ; NM_000492.3(CFTR):c.3717+1G>A ; NM_000492.4:c.3717+40A>G ; NM_000492.4:c.3717+4A>G ; NM_000492.3(CFTR):c.3717+5G>A ; NM_000492.3(CFTR):c.3717G>A ; NM_000492.4:c.3718-1G>A ; NM_000492.4:c.3718-2477C>T ; NM_000492.4:c.3718-3T>G ; NM_000492.3(CFTR):c.3719T>G ; NM_000492.3(CFTR):c.3728T>A ; NM_000492.4:c.3731G>A ; NM_000492.4:c.3744delA ; NM_000492.3(CFTR):c.3745G>A ; NM_000492.3(CFTR):c.3745G>C ; NM_000492.4:c.3747delG ; NM_000492.4:c.3752G>A ; NM_000492.4:c.3761T>G ; NM_000492.4:c.3763T>C ; NM_000492.4:c.3764C>A ; NM_000492.3(CFTR):c.3767dupC ; NM_000492.4:c.3773dupT ; NM_000492.3:c.3774dupG ; NM_000492.3(CFTR):c.377G>A ; NM_000492.3(CFTR):c.3808del ; c.3835_3836del ; NM_000492.3(CFTR):c.3844T>G ; NM_000492.4:c.3846G>A ; NM_000492.4:c.3848G>T ; NM_000492.3(CFTR):c.3857T>C ; NM_000492.4:c.3873+1G>A ; NM_000492.4:c.3873+2T>C ; NM_000492.3(CFTR):c.3874-1G>A ; NM_000492.3:c.3876delA ; NM_000492.3:c.3883_3884insG ; NM_000492.4:c.3883_3886delATTT ; NM_000492.4:c.3883delA ; NM_000492.3(CFTR):c.3889dupT ; NM_000492.4:c.3891dupT ; NM_000492.3(CFTR):c.38C>T ; NM_000492.3(CFTR):c.3900dup ; NM_000492.3(CFTR):c.3907A>C ; NM_000492.4:c.3908delA ; NM_000492.4:c.3909C>G ; c.3917_3918dup ; NM_000492.3(CFTR):c.3925C>T ; NM_000492.4:c.3937C>T ; NM_000492.3(CFTR):c.3947G>A ; NM_000492.3(CFTR):c.3963+1G>A ; c.3963+1G>T ; NM_000492.3:c.3964-1G-A ; NM_000492.3(CFTR):c.3971T>C ; NM_000492.3(CFTR):c.3988C>T ; NM_000492.3(CFTR):c.3999delG ; NM_000492.3(CFTR):c.3G>A ; NM_000492.3(CFTR):c.4004T>C ; NM_000492.4:c.4036_4042delCTAAGCC ; NM_000492.3:c.4039dupA ; NM_000492.4:c.4046G>A ; NM_000492.4:c.4077_4080delTGTTinsAA ; NM_000492.4:c.4086dupT ; NM_000492.3(CFTR):c.409_412delCTCC ; NM_000492.4:c.409delC ; NM_000492.3:c.40A-T ; NM_000492.4:c.4111G>T ; NM_000492.3(CFTR):c.4124A>C ; NM_000492.3(CFTR):c.4127_4131delTGGAT ; NM_000492.3(CFTR):c.4136+1G>A ; NM_000492.4:c.413_415dupTAC ; NM_000492.3:c.4140delA ; NM_000492.4:c.4144C>T ; NM_000492.4:c.4147dupA ; NM_000492.3:c.415_416insGA ; NM_000492.3:c.415_416insTA ; NM_000492.3(CFTR):c.416A>G ; NM_000492.4:c.416A>T ; c.4170delA ; NM_000492.3:c.4170delA ; NM_000492.4:c.4197_4198delCT ; c.4200_4201del ; c.4201dup ; c.420dup ; NM_000492.4:c.4231C>T ; NM_000492.4:c.4234C>T ; NM_000492.4:c.4242+1G>A ; NM_000492.4:c.4242+1G>T ; NM_000492.3:c.4243-1G-C ; NM_000492.3:c.4243-2A-C ; NM_000492.3(CFTR):c.424delA ; NM_000492.4:c.4251delA ; NM_000492.3(CFTR):c.429delT ; NM_000492.3(CFTR):c.4300_4301dupAG ; NM_000492.4:c.4364C>G ; NM_000492.3(CFTR):c.4426C>T ; NM_000492.4:c.442delA ; NM_000492.3(CFTR):c.454A>G ; NM_000492.3(CFTR):c.459_476delAATAGCTATGTTTAGTTT ; NM_000492.3(CFTR):c.470_483delTTAGTTTGATTTAT ; NM_000492.3:c.476T-A ; NM_000492.3:c.476dupT ; NM_000492.3(CFTR):c.481T>G ; NM_000492.4:c.487A>G ; NM_000492.4:c.489+1G>T ; NM_000492.3(CFTR):c.490-1G>T ; NM_000492.3:c.490-2A-C ; NM_000492.3(CFTR):c.494T>C ; NM_000492.3(CFTR):c.49_50dupTT ; NM_000492.3(CFTR):c.4C>T ; NM_000492.4:c.50delT ; NM_000492.3:c.51delC ; NM_000492.4:c.523A>G ; NM_000492.3:c.526delA ; NM_000492.4:c.53+1G>T ; NM_000492.4:c.531delT ; NM_000048.4:c.532G>A ; c.54-1G>A ; c.54-2A>G ; NM_000492.4:c.543_546delTAGT ; NM_000492.4:c.575A>G ; NM_000492.4:c.577G>T ; c.578_579+5del ; NM_000492.4:c.579+1G>T ; NM_000492.4:c.579+3A>G ; NM_000492.4:c.579+5G>A ; NM_000492.4:c.57G>A ; NM_000492.4:c.580-1G>T ; NM_000492.3(CFTR):c.580-2A>C ; NM_000492.4:c.595C>T ; c.601del ; NM_000492.4:c.613C>T ; NM_000492.4:c.617T>G ; NM_000492.4:c.647G>A ; NM_000492.3:c.650_659del10 ; NM_000492.4:c.658C>T ; NM_000492.4:c.675T>A ; NM_000492.4:c.680T>G ; NM_000492.3(CFTR):c.695T>A ; c.708del ; NM_000492.3(CFTR):c.717delG ; NM_000492.4:c.720_741delAGGGAGAATGATGATGAAGTAC ; NM_000492.3(CFTR):c.743+1G>A ; NM_000492.3(CFTR):c.744-14_744-3del ; NM_000492.4:c.761delA ; NM_000492.3(CFTR):c.79G>A ; NM_000492.4:c.79G>T ; NM_000492.4:c.803delA ; NM_000492.3(CFTR):c.805_806delAT ; NM_000492.4:c.825C>G ; NM_000492.4:c.828C>A ; NM_000492.3(CFTR):c.830G>A ; NM_000492.3(CFTR):c.848_860delAAATGATTGAAAAinsTG ; NM_000492.4:c.850dupA ; NM_000492.3(CFTR):c.860dup ; NM_000492.4:c.861_865delAACTT ; NM_000492.3:c.868C-T ; NM_000492.3(CFTR):c.869+1G>C ; NM_000492.3(CFTR):c.869+1G>T ; NM_000492.4:c.870-2A>G ; NM_000492.4:c.88C>T ; c.912C>G ; NM_000492.3:c.927delC ; NM_000492.3(CFTR):c.933C>G ; c.938C>A ; NM_000492.4:c.948delT ; NM_000492.3:c.959T-A ; NM_000492.4:c.987delA ; NM_000492.4:c.988G>T ; NC_000007.14:g.117480098delC ; NC_000007.14:g.117480138T>C ; NC_000007.14:g.117509112delT ; NC_000007.14:g.117531058delC ; NC_000007.14:g.117531108_117531109insCC ; NC_000007.14:g.117534346delA ; NC_000007.14:g.117536669_117536673delAGACA ; NC_000007.14:g.117540159_117540161TCT[2] ; NC_000007.14:g.117540345delA ; NC_000007.14:g.117542096delC ; NC_000007.14:g.117559601_117559602delTT ; NC_000007.14:g.117592110del ; NC_000007.14:g.117592256delA ; NC_000007.14:g.117603631C>G ; NC_000007.14:g.117603753_117603756delCTAT ; NC_000007.14:g.117610541delC ; NC_000007.14:g.117611672_117611673delGT ; NC_000007.14:g.117627622_117627623delTT ; NC_000007.14:g.117642526T>A ; NC_000007.14:g.117664752delG ; NM_000478.6:c.1001G>A ; NM_000492.4:c.1210-7_1210-6del[5T] ; NM_000492.4:c.14C>T ; NM_000492.4:c.1736A>G ; NM_000492.4:c.1841A>G ; NM_000492.4:c.1865G>A ; NM_000492.4:c.220C>T ; NM_000492.4:c.2930C>T ; NM_000492.4:c.3154T>G ; NM_000492.4:c.3205G>A ; NM_000492.4:c.3208C>T ; NM_000492.4:c.3209G>A ; NM_000492.4:c.3222T>A ; NM_000492.4:c.330C>A ; NM_000492.4:c.3808G>A ; NM_000492.4:c.489+3A>G

GENE

CLN3

DISEASES
CLN3 disease
SUMMARY

Juvenile neuronal ceroid lipofuscinoses (JNCLs) are a genetically heterogeneous group of neuronal ceroid lipofuscinoses (NCLs; see this term) typically characterized by onset at early school age with vision loss due to retinopathy, seizures and the decline of mental and motor capacities.

CLINICAL DESCRIPTION

The classic form of JNCLs (cJNCLs, also referred to as Batten disease and Spielmeyer-Vogt disease) typically manifests with deteriorating vision in an otherwise healthy child at about six years of age. Blindness occurs within a few years. Several years after the onset of visual problems, cognitive abilities decline and epilepsy starts. Dementia and motor disturbances worsen progressively. Psychiatric problems (such as aggressive behavior and sleep problems) have also been reported. Rare cases of JNCL have also been described in which eye involvement is not a striking feature. Epilepsy and dementia without visual loss in these patients may be indicative of a form of JNCL known as the Northern epilepsy variant (progressive epilepsy-intellectual deficit, Finnish type; see this term).

VARIANTS

NM_001042432.1(CLN3):c.1272delG ; NM_001042432.1(CLN3):c.597C>A ; NM_001042432.1(CLN3):c.622dupT ; NM_000086.2(CLN3):c.883G>A

GENE

CLN5

DISEASES
CLN5 disease
SUMMARY

Late infantile neuronal ceroid lipofuscinoses (LINCLs) are a genetically heterogeneous group of neuronal ceroid lipofuscinoses (NCLs; see this term) typically characterized by onset during infancy or early childhood with decline of mental and motor capacities, epilepsy, and vision loss through retinal degeneration.

CLINICAL DESCRIPTION

The initial clinical symptoms are motor or/and cognitive decline or epilepsy but the mean age of onset and speed of progression may vary depending on the underlying genetic defect. Patients with classic LINCL generally present with a standstill of mental development or the onset of severe epilepsy around the third year of life. The disorder progresses to complete loss of almost all motor and mental capacities before school age. As visual loss is not a prominent finding in the early stages of the disease course, it is frequently not recognized. Several variant forms have also been described in the literature (vLINCL) in which the mean ages of onset generally vary from 2-7 years and which commonly manifest with severe epilepsy followed by cognitive and motor decline and vision loss.

VARIANTS

NM_006493.2(CLN5):c.1026C>A ; NM_006493.2(CLN5):c.335G>C ; NM_006493.2(CLN5):c.433C>T ; NM_006493.2(CLN5):c.524T>G ; NM_006493.2(CLN5):c.565C>T ; NM_006493.2(CLN5):c.575A>G ; NM_006493.2(CLN5):c.593T>C ; NM_006493.2(CLN5):c.595C>T ; NM_006493.2(CLN5):c.613C>T ; NM_006493.2(CLN5):c.620G>C ; NM_006493.2(CLN5):c.669dupC ; NM_006493.2(CLN5):c.919delA ; NM_006493.2(CLN5):c.924_925delAT ; NM_006493.2(CLN5):c.377G>A ; NM_006493.2:c.526dupA ; NM_006493.2(CLN5):c.835G>A ; NM_006493.2(CLN5):c.955_970del16

GENE

CLN6

DISEASES
CLN4A disease
SUMMARY

A genetically heterogeneous group of neuronal ceroid lipofuscinoses (NCLs) with onset during the third decade of life, characterized by dementia, seizures and loss of motor capacities, and sometimes associated with visual loss caused by retinal degeneration.

CLINICAL DESCRIPTION

The clinical picture is characterized by onset with progressive myoclonic epilepsy or behavioral disturbances, dementia and extrapyramidal motor symptoms that appear at the age of 20-30 years. Vision loss is an uncommon feature and depends on the underlying genetic cause.

CLN6 disease
SUMMARY

Late infantile neuronal ceroid lipofuscinoses (LINCLs) are a genetically heterogeneous group of neuronal ceroid lipofuscinoses (NCLs; see this term) typically characterized by onset during infancy or early childhood with decline of mental and motor capacities, epilepsy, and vision loss through retinal degeneration.

CLINICAL DESCRIPTION

The initial clinical symptoms are motor or/and cognitive decline or epilepsy but the mean age of onset and speed of progression may vary depending on the underlying genetic defect. Patients with classic LINCL generally present with a standstill of mental development or the onset of severe epilepsy around the third year of life. The disorder progresses to complete loss of almost all motor and mental capacities before school age. As visual loss is not a prominent finding in the early stages of the disease course, it is frequently not recognized. Several variant forms have also been described in the literature (vLINCL) in which the mean ages of onset generally vary from 2-7 years and which commonly manifest with severe epilepsy followed by cognitive and motor decline and vision loss.

VARIANTS

NM_017882.2(CLN6):c.200T>C ; NM_017882.2(CLN6):c.214G>T ; NM_017882.2(CLN6):c.663C>G

GENE

CLN8

DISEASES
CLN8 disease
SUMMARY

Neuronal ceroid lipofuscinoses (NCLs) are a group of inherited progressive degenerative brain diseases characterized clinically by a decline of mental and other capacities, epilepsy, and vision loss through retinal degeneration, and histopathologically by intracellular accumulation of an autofluorescent material, ceroid lipofuscin, in the neuronal cells in the brain and in the retina.

CLINICAL DESCRIPTION

The clinical presentation varies widely between forms but the clinical hallmark is a combination of dementia, visual loss, and epilepsy. Manifestations may begin between the neonatal period and young adult age depending on the form, leading to the original classification of NCLs by age at onset into congenital, infantile, late infantile, juvenile and adult NCL subgroups (see these terms). A Northern epilepsy variant (progressive epilepsy-intellectual deficit, Finnish type; see this term), in which the visual problems may be absent or be mild and go unrecognized, has also been described.

Progressive epilepsy-intellectual disability syndrome, Finnish type
SUMMARY

Progressive epilepsy-intellectual deficit, Finnish type (also known as Northern epilepsy) is a subtype of neuronal ceroid lipofuscinosis (NCL; see this term) characterized by seizures, progressive decline of intellectual capacities and variable loss of vision.

CLINICAL DESCRIPTION

The disorder is characterized by generalized tonic-clonic seizures with onset at 5 to 10 years of age and subsequent slowly progressive mental deterioration. The seizures increase in frequency until puberty after which the epileptic activity starts to decline. The intellectual deficit is severe, develops 2-5 years after the onset of seizures and progresses continuously through adulthood. Visual problems are not a prominent feature of this disorder; if present they may be mild and go unrecognized.

VARIANTS

NM_018941.3(CLN8):c.610C>T ; NM_018941.3(CLN8):c.88delG ; NM_018941.3(CLN8):c.789G>C ; NM_018941.3(CLN8):c.88G>C

GENE

CLRN1

DISEASES
Retinitis pigmentosa
SUMMARY

Retinitis pigmentosa (RP) is an inherited retinal dystrophy leading to progressive loss of the photoreceptors and retinal pigment epithelium and resulting in blindness usually after several decades.

CLINICAL DESCRIPTION

Retinitis pigmentosa is slowly progressive but relentless. There is however broad variability in age of onset, rate of progression and secondary clinical manifestations. Affected individuals generally first develop night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and over time loss of central vision, usually at late stages, often around midlife. Central visual acuity loss may occur at any age as a result of cystoid macular edema or photoreceptor loss. Posterior subcapsular cataracts are common and severity is age dependent. Reduced color vision may also be found. Fundus examination reveals bone spicule pigment deposits, attenuated retinal vessels, retinal atrophy and waxy optic nerve pallor. Severity is partly correlated with the pattern of inheritance with X-linked cases having the most severe course, autosomal recessive and single occurrence cases having intermediate severity, and autosomal dominant the most favorable course.

Usher syndrome type 3
SUMMARY

Usher syndrome type I is an autosomal recessive condition characterized by profound congenital hearing impairment with unintelligible speech, early retinitis pigmentosa (usually evident within the first decade), and constant vestibular dysfunction. Type I is distinguished from type II on the basis of severity of hearing loss and the extent of vestibular involvement. Type I patients are profoundly deaf, whereas type II patients are 'hard of hearing.' Vestibular function is defective in type I patients, whereas type II patients have normal vestibular function. Patients with type III (USH3) have progressive hearing loss.

CLINICAL DESCRIPTION

A rare ciliopathy characterized by progressive hearing and visual loss in the first decades of life and, in some cases, vestibular dysfunction. Patients have normal hearing at birth. Onset of hearing loss is usually in late childhood or adolescence after development of speech. Profound deafness is mostly reported by middle age. Retinitis pigmentosa related visual loss also develops in late childhood or adolescence. Developmental motor milestones are generally normal but vestibular dysfunction may occur in adulthood.

VARIANTS

NM_174878.2(CLRN1):c.118T>G ; NM_001195794.1:c.144T>G ; NM_001195794.1(CLRN1):c.189C>A ; c.591dup ; c.633dup ; NM_001195794.1(CLRN1):c.92C>T

GENE

CNGB3

DISEASES
Achromatopsia
SUMMARY

CLINICAL DESCRIPTION

ACHM is characterized by reduced visual acuity, pendular nystagmus, increased sensitivity to light (photophobia), a small central scotoma, and reduced or complete loss of color discrimination. Most individuals have complete ACHM, with total lack of function in all three types of cones. Rarely, individuals have incomplete ACHM, with similar, but generally less severe symptoms.

Progressive cone dystrophy
SUMMARY

A rare retinal dystrophy characterized by photophobia, progressive loss of visual acuity, nystagmus, visual field abnormalities, abnormal color vision, and psychophysical and electrophysiological evidence of abnormal cone function. Progressive cone dystrophy usually presents in childhood or early adult life, and patients tend to develop rod photoreceptor dysfunction in later life.

CLINICAL DESCRIPTION

Stargardt disease
SUMMARY

A rare ophthalmic disorder that is usually characterized by a progressive loss of central vision associated with irregular macular and perimacular yellow-white fundus flecks, and a so-called ''beaten bronze'' atrophic central macular lesion.

CLINICAL DESCRIPTION

The disease typically presents within the first two decades of life, even though symptoms can also appear during adulthood and as late as the seventh decade. Although disease progression and severity varies widely, Stargardt disease (STGD1) is usually characterized by a progressive loss of central vision causing blurry vision and, occasionally, an increasing difficulty to adapt in the dark. Peripheral vision is usually normal. Most affected individuals also have impaired color vision. Photophobia may be present.

VARIANTS

NM_019098.4(CNGB3):c.1208G>A ; NM_019098.4(CNGB3):c.1063C>T ; NM_019098.4(CNGB3):c.446_447insT ; NM_019098.4:c.1148delC ; NM_019098.4:c.2011G-T ; c.2048_2049del ; NM_019098.4(CNGB3):c.819_826delCAGACTCC ; c.886_890del ; c.887_896del ; c.893_897del

GENE

COL4A3

DISEASES
Autosomal dominant Alport syndrome
SUMMARY

A rare renal disease characterized by glomerular nephropathy with hematuria progressing to end-stage renal disease (ESRD), frequently associated with sensorineural deafness, and occasionally with ocular anomalies.

CLINICAL DESCRIPTION

The clinical subtypes of AS include X-linked (XL), autosomal recessive (AR) and autosomal dominant (AD) AS and count for about 80%, 15% and 5% of all AS cases, respectively. AS can present anywhere from childhood to elderly age, although it generally manifests earlier (during childhood or adolescence) in XL and AR forms. Males are severely affected in XLAS and present with microhematuria very early in life, followed by micro-albuminuria, macroproteinuria and progression to ESRD before the age of 40 years old. XLAS is highly variable in females, ranging from an asymptomatic disease to lifelong microscopic hematuria (with preserved renal function), or renal failure at a young age. Sensorineural hearing loss is common. Occasional ocular anomalies (e.g. anterior lenticonus, retinal flecks, corneal lesions) may develop in late childhood or early adulthood, males being more commonly affected than females. Rarely, leiomyomatosis (esophagus, tracheobronchial tree or female genitalia) can be associated, forming the X-linked diffuse leiomyomatosis-AS (XL-DLAS). ARAS is similar to XLAS in males, but presents without any gender differentiation in the disease course and the family history. ADAS varies from an asymptomatic disease (mostly presenting as a familial benign hematuria) to AD forms of proteinuria and focal segmental glomerulosclerosis (in cases without hematuria or not as a first line presentation). The progression to ESRD is usually slower than in XLAS, and extra-renal manifestations are less common.

Autosomal recessive Alport syndrome
SUMMARY

A rare renal disease characterized by glomerular nephropathy with hematuria progressing to end-stage renal disease (ESRD), frequently associated with sensorineural deafness, and occasionally with ocular anomalies.

CLINICAL DESCRIPTION

The clinical subtypes of AS include X-linked (XL), autosomal recessive (AR) and autosomal dominant (AD) AS and count for about 80%, 15% and 5% of all AS cases, respectively. AS can present anywhere from childhood to elderly age, although it generally manifests earlier (during childhood or adolescence) in XL and AR forms. Males are severely affected in XLAS and present with microhematuria very early in life, followed by micro-albuminuria, macroproteinuria and progression to ESRD before the age of 40 years old. XLAS is highly variable in females, ranging from an asymptomatic disease to lifelong microscopic hematuria (with preserved renal function), or renal failure at a young age. Sensorineural hearing loss is common. Occasional ocular anomalies (e.g. anterior lenticonus, retinal flecks, corneal lesions) may develop in late childhood or early adulthood, males being more commonly affected than females. Rarely, leiomyomatosis (esophagus, tracheobronchial tree or female genitalia) can be associated, forming the X-linked diffuse leiomyomatosis-AS (XL-DLAS). ARAS is similar to XLAS in males, but presents without any gender differentiation in the disease course and the family history. ADAS varies from an asymptomatic disease (mostly presenting as a familial benign hematuria) to AD forms of proteinuria and focal segmental glomerulosclerosis (in cases without hematuria or not as a first line presentation). The progression to ESRD is usually slower than in XLAS, and extra-renal manifestations are less common.

Genetic steroid-resistant nephrotic syndrome
SUMMARY

A rare, hereditary nephrotic syndrome characterized by proteinuria, hypoalbuminemia, edema, and hyperlipidemia, with an absence of response to an initial trial of corticosteroids (i.e. steroid-resistant nephrotic syndrome; SRNS) and a generally complicated course.

CLINICAL DESCRIPTION

Disease onset may occur anywhere between birth and adulthood but predominantly presents in younger populations. The nephrotic syndrome is defined by severe proteinuria (Urinary Protein/Creatinine ration > 200 mg/mmol) with low serum albumin (<30 g/l) and possible edema. Biopsy shows minimal change disease (MCD), focal segmental glomerulosclerosis (FSGS) or, more rarely, diffuse mesangial sclerosis (DMS), and podocyte foot process effacement by electron microscopy. It is multi-drug resistant and usually progresses to end-stage kidney failure; however, patients have a very low risk of recurrence after kidney transplantation.

NON RARE IN EUROPE: Benign familial hematuria
SUMMARY

Benign familial hematuria is an autosomal dominant condition manifest as nonprogressive isolated microscopic hematuria that does not result in renal failure. It is characterized pathologically by thinning of the glomerular basement membrane (GBM), and can be considered the mildest end of the spectrum of renal diseases due to type IV collagen defects of the basement membrane. The most severe end of the spectrum is represented by Alport syndrome, which results in end-stage renal failure and may be associated with hearing loss and ocular anomalies.

CLINICAL DESCRIPTION

0

VARIANTS

NM_000091.4(COL4A3):c.2954G>T ; NM_000091.4(COL4A3):c.4421T>C ; NM_000091.4(COL4A3):c.4571C>G ; NM_000091.4(COL4A3):c.898G>A ; NM_000091.4(COL4A3):c.2083G>A ; NM_000091.4:c.2110delC ; NM_000091.4(COL4A3):c.345delG ; NM_000091.4(COL4A3):c.4420_4424del5 ; NM_000091.4(COL4A3):c.4441C>T

GENE

COL4A4

DISEASES
Autosomal dominant Alport syndrome
SUMMARY

A rare renal disease characterized by glomerular nephropathy with hematuria progressing to end-stage renal disease (ESRD), frequently associated with sensorineural deafness, and occasionally with ocular anomalies.

CLINICAL DESCRIPTION

The clinical subtypes of AS include X-linked (XL), autosomal recessive (AR) and autosomal dominant (AD) AS and count for about 80%, 15% and 5% of all AS cases, respectively. AS can present anywhere from childhood to elderly age, although it generally manifests earlier (during childhood or adolescence) in XL and AR forms. Males are severely affected in XLAS and present with microhematuria very early in life, followed by micro-albuminuria, macroproteinuria and progression to ESRD before the age of 40 years old. XLAS is highly variable in females, ranging from an asymptomatic disease to lifelong microscopic hematuria (with preserved renal function), or renal failure at a young age. Sensorineural hearing loss is common. Occasional ocular anomalies (e.g. anterior lenticonus, retinal flecks, corneal lesions) may develop in late childhood or early adulthood, males being more commonly affected than females. Rarely, leiomyomatosis (esophagus, tracheobronchial tree or female genitalia) can be associated, forming the X-linked diffuse leiomyomatosis-AS (XL-DLAS). ARAS is similar to XLAS in males, but presents without any gender differentiation in the disease course and the family history. ADAS varies from an asymptomatic disease (mostly presenting as a familial benign hematuria) to AD forms of proteinuria and focal segmental glomerulosclerosis (in cases without hematuria or not as a first line presentation). The progression to ESRD is usually slower than in XLAS, and extra-renal manifestations are less common.

Autosomal recessive Alport syndrome
SUMMARY

A rare renal disease characterized by glomerular nephropathy with hematuria progressing to end-stage renal disease (ESRD), frequently associated with sensorineural deafness, and occasionally with ocular anomalies.

CLINICAL DESCRIPTION

The clinical subtypes of AS include X-linked (XL), autosomal recessive (AR) and autosomal dominant (AD) AS and count for about 80%, 15% and 5% of all AS cases, respectively. AS can present anywhere from childhood to elderly age, although it generally manifests earlier (during childhood or adolescence) in XL and AR forms. Males are severely affected in XLAS and present with microhematuria very early in life, followed by micro-albuminuria, macroproteinuria and progression to ESRD before the age of 40 years old. XLAS is highly variable in females, ranging from an asymptomatic disease to lifelong microscopic hematuria (with preserved renal function), or renal failure at a young age. Sensorineural hearing loss is common. Occasional ocular anomalies (e.g. anterior lenticonus, retinal flecks, corneal lesions) may develop in late childhood or early adulthood, males being more commonly affected than females. Rarely, leiomyomatosis (esophagus, tracheobronchial tree or female genitalia) can be associated, forming the X-linked diffuse leiomyomatosis-AS (XL-DLAS). ARAS is similar to XLAS in males, but presents without any gender differentiation in the disease course and the family history. ADAS varies from an asymptomatic disease (mostly presenting as a familial benign hematuria) to AD forms of proteinuria and focal segmental glomerulosclerosis (in cases without hematuria or not as a first line presentation). The progression to ESRD is usually slower than in XLAS, and extra-renal manifestations are less common.

NON RARE IN EUROPE: Benign familial hematuria
SUMMARY

Benign familial hematuria is an autosomal dominant condition manifest as nonprogressive isolated microscopic hematuria that does not result in renal failure. It is characterized pathologically by thinning of the glomerular basement membrane (GBM), and can be considered the mildest end of the spectrum of renal diseases due to type IV collagen defects of the basement membrane. The most severe end of the spectrum is represented by Alport syndrome, which results in end-stage renal failure and may be associated with hearing loss and ocular anomalies.

CLINICAL DESCRIPTION

0

VARIANTS

c.2312del ; NM_000092.4(COL4A4):c.3601G>A ; NM_000092.4(COL4A4):c.3713C>A ; NM_000092.4(COL4A4):c.4129C>T ; NM_000092.4(COL4A4):c.4923C>A ; NM_000092.4(COL4A4):c.71+1G>A

GENE

COL7A1

DISEASES
Autosomal dominant generalized dystrophic epidermolysis bullosa
SUMMARY

Generalized dominant dystrophic epidermolysis bullosa (DDEB-gen) is a subtype of dystrophic epidermolysis bullosa (DEB, see this term), formerly known as DDEB, Pasini and Cockayne-Touraine types, characterized by generalized blistering, milia formation, atrophic scarring, and dystrophic nails.

CLINICAL DESCRIPTION

The clinical picture of intermediate dominant dystrophic epidermolysis bullosa (DDEB-intermediate) is generally milder than that of the autosomal recessive generalized DEB forms. DDEB-intermediate manifests usually at birth with the development of blisters, primarily affecting the limbs. Blisters heal by developing numerous milia and atrophic scars with an onion-like appearance, particularly visible on the elbows, knees, and hands. Nail dystrophy, always present, can lead to loss of nail plates. Usually, fingers and toes are not affected by major cicatricial retractions. Blisters can develop in the mucosa, mainly in the oral cavity and, less commonly, in the esophagus, where they can cause strictures, often in sharp contrast with the scarce cutaneous involvement. Dental caries are relatively frequent. Corneal and genitourinary tract involvement, anemia, and growth delay are rare.

Autosomal recessive generalized dystrophic epidermolysis bullosa, intermediate form
SUMMARY

Recessive dystrophic epidermolysis bullosa (RDEB)-generalized other, also known as RDEB non-Hallopeau-Siemens type, is a subtype of DEB (see this term) characterized by generalized cutaneous and mucosal blistering that is not associated with severe deformities.

CLINICAL DESCRIPTION

Under the term intermediate RDEB are grouped a spectrum of phenotypes, showing highly variable severity of the cutaneous and mucosal involvement. The disease manifests at birth or during the neonatal period with generalized blistering. Aplasia cutis congenita (congenital absence of the skin) can also be observed at birth. Healing of blisters results in the development of milia, atrophic scarring (less severe than in severe RDEB), dystrophic nails, and, occasionally, albopapuloid lesions (ivory-white colored, scar-like papules) and scalp abnormalities. In some patients, the scarring phenomena can lead to a certain degree of pseudosyndactyly and loss of nail plates. Extracutaneous involvement is similar but less severe than in severe RDEB with no hand/foot deformities associated with this disease. Oral cavity lesions and excessive dental caries are common. Patients have a lower risk of esophageal strictures and corneal injury than severe RDEB. Growth delay and anemia are rare. Genitourinary tract involvement is rare. The risk of developing squamous cell carcinomas (SCC) is also increased but less common than in severe RDEB and occurs later in adulthood.

Autosomal recessive generalized dystrophic epidermolysis bullosa, severe form
SUMMARY

Severe generalized recessive dystrophic epidermolysis bullosa (RDEB-sev gen) is the most severe subtype of dystrophic epidermolysis bullosa (DEB, see this term), formerly known as the Hallopeau-Siemens type, and is characterized by generalized cutaneous and mucosal blistering and scarring associated with severe deformities and major extracutaneous involvement.

CLINICAL DESCRIPTION

Blisters develop spontaneously or after the mildest trauma at birth or during the neonatal period and affect all of the body (with predilection for skin over bony prominences) with extensive involvement of the oral and gastrointestinal mucosa. Congenital skin ulceration with extensive denudation of a body area may be present. Lesions heal with retracting scars and milia. Epidermolysis bullosa (EB) nevi may occur. Excessive scarring can lead to adhesion of fingers and toes resulting to pseudosyndactyly, and to joint contractures that further cause disabling hand and foot deformities (''mitten deformities''). Scarring alopecia of the scalp and permanent loss of nail plates are also observed. Eye involvement is frequent and includes blepharitis, loss of eyelashes, ectropion, symblepharon, and corneal blisters that can lead to loss of vision. Chewing and swallowing difficulties are due to ankyloglossia, obliteration of the oral vestibules and progressive microstomia. Dental caries are numerous. Esophageal stricture is frequent and results in severe dysphagia. Anal and perianal erosions cause major pain during defecation and foster constipation. Extensive gastrointestinal involvement in combination with a hypercatabolic state due to permanent wounding, infection and inflammation, induce a state of chronic malnutrition which contributes to growth retardation, delayed puberty, osteopenia and osteoporosis. Urethral strictures may occur. Refractory anemia, iron deficiency and hypoalbuminemia are also observed. Nearly all patients develop at least one aggressive squamous cell carcinoma (SCC), typically during the third-fourth decade of life.

Dystrophic epidermolysis bullosa inversa
SUMMARY

Recessive dystrophic epidermolysis bullosa inversa (RDEB-I) is rare subtype of dystrophic epidermolysis bullosa (DEB, see this term) characterized by blisters and erosions which are primarily confined to intertriginous skin sites, the base of the neck, the uppermost back, and the lumbosacral area.

CLINICAL DESCRIPTION

The disease manifests at birth or shortly thereafter with generalized blistering and superficial erosions of intermediate severity that heal with atrophic scarring and milia formation. From adolescence to early adulthood, blistering tends to localize to folds, particularly axillae, groin, perianal area and natal cleft. Women may present with marked vulvovaginal and inframammary skin blistering. Other predilection sites include the base of the neck, the uppermost back, and the lumbosacral area. Nail dystrophy is typical but of variable severity. Mucosal lesions with blistering and scarring in the mouth are characteristic and can lead to microglossia (loss of lingual papillae and fusion of the tongue to the mouth floor) and ankyloglossia (obliteration of the oral vestibules and progressive restriction of oral aperture). Esophageal involvement is often severe and is associated with a risk of esophageal stricture that can impair intake of nutrients. Lesions of the lowermost portion of the genitourinary tract are also common and may lead to the development of vaginal strictures that may impair normal sexual function. Other less common extracutaneous features include external auditory canal stenosis or complete occlusion with varying degrees of hearing loss; corneal erosions, and anemia. Growth delay is rare. Patients may develop squamous cell carcinomas, with a cumulative risk reaching 23% by age 50 which is much lower than in either of the two generalized forms of RDEB (severe RDEB and intermediate RDEB).

Dystrophic epidermolysis bullosa pruriginosa
SUMMARY

Dystrophic epidermolysis bullosa pruriginosa is a rare subtype of dystrophic epidermolysis bullosa (DEB, see this term) characterized by generalized or localized skin lesions associated with severe, if not intractable, pruritus.

CLINICAL DESCRIPTION

While skin fragility and blistering lesions usually manifest in infancy, which heal with atrophic scarring and milia formation, the onset of intense pruritus is frequently delayed until the adolescence or even adulthood. At the onset of pruritus, the clinical picture generally worsens with the development of papules, nodules, lichenoid and hypertrophic lesions in a linear distribution, preferentially on the extensor surfaces of the limbs. Nail dystrophy is usually present.

Localized dystrophic epidermolysis bullosa, acral form
SUMMARY

A very rare dystrophic epidermolysis bullosa (DEB) characterized by blistering confined primarily to the hands and feet.

CLINICAL DESCRIPTION

Localized dystrophic epidermolysis bullosa, nails only
SUMMARY

Dystrophic epidermolysis bullosa, nails only is a rare subtype of dystrophic epidermolysis bullosa (DEB, see this term) that shows no blistering and that is characterized by dystrophic or absent nails.

CLINICAL DESCRIPTION

Localized dystrophic epidermolysis bullosa, pretibial form
SUMMARY

Pretibial dystrophic epidermolysis bullosa is characterized by recurrent blistering and scarring, mainly in the pretibial area. The lesions often show lichenoid features.

CLINICAL DESCRIPTION

Pretibial dystrophic epidermolysis bullosa is a rare subtype of dystrophic epidermolysis bullosa (DEB, see this term) characterized by the development of blisters, erosions, and lichenoid lesions predominantly in the pretibial region.

Self-improving dystrophic epidermolysis bullosa
SUMMARY

Transient bullous dermolysis of the newborn is a rare subtype of dystrophic epidermolysis bullosa (DEB, see this term) characterized by generalized blistering at birth that usually regresses within the first 6 to 24 months of life.

CLINICAL DESCRIPTION

The disease usually manifests at birth, or soon after. Skin blisters generally affect the whole body. Blisters can also affect the oral cavity. Healing of blisters is associated with mild, mostly atrophic, scarring and milia formation. Disease activity usually ceases within the first 6 to 24 months of life, although there are a few cases with continued blistering past age 3 years. Nail dystrophy and some degree of skin fragility can persist in adulthood. Ultrastructurally, the presence in basal keratinocytes of peculiar cytoplasmic inclusions, known as stellate bodies, filled with unsecreted procollagen VII, is typical of the disease.

VARIANTS

NM_000094.3(COL7A1):c.6091G>A ; NM_000094.3(COL7A1):c.8371C>T ; NM_000094.3(COL7A1):c.6205C>T ; NC_000003.12:g.48585689C>A ; c.336C>G ; NM_000094.3(COL7A1):c.4039G>C ; NM_000094.3(COL7A1):c.425A>G ; NM_000094.3(COL7A1):c.4373C>T ; NM_000094.3(COL7A1):c.4783G>C ; NM_000094.3(COL7A1):c.4888C>T ; NM_000094.3:c.5052.1G-A ; NM_000094.3(COL7A1):c.5096C>T ; c.5287C>T ; c.5443G>C ; NM_000094.3(COL7A1):c.5532+1G>A ; NM_000094.3:c.5821-1G-A ; NM_000094.3(COL7A1):c.6187C>T ; NM_000094.3(COL7A1):c.6527dupC ; c.6573+1G>T ; NM_000094.3:c.6670G-T ; NM_000094.3(COL7A1):c.6752G>A ; NM_000094.3(COL7A1):c.6859G>A ; NM_000094.3(COL7A1):c.706C>T ; NM_000094.3:c.7345-1G-A ; NM_000094.3(COL7A1):c.7411C>T ; NM_000094.3:c.7912G-T ; c.7930-1G>C ; NM_000094.3(COL7A1):c.7957G>A ; NM_000094.3(COL7A1):c.8245G>A ; NM_000094.3(COL7A1):c.8393T>A ; NM_000094.3(COL7A1):c.8440C>T ; NM_000094.3(COL7A1):c.8479C>T ; NM_000094.3:c.8524_8527.10del ; NM_000094.3(COL7A1):c.887delG ; NM_000094.3(COL7A1):c.933C>A ; NC_000003.12:g.48572412C>T ; NC_000003.12:g.48584484C>A ; NC_000003.12:g.48588759dup

GENE

CPS1

DISEASES
Carbamoyl-phosphate synthetase 1 deficiency
SUMMARY

A rare, severe disorder of urea cycle metabolism typically characterized by either a neonatal-onset of severe hyperammonemia that occurs few days after birth and manifests with lethargy, vomiting, hypothermia, seizures, coma and death or a presentation outside the newborn period at any age with (sometimes) milder symptoms of hyperammonemia.

CLINICAL DESCRIPTION

In the neonatal-onset form of carbamoyl-phosphate synthetase 1 deficiency (CPS1D), patients are usually healthy at birth but after few days they begin to manifest with lethargy and unwillingness to feed. Severe hyperammonemia continues and manifests with vomiting, hypothermia, hypotonia, seizures, coma, and can lead to death. Outside the newborn period, patients can present at any time in life. Risk factors for manifestation include catabolic stressors such as fasting and intercurrent illness. Manifestations include hyperammonemia with irritability, lethargy, headache, seizures, confusion, avoidance of high-protein meals, axial hypotonia and cognitive disability.

VARIANTS

NM_001875.4(CPS1):c.1631C>T ; NM_001875.4(CPS1):c.1912C>T ; c.3556del

GENE

CPT1A

DISEASES
Carnitine palmitoyl transferase 1A deficiency
SUMMARY

Carnitine palmitoyltransferase 1A (CPT-1A) deficiency is an inborn error of metabolism that affects mitochondrial oxidation of long chain fatty acids (LCFA) in the liver and kidneys, and is characterized by recurrent attacks of fasting-induced hypoketotic hypoglycemia and risk of liver failure.

CLINICAL DESCRIPTION

CPT-1A deficiency manifests between birth and 18 months of age with recurrent attacks of hypoketotic hypoglycemia of varying severity, triggered by fasting or intercurrent illness, that can lead to severe neurological sequelae. CPT-1A-deficient patients can also present with hepatic encephalopathy with loss of consciousness, seizures, coma, or even sudden death. There may be a risk of progression to liver failure. Patients with severe CPT-1A deficiency may also have renal tubular acidosis.

VARIANTS

NM_001876.3(CPT1A):c.222C>A ; NM_001876.3(CPT1A):c.298C>T ; NM_001876.3(CPT1A):c.1079A>G ; NM_001876.3(CPT1A):c.1241C>T ; NM_001876.4:c.1361A>G ; NM_001876.3(CPT1A):c.1393G>T ; NM_001876.3(CPT1A):c.1436C>T ; NM_001031847.2(CPT1A):c.281+1G>A ; c.335_336del ; NC_000011.10:g.68781907G>A

GENE

CPT2

DISEASES
Acute necrotizing encephalopathy of childhood
SUMMARY

Acute encephalopathy is a severe neurologic complication of an infection that usually occurs in children. It is characterized by a high-grade fever accompanied within 12 to 48 hours by febrile convulsions, often leading to coma, multiple-organ failure, brain edema, and high morbidity and mortality. The infections are usually viral, particularly influenza, although other viruses and even mycoplasma have been found to cause the disorder

CLINICAL DESCRIPTION

A rare neurologic disease characterized by a rapid onset of seizures, an altered state of consciousness, neurologic decline, and variable degrees of hepatic dysfunction following a respiratory or gastrointesitnal infection (e.g. mycoplasma, influenza virus) in a previously healthy child. Brain MRI of patients reveals bilateral, multiple, symmetrical lesions predominantly observed in thalami and brainstem, but also in periventricular white matter and cerebellum in some cases.

Carnitine palmitoyl transferase II deficiency, myopathic form
SUMMARY

The myopathic form of carnitine palmitoyltransferase II (CPT II) deficiency, an inherited metabolic disorder that affects mitochondrial oxidation of long chain fatty acids (LCFA), is the most common and the least severe form of CPT II deficiency (see this term).

CLINICAL DESCRIPTION

The age of onset varies between 1 and 61 years of age with 70% of cases first presenting in childhood. The disease is more common in men, probably reflecting an ascertainment bias related to exposure to prolonged exercise. The clinical manifestations are characterized by recurrent attacks of rhabdomyolysis, muscle pain, and weakness triggered usually by prolonged physical exercise and sometimes exacerbated by extremes in temperature; episodes may also be provoked or exacerbated by prolonged fasting, such as may occur with intercurrent viral illness. Episodes of rhabdomyolysis may be associated with extreme elevation of serum creatine phosphokinase (CPK) and myoglobinuria (75% of cases) and can lead to renal failure (in 8-25% of cases, but rarely requiring dialysis). Patients are asymptomatic between episodes of rhabdomyolysis.

Carnitine palmitoyl transferase II deficiency, neonatal form
SUMMARY

The neonatal form of carnitine palmitoyltransferase II (CPT II) deficiency (see this term), an inherited disorder that affects mitochondrial oxidation of long chain fatty acids (LCFA), is the lethal form of the disease which presents with multisystem failure.

CLINICAL DESCRIPTION

Affected infants experience hypoketotic hypoglycemia, liver and respiratory failure and can present with cardiomyopathy, muscle hypotonia, liver calcification, cystic dysplastic kidneys and malformations of the brain due to a neuronal migration defect. Seizures and coma can occur as well as cardiac arrhythmias that generally lead to cardiac arrest in the perinatal/ early infantile period. Death occurs within days to months.

Carnitine palmitoyl transferase II deficiency, severe infantile form
SUMMARY

The severe infantile form of carnitine palmitoyltransferase II (CPT II) deficiency (see this term), an inherited disorder that affects mitochondrial oxidation of long chain fatty acids (LCFA), is the early-onset form of the disease.

CLINICAL DESCRIPTION

Presentation can be in the newborn period but most cases have an age of onset between 6 and 24 months. The disease is characterized by a severe fasting intolerance leading to metabolic derangements of hypoketotic hypoglycemia, resulting in coma and seizures, and hepatic encephalopathy leading to liver failure. There is associated skeletal muscle myopathy and cardiomyopathy which can lead to fatal paroxysmal cardiac arrhythmias.

VARIANTS

NM_000098.2(CPT2):c.1148T>A ; NM_000098.2(CPT2):c.1369A>T ; NM_000098.2(CPT2):c.1883A>C ; NM_000098.2(CPT2):c.359A>G ; NM_000098.2(CPT2):c.370C>T ; NM_000098.2(CPT2):c.452G>A ; NM_000098.2(CPT2):c.520G>A ; NM_000098.2(CPT2):c.680C>T ; NM_000098.2(CPT2):c.886C>T ; NM_000098.3:c.1239_1240delGA ; NM_000098.2:c.1239_1240delGA ; NM_000098.2:c.1437C-G ; NM_000098.2(CPT2):c.149C>A ; NM_000098.2(CPT2):c.1784delC ; NM_000098.2(CPT2):c.1891C>T ; NM_000098.3:c.338C>T ; NM_000098.2:c.464dupT ; NM_000098.2(CPT2):c.638A>G ; NM_000098.2(CPT2):c.725_726delAC

GENE

CRB1

DISEASES
Leber congenital amaurosis
SUMMARY

Leber congenital amaurosis (LCA) is a retinal dystrophy defined by blindness and responses to electrophysiological stimulation (Ganzfeld electroretinogram (ERG)) below threshold, associated with severe visual impairment within the first year of life.

CLINICAL DESCRIPTION

LCA is characterized by severely reduced visual acuity (less or equal 20/400) or blindness within in the first year of life. Sluggish pupillary responses, roving eye movement, photophobia, high hyperopia, nystagmus, convergent strabismus, or keratoconus may occur depending on the genetic cause. The Franceschetti's oculo-digital sign, comprising eye poking, pressing, and rubbing is pathognomonic. LCA may be associated with mutations in genes linked to syndromes presenting with neurodevelopmental delay, intellectual disability, oculomotor apraxia-type behavior (difficulty moving the eye) and renal dysfunction.

Nanophthalmos
SUMMARY

A rare ophthalmic disease and a severe form of microphthalmia (small eye phenotype) characterized by a small eye with a short axial length, severe hyperopia, an elevated lens/eye ratio, and a high incidence of angle-closure glaucoma.

CLINICAL DESCRIPTION

The disease occurs neonatally or during infancy. Typical clinical signs include an axial length inferior to 20 mm, a lens/eye ratio 4 to 8 times greater than normal, thickened and abnormally dense sclera, a thickened lens and choroids, and severe hyperopia (+7.00 D to +13.00 D). Despite its small size, the functionality and organization of the eye are preserved. Nanophthalmos is generally bilateral. Strabismus is present in most patients. The association of nanophthalmos and pigmentary retinopathy or Best disease has been reported. The condition can be simple (occurring in isolation), complex (associated with other malformations such as colobomas, anterior segment dysgenesis, and lens and posterior segment abnormalities) or syndromic (as part of a rare syndrome).

Pigmented paravenous retinochoroidal atrophy
SUMMARY

Pigmented paravenous chorioretinal atrophy is a stationary disease of the ocular fundus in which bone corpuscle pigmentation is seen in a paravenous distribution. Patients are usually asymptomatic; diagnosis is based on the characteristic fundus appearance. Most cases have been reported in males.

CLINICAL DESCRIPTION

Pigmented paravenous retinochoroidal atrophy (PPRCA) is a rare, commonly bilateral and symmetric retinal disease characterized by non-progressive or slowly progressive chorioretinal atrophy, peripapillary pigmentary changes and accumulation of ''bone-corpuscle'' pigmentation along the retinal veins and which is usually asymptomatic or can present with mild blurred vision.

Retinitis pigmentosa
SUMMARY

Retinitis pigmentosa (RP) is an inherited retinal dystrophy leading to progressive loss of the photoreceptors and retinal pigment epithelium and resulting in blindness usually after several decades.

CLINICAL DESCRIPTION

Retinitis pigmentosa is slowly progressive but relentless. There is however broad variability in age of onset, rate of progression and secondary clinical manifestations. Affected individuals generally first develop night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and over time loss of central vision, usually at late stages, often around midlife. Central visual acuity loss may occur at any age as a result of cystoid macular edema or photoreceptor loss. Posterior subcapsular cataracts are common and severity is age dependent. Reduced color vision may also be found. Fundus examination reveals bone spicule pigment deposits, attenuated retinal vessels, retinal atrophy and waxy optic nerve pallor. Severity is partly correlated with the pattern of inheritance with X-linked cases having the most severe course, autosomal recessive and single occurrence cases having intermediate severity, and autosomal dominant the most favorable course.

VARIANTS

NM_001257965.1(CRB1):c.291_299delAATTGATGG ; NM_201253.2(CRB1):c.613_619delATAGGAA ; c.2080G>T ; NM_201253.2(CRB1):c.2290C>T ; NM_201253.2(CRB1):c.2401A>T ; NM_201253.2(CRB1):c.2688T>A ; c.2719_2723dup ; NM_201253.2(CRB1):c.2843G>A ; NM_201253.2(CRB1):c.2983G>T ; c.3083T>A ; NM_201253.2(CRB1):c.3122T>C ; NM_201253.2(CRB1):c.3299T>G ; NM_201253.2(CRB1):c.3383delT ; NM_201253.2(CRB1):c.3997G>T

GENE

CTNS

DISEASES
Infantile nephropathic cystinosis
SUMMARY

A subtype of cystinosis characterized by an accumulation of cystine in the organs and tissues, particularly in the kidneys and eyes, and that clinically manifests from infancy with renal Fanconi syndrome, photophobia, hypothyroidism, impaired growth and rickets, in addition to various other systemic effects. Progressive extra-renal manifestations include hypothyroidism, hypogonadism and male infertility, insulin-dependent diabetes, hepatosplenomegaly with portal hypertension, muscle involvement with distal muscle weakness and atrophy, pharyngeal and oral dysfunction, swallowing difficulties, cerebral involvement with hypotonia, speech and walking difficulties, and cerebellar syndrome.

CLINICAL DESCRIPTION

Cystinosis has been classified as a lysosomal storage disorder on the basis of cytologic and other evidence pointing to the intralysosomal localization of stored cystine. Cystinosis differs from the other lysosomal diseases inasmuch as acid hydrolysis, the principal enzyme function of lysosomes, is not known to play a role in the metabolic disposition of cystine. The fact that plasma levels are well below saturation indicates that the defect is a cellular one. Within the cell, cystine is compartmentalized with acid phosphatase and is membrane-bound as demonstrated by electron microscopy. Ferritin accumulates in the same organelle which appears to be the lysosome.

Juvenile nephropathic cystinosis
SUMMARY

A subtype of cystinosis characterized by an accumulation of cystine in different organs and tissues, particularly in the kidneys and eyes, and that clinically manifests between childhood and adolescence with a slowly progressive proximal tubulopathy and/or proteinuria, and photophobia. Extra-renal manifestations (e.g. hypothyroidism, insulin-dependent diabetes, hepatosplenomegaly, muscular and cerebral involvement) are less severe than in the infantile form of the disease.

CLINICAL DESCRIPTION

Adolescent nephropathic cystinosis manifests itself first at age 10 to 12 years with proteinuria due to glomerular damage rather than with the manifestations of tubular damage that occur first in infantile cystinosis. There is no excess amino aciduria and stature is normal. Photophobia, late development of pigmentary retinopathy, and chronic headaches are features. White cells show high cystine content in heterozygotes for this form of cystinosis, just as they do in infantile cystinosis. Clinically the disorder shows a slowly progressive glomerular insufficiency rather than the prominent Fanconi syndrome, electrolyte and water disturbances, growth arrest, and rickets typical of infantile cystinosis. The patient was the only affected person in the family and the parents were not related (as one would expect if juvenile cystinosis is the genetic compound of infantile cystinosis and adult cystinosis).

Ocular cystinosis
SUMMARY

Ocular cystinosis is the benign, adult form of cystinosis, a metabolic disease characterized by an accumulation of cystine crystals in the cornea and conjunctiva responsible for tearing and photophobia and associated with no other additional manifestations.

CLINICAL DESCRIPTION

Ocular nonnephropathic cystinosis, a variant of the classic nephropathic type of cystinosis (219800), is an autosomal recessive lysosomal storage disorder characterized by photophobia due to corneal cystine crystals but absence of renal disease.

VARIANTS

NM_004937.2(CTNS):c.416C>T ; NM_004937.2(CTNS):c.589G>A ; NM_004937.3:c.1015G>A ; NM_001031681.2(CTNS):c.283G>T ; NM_001031681.2(CTNS):c.329G>T ; NM_004937.2:c.357_360delCAGC ; NM_004937.2:c.397_398delAT ; NM_004937.2(CTNS):c.414G>A ; NM_001031681.2(CTNS):c.506G>A ; NM_004937.2(CTNS):c.646dupA ; NM_004937.2(CTNS):c.853-3C>G

GENE

CTSD

DISEASES
CLN10 disease
SUMMARY

Neuronal ceroid lipofuscinoses (NCLs) are a group of inherited progressive degenerative brain diseases characterized clinically by a decline of mental and other capacities, epilepsy, and vision loss through retinal degeneration, and histopathologically by intracellular accumulation of an autofluorescent material, ceroid lipofuscin, in the neuronal cells in the brain and in the retina.

CLINICAL DESCRIPTION

The clinical presentation varies widely between forms but the clinical hallmark is a combination of dementia, visual loss, and epilepsy. Manifestations may begin between the neonatal period and young adult age depending on the form, leading to the original classification of NCLs by age at onset into congenital, infantile, late infantile, juvenile and adult NCL subgroups (see these terms). A Northern epilepsy variant (progressive epilepsy-intellectual deficit, Finnish type; see this term), in which the visual problems may be absent or be mild and go unrecognized, has also been described.

VARIANTS

NM_001909.4(CTSD):c.1149G>C ; NM_001909.4(CTSD):c.685T>A

GENE

CTSK

DISEASES
Pycnodysostosis
SUMMARY

Pycnodysostosis is a genetic lysosomal disease characterized by osteosclerosis of the skeleton, short stature and brittle bones.

CLINICAL DESCRIPTION

The disease is discovered at variable ages, ranging from 9 months to 50 years. The condition is most often diagnosed in childhood, but sometimes the condition is not detected until adulthood, usually as a result of a fracture or a routine examination. The most frequent clinical or radiological manifestations of the disease are osteosclerosis, short stature or dwarfism, acroosteolysis of the distal phalanges, fragile bones associated with spontaneous fractures and dysplasia of the clavicles. Patients present with characteristic cranial malformations: a voluminous skull with wormian bones present and persistence of the anterior fontanelle, and a small mandible. Dental abnormalities such as decayed, poorly located or abnormally shaped (pointed or conical) teeth and delayed tooth eruption may be observed. Nails are sometimes irregular and cracked. Very rarely, the disease is associated with anemia, hepatosplenomegaly, hematologic alterations, respiratory distress and sleep apnea. The short stature is variable but moderate (1.35m to 1.50m).

VARIANTS

NM_000396.3(CTSK):c.721C>T ; NM_000396.3(CTSK):c.926T>C ; NM_000396.3(CTSK):c.154A>T ; NM_000396.3(CTSK):c.236G>A ; NM_000396.3(CTSK):c.436G>C

GENE

CYP21A2

DISEASES
Classic congenital adrenal hyperplasia due to 21-hydroxylase deficiency, salt wasting form
SUMMARY

The salt wasting form of classic congenital adrenal hyperplasia due to 21-hydroxylase deficiency (classical 21 OHD CAH; see this term) is characterized by virilization of the external genitalia in females, hypocortisolism, precocious pseudopuberty and renal salt loss due to aldosterone deficiency.

CLINICAL DESCRIPTION

Patients suffer from glucocorticoid deficiency, aldosterone deficiency with salt wasting, failure to thrive, and potentially fatal hypovolemia and shock. Virilization of external genitalia in females is seen from birth. During the firstweeks of life this salt wasting form can manifest in a salt-losing crisis (failure to thrive, vomiting, hyponatremia, hyperkaliema, acidosis, hypovolemia) which requires life saving treatment immediately. Precocious pseudopuberty, manifesting with various symptoms including accelerated growth velocity and bone maturation, is also present in both sexes.

Classic congenital adrenal hyperplasia due to 21-hydroxylase deficiency, simple virilizing form
SUMMARY

The simple virilizing form of classical congenital adrenal hyperplasia due to 21-hydroxylase deficiency (classical 21 OHD CAH; see this term) is characterized by genital ambiguity and virilization of the external genitalia in females, hypocortisolism and precocious pseudopuberty without salt-wasting.

CLINICAL DESCRIPTION

Girls present at birth with ambiguous genitalia and variable levels of virilization. They have a normal uterus but abnormal vaginal development. The external genitalia in boys are normal. Precocious pseudopuberty, manifesting with various symptoms including accelerated growth velocity and bone maturation, is also present in both sexes. Unlike the salt wasting form of classical 21 OHD CAH, the simple virilizing form has no symptoms of dehydration, but has a glucocorticoid deficiency requiring life-long substitution therapy and carrying a life-long risk of adrenal crisis.

NON RARE IN EUROPE: Non-classic congenital adrenal hyperplasia due to 21-hydroxylase deficiency
SUMMARY

In female newborns, the external genitalia are masculinized; gonads and internal genitalia are normal. Postnatally, untreated males as well as females may manifest rapid growth, penile or clitoral enlargement, precocious adrenarche, and ultimately early epiphyseal closure and short stature. A mild form of late-onset adrenal hyperplasia due to 21-hydroxylase deficiency can occur in adults and has hirsutism as the only manifestation in the most attenuated form.

CLINICAL DESCRIPTION

Congenital adrenal hyperplasia (CAH) results from a deficiency in one or another of the enzymes of cortisol biosynthesis. In about 95% of cases, 21-hydroxylation is impaired in the zona fasciculata of the adrenal cortex so that 17-hydroxyprogesterone (17-OHP) is not converted to 11-deoxycortisol. Because of defective cortisol synthesis, ACTH levels increase, resulting in overproduction and accumulation of cortisol precursors, particularly 17-OHP, proximal to the block. This causes excessive production of androgens, resulting in virilization.

VARIANTS

NM_000500.7(CYP21A2):c.1118G>A ; NM_000500.7(CYP21A2):c.1136T>A ; NM_000500.7(CYP21A2):c.1174G>A ; NM_000500.7(CYP21A2):c.158_159delCT ; NM_000500.7(CYP21A2):c.274A>G ; NM_000500.9(CYP21A2):c.922T>G ; NM_000500.7(CYP21A2):c.1069C>T ; NM_000500.7(CYP21A2):c.1217G>A ; NM_000500.9(CYP21A2):c.1279C>T ; NM_000500.7(CYP21A2):c.1360C>T ; NM_000500.9(CYP21A2):c.1447C>T ; NM_000500.9(CYP21A2):c.1451G>A ; NM_000500.9(CYP21A2):c.1451_1452delGGinsC ; NM_000500.7(CYP21A2):c.293-13C>G ; NM_000500.7(CYP21A2):c.332_339delGAGACTAC ; NM_000500.7(CYP21A2):c.361A>C ; NM_000500.7(CYP21A2):c.518T>A ; NM_000500.7(CYP21A2):c.844G>T ; NM_000500.7(CYP21A2):c.874G>A ; NM_000500.9(CYP21A2):c.923dup ; NM_000500.7(CYP21A2):c.92C>T ; NM_000500.7(CYP21A2):c.955C>T ; NC_000006.12:g.32039092A>G ; CNVs ; Large gene conversion

GENE

DBT

DISEASES
Classic maple syrup urine disease
SUMMARY

Classic maple syrup urine disease (classic MSUD) is the most severe and probably common form of MSUD (see this term) characterized by a maple syrup odor in the cerumen at birth, poor feeding, lethargy and focal dystonia, followed by progressive encephalopathy and central respiratory failure if untreated.

CLINICAL DESCRIPTION

Onset of classic MSUD occurs in the neonatal period (usually 12 hours after birth) with the presence of a maple syrup odor in the cerumen and later in urine, poor feeding and drowsiness. Progressive encephalopathy with lethargy, intermittent apnea, stereotyped movements (described as "fencing" and bicycling") and opisthotonus occur in the first few days of life. Without treatment, coma and central respiratory failure occur by days 7 to 10. Later, catabolic stress, infection or injury may cause acute, potentially fatal, leucine intoxication with vomiting, altered consciousness, ataxia and acute dystonia in toddlers and hallucinations, hyperactivity, focal dystonia, ataxia and choreoathetosis in children and adults.

Intermediate maple syrup urine disease
SUMMARY

Intermediate maple syrup urine disease (intermediate MSUD) is a milder form of MSUD (see this term) characterized by persistently raised branched-chain amino acids (BCAAs) and ketoacids, but fewer or no acute episodes of decompensation.

CLINICAL DESCRIPTION

Symptom onset of intermediate MSUD varies between the early months and the early years of childhood. Infants may have feeding problems, poor growth, maple syrup odor in urine and developmental delay. Older children usually present with learning difficulties. Like classic MSUD (see this term), catabolic stress can result in acute decompensation with anorexia, vomiting, ataxia (in infants/toddlers), cognitive impairment, sleep disturbances, hallucinations, hyperactivity, mood swings, acute dystonia, choreoathetosis (in adults), stupor, coma and cerebral edema, if untreated.

Intermittent maple syrup urine disease
SUMMARY

Intermittent maple syrup urine disease (intermittent MSUD) is a mild form of MSUD (see this term) where patients (when well) are asymptomatic with normal levels of branched-chain amino acids (BCAAs) but with catabolic stress are at risk of acute decompensation with ketoacidosis, which can lead to cerebral edema and coma if untreated.

CLINICAL DESCRIPTION

Unlike classic MSUD (see this term), patients with intermittent MSUD show normal growth and intellectual development during infancy and childhood. They may develop symptoms (mainly in childhood) with any catabolic stress (i.e. fasting, dehydration, fever, infections or pregnancy (in adults)). These precipitating factors can lead to a potentially fatal episode of acute decompensation with anorexia, nausea, vomiting, lethargy, ataxia (in infants/toddlers), cognitive impairment, sleep disturbances, hallucinations, hyperactivity, mood swings, acute dystonia, and choreoathetosis (in adults), that can progress to stupor, coma and cerebral edema. Intelligence and development are not usually affected by these episodes.

Thiamine-responsive maple syrup urine disease
SUMMARY

Thiamine-responsive maple syrup urine disease (thiamine-responsive MSUD) is a less severe variant of MSUD (see this term) that manifests with a phenotype similar to intermediate MSUD (see this term) but that responds positively to treatment with thiamine.

CLINICAL DESCRIPTION

Thiamine-responsive MSUD is poorly characterized. It appears to usually present after infancy with a phenotype very similar to that seen in intermediate MSUD (see this term). Manifestations include feeding problems, poor growth, maple syrup odor in urine and developmental delay. Older children usually present with learning difficulties. Like classic MSUD (see this term), physiological stress can result in acute decompensation with anorexia, nausea, vomiting (at all ages), ataxia (in infants/toddlers), cognitive impairment, sleep disturbances, hallucinations, hyperactivity, mood swings, acute / focal dystonia and choreoathetosis (in adults) that can progress to stupor, coma and cerebral edema, if untreated. Thiamine (doses of 10-1000 mg per day) has improved the leucine tolerance in the few reported cases of this MSUD subtype, but some dietary branched-chain amino-acid (BCAA) restriction remains necessary.

VARIANTS

NM_001918.3(DBT):c.827T>G ; NM_001918.3(DBT):c.126T>G ; NM_001918.3(DBT):c.670G>T ; NM_001918.3(DBT):c.901C>T ; NM_001918.3(DBT):c.939G>C ; c.1281+1G>A ; NM_001918.3(DBT):c.272_275delCAGT ; NM_001918.3(DBT):c.294C>G ; NM_001918.4:c.581C>G ; c.772+1G>A ; NM_001918.3(DBT):c.871C>T

GENE

DCLRE1C

DISEASES
Omenn syndrome
SUMMARY

Omenn syndrome (OS) is an inflammatory condition characterized by erythroderma, desquamation, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency (SCID; see this term).

CLINICAL DESCRIPTION

OS presents during the first year of life with features of SCID including chronic diarrhea, pneumonitis and failure to thrive. In addition, patients present with inflammatory symptoms including lymphadenopathy, hepatosplenomegaly and generalized erythroderma, which may often cause alopecia and loss of eyebrows and eyelashes; protein loss may lead to generalized edema and metabolic disturbances. The signs and symptoms of OS can evolve over time and may not appear simultaneously. Some patients present with some but not all of these symptoms and may be described as having atypical Omenn syndrome. OS may also be associated with syndromic disorders including cartilage-hair hypoplasia (CHH), adenosine deaminase (ADA) deficiency, monosomy 22q11, coloboma of the eye, CHARGE syndrome and ligase 4 deficiency (see these terms).

Severe combined immunodeficiency due to DCLRE1C deficiency
SUMMARY

Severe combined immunodeficiency (SCID) due to DCLRE1C deficiency is a type of SCID (see this term) characterized by severe and recurrent infections, diarrhea, failure to thrive, and cell sensitivity to ionizing radiation.

CLINICAL DESCRIPTION

Patients present with the classical features of SCID such as failure to thrive, severe infections (pneumonia, gastrointestinal infections, sepsis), recurrent or persistent thrush, and chronic diarrhea. Materno-fetal transfusion-associated graft versus host disease is also associated with the disease. Immunological findings include absence of T and B lymphocytes with normal natural killer (NK) cell count.

VARIANTS

c.1294G>T ; NM_001033855.2:c.1558_1559insA ; NM_001033855.2(DCLRE1C):c.2T>C ; NM_022487.3(DCLRE1C):c.435del ; NM_001033855.2(DCLRE1C):c.597C>A

GENE

DDB2

DISEASES
Xeroderma pigmentosum
SUMMARY

Xeroderma pigmentosum (XP) is a rare genodermatosis characterized by extreme sensitivity to ultraviolet (UV)-induced changes in the skin and eyes, and multiple skin cancers. It is subdivided into 8 complementation groups, according to the affected gene: classical XP (XPA to XPG) and XP variant (XPV) (see these terms).

CLINICAL DESCRIPTION

The severity of the clinical manifestations and the age of onset are extremely variable and are in part dependent on exposure to sunlight and the complementation group. Approximately 50% of affected individuals have acute sun sensitivity from the first few months of life, presenting with severe sunburn and/or persistent erythema which takes weeks to resolve. Others do not show any sunburn reaction and gradually develop marked freckling at sun exposed sites. Individuals have dry skin and hypo- or hyperpigmented lesions. There is a greater than 10,000-fold increased risk of non-melanoma skin cancers, and a 2,000 fold increased risk of melanoma under the age of 20 when compared to the general population. Patients with classical XP develop skin cancer generally before the age of 20, while patients with XP variant start to develop skin cancer at about 20-30 years of age. Ocular abnormalities include keratitis resulting in corneal opacification and vascularization. Photophobia is common. Ocular squamous cell carcinoma and melanoma are common. Neurologic abnormalities of varying severity have been reported in about 30% of cases. These include acquired microcephaly, diminished or absent deep tendon stretch reflexes, progressive sensorineural hearing loss, spasticity, ataxia, seizures and progressive cognitive impairment. De Sanctis-Cacchione syndrome is a term that was originally attributed to XP cases with severe neurological abnormalities but it is no longer in general use.

VARIANTS

NM_000107.2(DDB2):c.730A>G ; NM_000107.2(DDB2):c.818G>A ; NM_000107.2(DDB2):c.919G>T ; NM_000107.2(DDB2):c.937C>T

GENE

DHCR7

DISEASES
Smith-Lemli-Opitz syndrome
SUMMARY

Smith-Lemli-Opitz syndrome (SLOS) is characterized by multiple congenital anomalies, intellectual deficit, and behavioral problems.

CLINICAL DESCRIPTION

The disease is present at birth, but may be detected in later childhood or adulthood in mild forms. Patients present with growth retardation and intellectual deficit. Behavioral problems include multiple autistic traits, hyperactivity, self-injurious behavior and sleep disturbances. The structural brain anomalies may include hypoplasia or absence of the corpus callosum, and holoprosencephaly. Microcephaly (80% of cases), bitemporal narrowing, ptosis, a broad nasal bridge, short nasal root, anteverted nares (90% of cases), a small chin, and micrognathia are common craniofacial features. Occasionally, cataract, strabismus, and nystagmus are observed. Other clinical features include cleft palate or bifid uvula (1/3 of patients), photosensitivity, rhizomelia and postaxial polydactyly of the hands or feet, syndactyly of the 2nd and 3rd toes (95% of cases), and short and proximally placed thumbs. Genital anomalies (small penis, hypospadias, ambiguous genitalia) are frequent in males (70% of cases). Cardiovascular anomalies (atrial and ventricular septal defects, patent ductus arteriosus, atrioventricular canal) can be present. Gastrointestinal anomalies including poor feeding, gastroesophageal reflux, pyloric stenosis, malrotation, and colonic aganglionosis are frequent.

VARIANTS

NM_001360.2(DHCR7):c.461C>G ; NM_001360.2(DHCR7):c.506C>T ; NM_001360.2(DHCR7):c.841G>A ; NM_001360.2(DHCR7):c.907G>A ; NM_001360.2(DHCR7):c.1337G>A ; NM_001360.2(DHCR7):c.1342G>A ; NM_001360.2(DHCR7):c.1A>G ; NM_001360.2(DHCR7):c.278C>T ; NM_001360.2(DHCR7):c.292C>T ; NM_001360.2(DHCR7):c.724C>T ; NM_001360.2(DHCR7):c.725G>A ; NM_001360.2(DHCR7):c.866C>T ; c.904T>C ; NM_001360.2(DHCR7):c.1054C>T ; NM_001360.2(DHCR7):c.1055G>A ; NM_001360.2(DHCR7):c.1210C>T ; NM_001360.2(DHCR7):c.1228G>A ; NM_001360.2(DHCR7):c.151C>T ; NM_001360.2(DHCR7):c.356A>T ; NM_001360.2(DHCR7):c.452G>A ; NM_001360.2(DHCR7):c.453G>A ; NM_001360.2(DHCR7):c.730G>A ; NM_001360.2(DHCR7):c.744G>T ; NM_001360.2(DHCR7):c.832-1G>C ; NM_001360.2(DHCR7):c.839A>G ; NM_001360.2:c.964-1G>C ; NM_001360.2(DHCR7):c.976G>T

GENE

DHDDS

DISEASES
Non-specific early-onset epileptic encephalopathy
SUMMARY

A rare infantile epilepsy syndrome characterized by early onset of seizures of variable type and severity, potentially associated with a spectrum of clinical signs and symptoms including delay or lack of psychomotor development, intellectual disability, poor or absent speech development, behavioral abnormalities, hypotonia, movement disorders, spasticity, microcephaly, and dysmorphic facial features, among others. Brain imaging findings are also variable and may include cerebral atrophy or white matter abnormalities.

CLINICAL DESCRIPTION

Retinitis pigmentosa
SUMMARY

Retinitis pigmentosa (RP) is an inherited retinal dystrophy leading to progressive loss of the photoreceptors and retinal pigment epithelium and resulting in blindness usually after several decades.

CLINICAL DESCRIPTION

Retinitis pigmentosa is slowly progressive but relentless. There is however broad variability in age of onset, rate of progression and secondary clinical manifestations. Affected individuals generally first develop night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and over time loss of central vision, usually at late stages, often around midlife. Central visual acuity loss may occur at any age as a result of cystoid macular edema or photoreceptor loss. Posterior subcapsular cataracts are common and severity is age dependent. Reduced color vision may also be found. Fundus examination reveals bone spicule pigment deposits, attenuated retinal vessels, retinal atrophy and waxy optic nerve pallor. Severity is partly correlated with the pattern of inheritance with X-linked cases having the most severe course, autosomal recessive and single occurrence cases having intermediate severity, and autosomal dominant the most favorable course.

VARIANTS

NM_024887.3:c.124A>G ; NM_024887.3:c.328delA ; NM_024887.3:c.998C-G

GENE

DKC1

DISEASES
Dyskeratosis congenita
SUMMARY

A rare ectodermal dysplasia syndrome that often presents with the classic triad of nail dysplasia, skin pigmentary changes, and oral leukoplakia associated with a high risk of bone marrow failure (BMF) and cancer.

CLINICAL DESCRIPTION

DC has a wide phenotypic spectrum and age onset. It classically manifests during childhood with the triad of dysplastic nails, lacy reticular pigmentation and atrophy of the skin at the level of the neck and upper chest, and oral leukoplakia. Patients are at high risk of progressive BMF and may develop myelodysplastic syndrome or acute myelogenous leukemia at any age (the risk increasing with age). There is also an increased risk for solid tumors, typically squamous cell carcinoma of head and neck or anogenital cancer. Additional clinical findings have been reported and may include: developmental delay, short stature, microcephaly, blepharitis, epiphora, periodontal disease, taurodontism, decreased teeth/root ratio, esophageal stenosis, urethral stenosis, osteoporosis, avascular necrosis of femur and/or humerus, premature hair greying/alopecia, or abnormal eyelashes. Individuals with Patients with DC may also develop pulmonary fibrosis, pulmonary arteriovenous malformations, gastrointestinal telangiectasias, and liver disease. It is important to note that the clinical features of DC progress over time and that all features, including the mucocutaneous triad, may not be present.

Hoyeraal-Hreidarsson syndrome
SUMMARY

An X-linked syndromic intellectual disability considered to be a severe variant of dyskeratosis congenita characterized by intrauterine growth retardation, microcephaly, cerebellar hypoplasia, progressive combined immune deficiency and aplastic anemia.

CLINICAL DESCRIPTION

The disease generally presents in early childhood and primarily affects males. Growth retardation is usually of prenatal onset. Other clinical manifestations include microcephaly, mucocutaneous lesions (hyperpigmentation, nail dystrophy, premalignant leukoplakia affecting oral and gastrointestinal mucosa), early onset bone marrow failure, immunodeficiency and pancytopenia. Cancer predisposition is also reported.

VARIANTS

NM_001363.4(DKC1):c.-142C>G ; NM_001363.4(DKC1):c.1054A>G ; NM_001363.4(DKC1):c.109_111delCTT ; NM_001363.4(DKC1):c.1255T>A ; NM_001363.4(DKC1):c.149C>A ; NM_001363.3(DKC1):c.361A>G ; NM_001363.4(DKC1):c.1049T>C ; NM_001363.4(DKC1):c.1050G>A ; NM_001363.4(DKC1):c.1058C>T ; NM_001363.4(DKC1):c.1069A>G ; NM_001363.4(DKC1):c.106T>G ; NM_001363.4(DKC1):c.1075G>A ; NM_001363.3(DKC1):c.1133G>A ; NM_001363.4(DKC1):c.113T>C ; NM_001363.4(DKC1):c.1150C>T ; NM_001363.4(DKC1):c.1151C>T ; NM_001363.4(DKC1):c.1156G>A ; NM_001363.4(DKC1):c.115A>G ; NM_001363.4(DKC1):c.1193T>C ; NM_001363.4(DKC1):c.119C>G ; NM_001363.4(DKC1):c.1204G>A ; NM_001363.4(DKC1):c.1205G>A ; NM_001363.4(DKC1):c.121G>A ; NM_001363.4(DKC1):c.1223C>T ; NM_001363.4(DKC1):c.1226C>T ; NM_001363.5(DKC1):c.1259+1G>A ; NM_001363.4(DKC1):c.127A>G ; NM_001363.4(DKC1):c.1345C>G ; NM_001363.3(DKC1):c.146C>T ; NM_001363.4(DKC1):c.194G>C ; NM_001363.4(DKC1):c.196A>G ; NM_001363.4(DKC1):c.200C>T ; NM_001363.4(DKC1):c.203A>G ; NM_001363.4(DKC1):c.204C>A ; NM_001363.4(DKC1):c.214_215delCTinsTA ; NM_001363.4(DKC1):c.29C>T ; NM_001363.4(DKC1):c.5C>T ; NM_001363.4(DKC1):c.911G>A ; NM_001363.4(DKC1):c.91C>A ; NM_001363.4(DKC1):c.91C>G ; NM_001363.4(DKC1):c.941A>G ; NM_001363.4(DKC1):c.949C>G ; NM_001363.4(DKC1):c.949C>T ; NM_001363.4(DKC1):c.961C>G ; NM_001363.4(DKC1):c.965G>A

GENE

DLD

DISEASES
Pyruvate dehydrogenase E3 deficiency
SUMMARY

Pyruvate dehydrogenase E3 deficiency is a very rare subtype of pyruvate dehydrogenase deficiency (PDHD, see this term) characterized by either early-onset lactic acidosis and delayed development, later-onset neurological dysfunction or liver disease.

CLINICAL DESCRIPTION

The majority of patients have presented with neonatal lactic acidosis or with lactic acidosis, delayed development and hypotonia during infancy. A few patients have presented later in childhood with ataxia and dystonia with normal cognitive development. A separate group of patients, essentially all of Ashkenazi Jewish origin and many homozygous for a common G229C missense mutation, present with episodic vomiting, abdominal pain, encephalopathy and liver cell dysfunction. In some patients, there is evidence of branched chain alpha-ketoacid dehydrogenase deficiency, with elevated concentrations of the branched chain amino acids and their metabolites. However, clinical manifestations in most cases appear to be related to the pyruvate dehydrogenase deficiency.

VARIANTS

NM_000108.3:c.105_106insA ; NM_000108.4(DLD):c.1483A>G ; NM_000108.3:c.916_926delTGTGATGTACT

GENE

DMD

DISEASES
Becker muscular dystrophy
SUMMARY

A rare, genetic muscular dystrophy characterized by progressive muscle wasting and weakness due to degeneration of skeletal, smooth and cardiac muscle.

CLINICAL DESCRIPTION

Onset is usually in childhood, typically after 7 years of age, but can be later. Presenting features in children include toe walking gait and or exercise-related cramps with or without myoglobinuria. Some patients may present following anesthetic induced acute rhabdomyolysis. In older patients, cardiomyopathy may be the presenting feature. As the condition progresses, muscle weakness leads to functional difficulties (difficulty climbing stairs or rising from a chair). Rarely, cardiomyopathy may be the presenting feature. Clinical examination reveals muscle pseudohypertrophy of the calf muscles and there may be atrophy of more proximal muscles such as the quadriceps. There is symmetrical and proximal muscle weakness, with the lower limbs being more severely affected than the upper limbs. There may be joint contractures, especially of the tendo- Achilles. The facial, ophthalmic and bulbar muscles are not involved. The condition is slowly progressive and about 40% of affected patients will eventually become wheelchair-dependent. In wheelchair dependent patients, restrictive respiratory insufficiency occurs due to weakness of the intercostal muscles and diaphragm. Cardiac involvement leads to dilated cardiomyopathy, which can be disproportionate to skeletal muscle involvement.

Duchenne muscular dystrophy
SUMMARY

A rare, genetic, muscular dystrophy characterized by rapidly progressive muscle weakness and wasting due to degeneration of skeletal, smooth and cardiac muscle.

CLINICAL DESCRIPTION

Onset occurs in early childhood, and affected boys may show a delay in walking (after 18 months of age) accompanied with speech and/or global developmental delay. Autism and behavioral problems, such as ADHD (attention deficit hyperactivity disorder), anxiety, obsessive compulsive disorder, are relatively common. Untreated children with DMD rarely achieve the ability to run or jump. The condition progresses rapidly and the child develops a waddling gait and a positive Gowers' sign. Climbing stairs becomes difficult and the child falls frequently. Loss of independent ambulation occurs between the ages of 6 and 13 years, the average being 9.5 years in non-steroid treated patients. Once ambulation is lost, joint contractures and scoliosis develop rapidly. Untreated patients die during late teens to early twenties from respiratory failure and or cardiomyopathy

Familial isolated dilated cardiomyopathy
SUMMARY

A rare familial cardiomyopathy characterized by the dilation of left ventricle and progressively impairing of systolic ventricular function, in the absence of abnormal loading conditions or coronary artery disease sufficient to cause global systolic impairment. The disease may cause heart failure or arrhythmia. The disease is isolated when no additional atypical cardiac or extracardiac manifestations are present.

CLINICAL DESCRIPTION

The disease is defined by the presence of two major clinical criteria: left ventricular (LV) fractional shortening less than 25% and/or LV ejection fraction less than 45% with LV end diastolic diameter greater than 117% of the predicted value (corrected for age and body surface area based on Henry's formula), in the absence of abnormal loading conditions or coronary artery disease sufficient to cause global systolic impairment. The disease can develop at any age, in either sex. LV mass is often greatly increased in this disorder but LV wall thickness is normal. Symptoms of heart failure may be present as well as arrhythmias. Other presentations include the incidental detection of asymptomatic cardiomegaly and symptoms related to coexisting conduction disturbance or thromboembolic complications. Typically, there is a history of DCM in the family.

Symptomatic form of muscular dystrophy of Duchenne and Becker in female carriers
SUMMARY

A rare, genetic muscular dystrophy affecting female carriers and characterized by variable degrees of muscle weakness due to progressive skeletal myopathy, sometimes associated with dilated cardiomyopathy or left ventricle dilation.

CLINICAL DESCRIPTION

Symptomatic female carriers usually present later than males with DMD or BMD. The muscle weakness is generally less severe than in affected males and is usually proximal and, unlike males, has an asymmetric distribution. The upper limbs may be weaker than the lower limbs. Myalgia and cramps have also been reported. The serum creatine kinase level is raised. Some patients may present with cardiac manifestations alone.

X-linked non-syndromic intellectual disability
SUMMARY

MECP2 duplication syndrome is an X-linked neurodevelopmental disorder characterized by severe to profound mental retardation, infantile hypotonia, mild dysmorphic features, poor speech development, autistic features, seizures, progressive spasticity, and recurrent infections. Only males are affected, although female carriers may have some mild neuropsychiatric features, such as anxiety. Submicroscopic Xq28 duplications encompassing MECP2 are considered nonrecurrent events, because the breakpoint locations and rearrangement sizes vary among affected individuals.

CLINICAL DESCRIPTION

VARIANTS

NM_000109.3(DMD):c.1700T>C ; NM_004006.2(DMD):c.4675-11A>G ; NM_004006.2(DMD):c.7555G>A ; NM_004006.2(DMD):c.10211delA ; NM_004006.2(DMD):c.10247G>A ; NM_004006.2(DMD):c.10509_10510del ; NM_004006.2(DMD):c.10797+1G>A ; NM_004006.2(DMD):c.1149+1G>A ; NM_004006.2(DMD):c.1304_1331+10del ; NM_004006.2(DMD):c.1602G>A ; NM_004006.2(DMD):c.170T>G ; NM_004006.2(DMD):c.177delG ; NM_004006.2(DMD):c.2292+2T>G ; NM_004006.2(DMD):c.31+1G>C ; NM_004006.2(DMD):c.3432+2036A>G ; NM_004006.2(DMD):c.357+1G>A ; NM_004006.2(DMD):c.3922-3C>T ; NM_004006.2(DMD):c.4000G>T ; NM_004006.2(DMD):c.4071+1delG ; NM_004006.2(DMD):c.4072-1G>T ; NM_004006.2(DMD):c.4115C>T ; NM_004006.2(DMD):c.4222C>T ; NM_004006.2(DMD):c.434G>C ; NM_004006.2(DMD):c.482_484delCCA ; NM_004006.2(DMD):c.5026-2A>G ; NM_004006.2(DMD):c.511G>C ; NM_004006.2(DMD):c.5154+2T>C ; NM_004006.2(DMD):c.5448+1G>A ; NM_004006.2(DMD):c.5586+1G>A ; NM_004010.3(DMD):c.631T>A ; NM_004006.2(DMD):c.650-39498A>G ; NM_004006.2(DMD):c.6614+3310G>T ; NM_004006.2(DMD):c.6913-11_6918del ; NM_004006.2(DMD):c.7085_7088dup ; NM_004006.2(DMD):c.7319dup ; NM_004006.2(DMD):c.7660+1G>C ; NM_004006.2(DMD):c.79_80insG ; NM_004006.2(DMD):c.8217+18052A>G ; NM_004006.2(DMD):c.832-15A>G ; NM_000109.3(DMD):c.8367-2A>G ; NM_004006.2(DMD):c.8391-1_8391delGGinsAA ; NM_004006.2(DMD):c.8459G>A ; NM_004006.2(DMD):c.8547+1G>A ; NM_004006.2(DMD):c.8548-2_8549dup ; NM_004006.2(DMD):c.9225-285A>G ; NM_004006.2(DMD):c.9225-647A>G ; NM_004006.2(DMD):c.9527A>G ; NM_004006.2(DMD):c.961-5831C>T ; NM_004006.2(DMD):c.9650-4_9655delGTAGACCTTT ; NM_004006.2(DMD):c.9958C>A ; NC_000023.11:g.32365200C>A ; NM_004006.2(DMD):c.10019G>A ; NM_004006.2(DMD):c.10033C>T ; NM_004006.2(DMD):c.10062T>A ; NM_004006.2(DMD):c.1006G>T ; NM_004006.2(DMD):c.10086+1G>A ; NM_004006.2(DMD):c.10087-2A>G ; NM_004006.2(DMD):c.100A>T ; NM_004006.2(DMD):c.10101_10103delAGA ; NM_004006.2(DMD):c.10108C>T ; NM_004006.2(DMD):c.10121del ; NM_004006.2(DMD):c.10126delC ; NM_004006.2(DMD):c.1012G>T ; NM_004006.2(DMD):c.10133del ; NM_004006.2(DMD):c.10141C>T ; NM_004006.2(DMD):c.10150delA ; NM_004006.2(DMD):c.10171C>T ; NM_004019.2(DMD):c.1020G>A ; NM_004006.2(DMD):c.10223+1G>C ; NM_004006.2(DMD):c.10238delT ; NM_004006.2(DMD):c.10258dupT ; NM_004006.2(DMD):c.10279C>T ; NM_004006.2(DMD):c.10361delA ; NM_004006.2(DMD):c.10367delA ; NM_004006.2(DMD):c.10406_10407insAA ; NM_004006.2(DMD):c.10412T>G ; NM_004006.2(DMD):c.10446_10447delCT ; NM_004006.2:c.10453_10454delCT ; NM_004006.2(DMD):c.10453delC ; NM_004006.2(DMD):c.10453dup ; NM_004006.2(DMD):c.10454delT ; NM_004006.2(DMD):c.10477C>T ; NM_004006.2(DMD):c.1048G>T ; NM_004006.2(DMD):c.10504G>T ; NM_004006.2(DMD):c.10504delG ; NM_004006.2(DMD):c.10519G>T ; NM_004006.2(DMD):c.10546G>T ; NM_004006.2(DMD):c.10554-2A>G ; NM_004006.2(DMD):c.10554dup ; NM_004006.2(DMD):c.10572T>A ; NM_004006.2(DMD):c.1061G>A ; NM_004006.2(DMD):c.10625delC ; NM_004006.2(DMD):c.1062G>A ; NM_004006.2(DMD):c.10651C>T ; NM_004006.2(DMD):c.10651_10652insCC ; NM_004006.2(DMD):c.1070delC ; NM_004006.2(DMD):c.10725delG ; NM_004006.2(DMD):c.1075G>T ; NM_004006.2(DMD):c.10783C>T ; NM_004006.2(DMD):c.10797+5G>A ; NM_004006.2(DMD):c.1093C>T ; NM_004006.2(DMD):c.1128dupA ; NM_004006.2(DMD):c.1150-1G>A ; NM_004006.2(DMD):c.1150-2A>G ; NM_004006.2(DMD):c.1150-2del ; c.1159C>T ; NM_004006.2:c.1238C-G ; NM_004006.2(DMD):c.1255G>T ; NM_004006.2(DMD):c.1261C>T ; c.1270del ; NM_004006.2(DMD):c.1286C>A ; NM_004006.2(DMD):c.1288A>T ; NM_004006.2(DMD):c.1292G>A ; NM_004006.2(DMD):c.1306dupG ; NM_004006.2(DMD):c.1324C>T ; NM_004006.2(DMD):c.1331+1G>A ; NM_004006.2(DMD):c.1332-9A>G ; NM_004006.2(DMD):c.133C>T ; NM_004006.2(DMD):c.1341_1342dupAG ; NM_004006.2(DMD):c.1366A>T ; NM_004006.2(DMD):c.1371delG ; NM_004006.2(DMD):c.137_138dupAT ; NM_004006.2(DMD):c.1387_1408del22 ; NM_004006.2(DMD):c.1388G>A ; NM_004006.2(DMD):c.1417A>T ; NM_004006.2(DMD):c.141dup ; NM_004006.2(DMD):c.1438G>T ; NM_000109.3(DMD):c.1457delA ; NM_004006.2(DMD):c.1465C>T ; NM_004006.2(DMD):c.1476delA ; NM_004006.2(DMD):c.1482+1G>C ; NM_004006.2(DMD):c.1482+1G>T ; NM_004006.2(DMD):c.1483-1G>C ; NM_004006.2(DMD):c.1489C>T ; NM_004006.2(DMD):c.14_15delAAinsT ; NM_004006.2(DMD):c.1504C>T ; NM_004006.2(DMD):c.1529_1530delTC ; NM_004006.2(DMD):c.1533_1536delTCAC ; NM_004006.2(DMD):c.1534_1535insTC ; NM_004006.2(DMD):c.153dupA ; c.1552C>T ; NM_004006.2(DMD):c.1577delC ; NM_004006.2(DMD):c.1594C>T ; NM_004006.2(DMD):c.1602+1G>A ; NM_004006.2(DMD):c.1602+1G>T ; NM_004006.2(DMD):c.1603-2A>C ; NM_004006.2(DMD):c.1615C>T ; NM_004006.2(DMD):c.1619G>A ; NM_004006.2(DMD):c.161T>G ; NM_004006.2(DMD):c.1620G>A ; NM_004006.2(DMD):c.1637G>A ; NM_004006.2(DMD):c.1638G>A ; NM_004006.2(DMD):c.1652G>A ; NM_004006.2(DMD):c.1653G>A ; NM_004006.2(DMD):c.1659_1660insGTAA ; NM_004006.2(DMD):c.1663C>T ; c.1664G>A ; NM_004006.2(DMD):c.1683G>A ; NM_004006.2(DMD):c.1704+1G>A ; NM_004006.2(DMD):c.1705-1G>T ; NM_004006.2:c.1734delA ; NM_004006.2(DMD):c.1769_1772dup ; NM_004006.2(DMD):c.178C>T ; NM_004006.2(DMD):c.1795delA ; NM_004006.2(DMD):c.179_180insGGGCA ; NM_004006.2(DMD):c.1812+1G>A ; NM_004006.2(DMD):c.1812+2T>A ; NM_004006.2(DMD):c.186+1G>A ; NM_004006.2(DMD):c.186+2T>A ; NM_004006.2(DMD):c.1865C>A ; NM_004006.2(DMD):c.1865C>G ; NM_004006.2(DMD):c.1886C>A ; NM_004006.2:c.1900A-T ; NM_004006.2:c.1900_1903dupAAGT ; NM_004006.2(DMD):c.1912C>T ; NM_004006.2(DMD):c.1952G>A ; NM_004006.2(DMD):c.1956delT ; NM_004006.2(DMD):c.1977_1981delAAAGA ; NM_004006.2(DMD):c.1978_1979del ; NM_004006.2(DMD):c.1990C>T ; NM_004006.2(DMD):c.1992+1G>T ; NM_004006.2:c.199G-T ; NM_004006.2(DMD):c.19delG ; NM_004006.2:c.2002delG ; NM_004006.2(DMD):c.2017C>T ; NM_004006.2(DMD):c.2032C>T ; c.204dup ; NM_004006.2(DMD):c.2052_2053delAG ; NM_004006.2(DMD):c.2076dupA ; NM_004006.2(DMD):c.2077C>T ; NM_004006.2(DMD):c.2101G>T ; NM_004006.2(DMD):c.2111del ; NM_004006.2(DMD):c.2125delC ; NM_004006.2(DMD):c.2129del ; NM_004006.2(DMD):c.2132delA ; NM_004006.2:c.2137C-T ; NM_004006.2(DMD):c.2168+1G>A ; NM_004006.2(DMD):c.2168+2T>G ; NM_004006.2:c.2169-3_2169-1delinsAA ; NM_004006.2(DMD):c.2195dup ; NM_004006.2(DMD):c.2202G>A ; c.220del ; NM_004006.2(DMD):c.2215G>T ; NM_004006.2(DMD):c.2257G>T ; NM_004006.2:c.2268delC ; NM_004006.2(DMD):c.2276T>A ; NM_004006.2(DMD):c.2281_2285delGAAAA ; NM_004006.2(DMD):c.2294_2297delCCAT ; NM_004006.2(DMD):c.2302C>T ; c.2305_2306insAAT ; NM_004006.2(DMD):c.2308A>T ; NM_004006.2(DMD):c.2314G>T ; NM_004006.2(DMD):c.2316_2317delGA ; NM_004006.2(DMD):c.2317A>G ; NM_004006.2(DMD):c.2332C>T ; NM_004006.2(DMD):c.2368C>T ; NM_004006.2(DMD):c.2380+1G>C ; NM_004006.2(DMD):c.2380+3A>C ; NM_004006.2:c.2380.2T-C ; NM_004006.2(DMD):c.2381-1G>T ; NM_004006.2(DMD):c.238dupG ; NM_000109.3(DMD):c.2392G>T ; NM_004006.2(DMD):c.2407C>T ; NM_004006.2(DMD):c.2419C>T ; NM_004006.2(DMD):c.2423_2424insA ; NM_000109.3(DMD):c.2461C>T ; NM_004006.2(DMD):c.2479G>T ; c.2479del ; NM_004006.2(DMD):c.2484T>G ; NM_004006.2(DMD):c.2512C>T ; NM_004006.2:c.251delT ; NM_004006.2:c.2523delA ; NM_004006.2(DMD):c.253C>T ; NM_004006.2(DMD):c.2547delT ; NM_004006.2(DMD):c.2555G>A ; NM_004006.2(DMD):c.2556G>A ; c.2587del ; NM_004006.2(DMD):c.2601_2602delAA ; NM_004006.2(DMD):c.2603delG ; NM_004006.2(DMD):c.2611A>T ; NM_004006.2(DMD):c.2622+1G>A ; NM_004006.2(DMD):c.2623-1G>T ; NM_004006.2(DMD):c.2623-3C>G ; NM_004006.2(DMD):c.2638delC ; NM_004006.2(DMD):c.264+1G>A ; NM_004006.2(DMD):c.2644_2645delGGinsA ; NM_004006.2(DMD):c.265-2A>G ; NM_004006.2(DMD):c.2650C>T ; NM_004006.2(DMD):c.2665C>T ; NM_004006.2(DMD):c.2669T>A ; NM_004006.2(DMD):c.2733dupT ; NM_004006.2(DMD):c.2755A>T ; c.2758C>T ; NM_004006.2(DMD):c.2776C>T ; NM_004006.2(DMD):c.2791G>T ; NM_004006.2(DMD):c.2797C>T ; c.2803+1G>A ; NM_004006.2(DMD):c.2803+1G>T ; NM_004006.2(DMD):c.2804-1G>A ; NM_004006.2(DMD):c.2804-1delG ; NM_004006.2(DMD):c.2804-2A>T ; NM_004006.2(DMD):c.280del ; NM_004006.2(DMD):c.2815_2816delTT ; NM_004006.2(DMD):c.2816T>A ; NM_004006.2(DMD):c.282dup ; NM_004006.2(DMD):c.283G>T ; NM_004006.2(DMD):c.2861G>A ; c.2866C>T ; NM_004006.2(DMD):c.28delT ; NM_004006.2(DMD):c.2914del ; NM_004006.2(DMD):c.291dupT ; NM_004006.2:c.2929dupC ; NM_004006.2(DMD):c.2933_2934delGA ; NM_004006.2(DMD):c.2949+1G>A ; NM_004006.2(DMD):c.2950-2A>T ; NM_004006.2(DMD):c.2956C>T ; NM_004006.2(DMD):c.2968C>T ; NM_004006.2:c.2971G-T ; NM_004006.2(DMD):c.2991C>G ; NM_004006.2(DMD):c.3020C>A ; NM_004006.2:c.3022A-T ; c.3076G>T ; NM_004006.2:c.3087G-A ; NM_004006.2(DMD):c.31+1G>T ; NM_004006.2(DMD):c.31+36947G>A ; NM_004006.2(DMD):c.3121C>T ; NM_004006.2:c.3124A-T ; NM_004006.2(DMD):c.3151C>T ; NM_004006.2:c.3172C-T ; NM_004006.2(DMD):c.3188G>A ; NM_004006.2(DMD):c.319dupA ; NM_004006.2(DMD):c.3217G>T ; NM_004006.2(DMD):c.3220G>T ; NM_004006.2(DMD):c.3238delG ; NM_004006.2:c.3246_3247insTTTCTAAAAA ; NM_004006.2(DMD):c.3257dup ; NM_004006.2(DMD):c.3259C>T ; NM_004006.2(DMD):c.3268C>T ; NM_004006.2(DMD):c.3276+1G>A ; NM_004006.2(DMD):c.3276+2delT ; NM_004006.2(DMD):c.3295C>T ; NM_004006.2(DMD):c.3309_3313delCAGTC ; NM_004006.2(DMD):c.3358G>T ; NM_004006.2(DMD):c.3365_3366delAG ; NM_004006.2(DMD):c.3365_3366dupAG ; NM_004006.2(DMD):c.336G>A ; NM_004006.2(DMD):c.3374C>A ; NM_004006.2(DMD):c.3388_3389dup ; NM_004006.2(DMD):c.3413G>A ; NM_004006.2(DMD):c.3427C>T ; NM_004006.2(DMD):c.3432+1G>A ; NM_004006.2(DMD):c.3432+3A>G ; NM_004006.2(DMD):c.3433-2_3433-1delAGinsCC ; NM_004006.2(DMD):c.3433-5_3434del ; NM_004006.2(DMD):c.3469G>T ; NM_004006.2(DMD):c.3487C>T ; NM_004006.2(DMD):c.3497_3500delTATC ; NM_004006.2(DMD):c.3500C>G ; NM_004006.2(DMD):c.3532G>T ; NM_004006.2(DMD):c.3535G>T ; NM_004006.2(DMD):c.355C>T ; NM_004006.2(DMD):c.356delA ; NM_004006.2(DMD):c.358-1G>A ; NM_004006.2(DMD):c.358-2A>G ; NM_004006.2(DMD):c.3580C>T ; NM_004006.2(DMD):c.3603+1G>T ; NM_004006.2(DMD):c.3603+2T>A ; NM_004006.2(DMD):c.3603+2T>G ; NM_004006.2(DMD):c.3603+2dup ; NM_004006.2(DMD):c.3603+3A>T ; NM_004006.2(DMD):c.3604-1G>C ; NM_004006.2(DMD):c.3606_3607del ; NM_004006.2(DMD):c.3631G>T ; NM_004006.2(DMD):c.3639dupA ; NM_004006.2(DMD):c.365delA ; NM_004006.2(DMD):c.3679C>T ; NM_004006.2:c.3697delC ; NM_004006.2(DMD):c.3713delA ; NM_004006.2(DMD):c.3742C>T ; NM_004006.2(DMD):c.3747G>A ; NM_004006.2(DMD):c.3747delG ; NM_004006.2(DMD):c.3779_3785delCTTTGGAinsGG ; NM_004006.2(DMD):c.377delA ; NM_004006.2(DMD):c.3804G>A ; NM_004006.2(DMD):c.3817delT ; NM_004006.2(DMD):c.3838A>T ; NM_004006.2(DMD):c.3856G>T ; NM_004006.2(DMD):c.3885delT ; NM_004006.2(DMD):c.3923C>A ; NM_004006.2(DMD):c.3940C>T ; NM_004006.2:c.3959delC ; NM_004006.2(DMD):c.4060delC ; NM_004006.2(DMD):c.4071+1G>A ; NM_004006.2(DMD):c.40_41delGA ; NM_004006.2(DMD):c.4117C>T ; NM_004006.2(DMD):c.4120G>T ; NM_004006.2(DMD):c.412_413delAA ; NM_004006.2(DMD):c.4151del ; NM_004006.2(DMD):c.415_428delATTCTCCTGAGCTG ; NM_004006.2(DMD):c.4174C>T ; NM_004006.2(DMD):c.4213C>T ; NM_004006.2(DMD):c.4231C>T ; NM_004006.2(DMD):c.4240C>T ; NM_004006.2(DMD):c.4290_4291delTA ; NM_004006.2(DMD):c.4295delA ; NM_004006.2(DMD):c.4312C>T ; NM_004006.2(DMD):c.4315A>T ; NM_004006.2(DMD):c.433C>T ; NM_004006.2:c.4351_4352insA ; NM_004006.2(DMD):c.4375C>T ; NM_004006.2(DMD):c.4405C>T ; NM_004006.2:c.4409_4412dupGTCT ; NM_004006.2(DMD):c.4414C>T ; NM_004006.2(DMD):c.4471_4472delAA ; NM_004006.2(DMD):c.4483C>T ; NM_004006.2(DMD):c.4486G>T ; NM_004006.2:c.4486delG ; NM_004006.2(DMD):c.4495C>T ; c.4500del ; NM_004006.2(DMD):c.4518+5G>A ; NM_004006.2(DMD):c.4523delT ; NM_004006.2(DMD):c.4534_4535delCT ; NM_004006.2(DMD):c.4538_4541delGTGA ; NM_004006.2(DMD):c.4545_4549delGAAGT ; NM_004006.2(DMD):c.4546A>T ; NM_004006.2(DMD):c.4550_4556delCTGAAGT ; NM_004006.2(DMD):c.457C>T ; NM_004006.2(DMD):c.4591C>T ; NM_004006.2(DMD):c.4606G>T ; NM_004006.2:c.4611delT ; NM_004006.2(DMD):c.4618G>T ; NM_004006.2(DMD):c.4675-2A>G ; NM_004006.2(DMD):c.468delAinsGG ; NM_004006.2(DMD):c.4729C>T ; c.4735G>T ; NM_004006.2(DMD):c.4758G>A ; NM_004006.2(DMD):c.4786_4787del ; NM_004006.2(DMD):c.478_479insAC ; NM_004006.2(DMD):c.4806A>T ; NM_004006.2(DMD):c.4838G>A ; NM_004006.2(DMD):c.4843A>T ; NM_004006.2(DMD):c.4845+1G>T ; NM_004006.2(DMD):c.4845+2T>G ; c.4856_4857del ; NM_004006.2(DMD):c.4858G>T ; NM_004006.2(DMD):c.4870C>T ; NM_004006.2:c.489G-A ; NM_004006.2(DMD):c.4918_4919delACinsTG ; NM_004006.2(DMD):c.4918del ; NM_004006.2(DMD):c.4934_4937delAGGA ; NM_004006.2:c.4960dupA ; NM_004006.2(DMD):c.4996C>T ; NM_004006.2(DMD):c.5024T>A ; NM_004006.2(DMD):c.5032C>T ; NM_004006.2(DMD):c.503C>A ; NM_004006.2(DMD):c.5082G>A ; NM_004006.2(DMD):c.5089C>T ; NM_004006.2(DMD):c.5097_5098delCAinsATGAATGAATTCATT ; NM_004006.2(DMD):c.5100_5101delAC ; NM_004006.2(DMD):c.5110G>T ; NM_004006.2(DMD):c.5124_5127delGAAA ; NM_004006.2(DMD):c.5131C>T ; NM_004006.2(DMD):c.5139delA ; NM_004006.2(DMD):c.5140G>T ; NM_004006.2(DMD):c.522_523del ; NM_004006.2(DMD):c.5266C>T ; NM_004006.2(DMD):c.5276_5277delAG ; NM_004006.2(DMD):c.5287C>T ; NM_004006.2:c.530.1delG ; NM_004006.2(DMD):c.531-1G>C ; NM_004006.2(DMD):c.531-2A>G ; c.5313dup ; NM_004006.2(DMD):c.5334delT ; NM_004006.2(DMD):c.5344G>T ; NM_004006.2(DMD):c.5350G>T ; NM_004006.2(DMD):c.5353C>T ; NM_004006.2(DMD):c.5360dupA ; NM_004006.2(DMD):c.5363C>G ; NM_004006.2(DMD):c.5371C>T ; NM_004006.2(DMD):c.5390_5411del ; NM_004006.2(DMD):c.5407C>T ; NM_004006.2(DMD):c.5455_5459dup ; NM_004006.2(DMD):c.5461G>T ; NM_004006.2(DMD):c.547dup ; NM_004006.2(DMD):c.5487_5488delAA ; NM_004006.2(DMD):c.5506C>T ; NM_004006.2(DMD):c.5530C>T ; NM_004006.2(DMD):c.5533G>T ; NM_004006.2(DMD):c.5548_5552delAAACA ; NM_004006.2(DMD):c.5551C>T ; NM_004006.2(DMD):c.5554C>T ; NM_004006.2(DMD):c.5563C>T ; NM_004006.2:c.5570_5571dupAA ; NM_004006.2(DMD):c.5595delG ; NM_004006.2(DMD):c.5602A>T ; NM_004006.2(DMD):c.5602_5605del ; NM_004006.2(DMD):c.5613_5640delGGCTCTAGAAATTTCTCATCAGTGGTAT ; NM_004006.2(DMD):c.5640T>A ; NM_004006.2(DMD):c.5641C>T ; NM_004006.2(DMD):c.5647A>T ; NM_004006.2(DMD):c.5652delG ; NM_004006.2(DMD):c.565C>T ; NM_004006.2:c.5671A-T ; NM_004006.2(DMD):c.5680del ; NM_004006.2(DMD):c.5697delA ; NM_004006.2(DMD):c.5699T>G ; NM_004006.2(DMD):c.5713G>T ; NM_004006.2(DMD):c.5729_5733del ; NM_004006.2(DMD):c.572C>G ; NM_004006.2(DMD):c.5739+1G>T ; NM_004006.2(DMD):c.5758C>T ; NM_004006.2(DMD):c.5773G>T ; NM_004006.2(DMD):c.5800G>T ; NM_004006.2:c.5807T-A ; NM_004006.2(DMD):c.583C>T ; NM_004006.2(DMD):c.5851C>T ; NM_004006.2(DMD):c.5867G>A ; NM_004006.2(DMD):c.5868G>A ; NM_004006.2(DMD):c.5872G>T ; NM_004006.2(DMD):c.5881_5882delAG ; NM_004006.2(DMD):c.5884_5891delAAATTTGC ; NM_004006.2(DMD):c.5899C>T ; NM_004006.2(DMD):c.589G>T ; NM_004006.2(DMD):c.5910delC ; NM_004006.2(DMD):c.5917C>T ; NM_004006.2(DMD):c.5938G>T ; NM_004006.2(DMD):c.595_598dup ; NM_004006.2(DMD):c.5972del ; NM_004006.2(DMD):c.5984delA ; NM_004006.2(DMD):c.5985T>G ; NM_004006.2(DMD):c.6000T>A ; NM_004006.2:c.6014_6017delCTCA ; NM_004006.2(DMD):c.6025C>T ; NM_004006.2(DMD):c.6025_6026delCA ; NM_004006.2(DMD):c.6072T>A ; NM_004006.2:c.6100delC ; NM_004006.2(DMD):c.6118-1G>A ; NM_004006.2(DMD):c.6128_6131del ; NM_004006.2(DMD):c.6139C>T ; NM_004006.2(DMD):c.615T>A ; NM_004006.2(DMD):c.6182delC ; NM_004006.2(DMD):c.6205delG ; NM_004006.2(DMD):c.6223C>T ; c.6226G>T ; NM_004006.2(DMD):c.6238delC ; NM_004006.2(DMD):c.6276C>G ; NM_004006.2(DMD):c.627delA ; NM_004006.2(DMD):c.6290+1G>C ; NM_004006.2(DMD):c.6292C>T ; NM_004006.2(DMD):c.630delG ; NM_004006.2(DMD):c.6317G>A ; c.6340A>T ; NM_004006.2(DMD):c.6373C>T ; NM_004006.2(DMD):c.6391_6392delCA ; NM_004006.2(DMD):c.6392_6393insCA ; NM_004006.2(DMD):c.6393_6394insCA ; NM_004006.2(DMD):c.6408G>A ; NM_004006.2(DMD):c.6423C>A ; NM_004006.2(DMD):c.6423delC ; NM_004006.2(DMD):c.6424A>T ; NM_004006.2(DMD):c.6472_6473delGT ; NM_004006.2(DMD):c.649+1G>A ; NM_004006.2(DMD):c.649+1G>T ; NM_004006.2(DMD):c.649+5G>T ; NM_004006.2(DMD):c.6502G>T ; NM_004006.2(DMD):c.6544C>T ; NM_004006.2(DMD):c.656dup ; NM_004006.2(DMD):c.6580G>T ; NM_004006.2(DMD):c.6611dupA ; NM_004006.2(DMD):c.6614+2T>C ; NM_004006.2(DMD):c.6615-2A>T ; NM_004006.2:c.6638delT ; NM_004006.2(DMD):c.6649C>T ; NM_004006.2(DMD):c.6651_6652delAA ; NM_004006.2(DMD):c.6662delA ; NM_004006.2(DMD):c.6665_6668delAATT ; NM_004006.2(DMD):c.6673_6674insGTTT ; NM_004006.2(DMD):c.6762+1G>T ; NM_004006.2:c.6763-2A-G ; NM_004006.2(DMD):c.676_678delAAG ; NM_004006.2(DMD):c.6790C>T ; NM_004006.2(DMD):c.6804_6807delACAA ; c.6808_6811del ; c.6834del ; NM_004006.2(DMD):c.686T>G ; NM_004006.2(DMD):c.6874G>T ; NM_004006.2(DMD):c.6906G>A ; NM_004006.2(DMD):c.691T>A ; NM_004006.2:c.6936delA ; c.6943G>T ; NM_004006.2(DMD):c.6955C>T ; c.6964del ; NM_004006.2(DMD):c.6982A>T ; NM_004006.2(DMD):c.6986dupA ; NM_004006.2(DMD):c.699_703dup ; NM_000109.3(DMD):c.700C>T ; NM_004006.2(DMD):c.7052_7053delTG ; NM_004006.2(DMD):c.7068_7069delAC ; NM_004006.2(DMD):c.7098+1G>T ; NM_004006.2(DMD):c.7105G>T ; NM_004006.2(DMD):c.7159C>T ; NM_004006.2(DMD):c.7170C>G ; NM_004006.2(DMD):c.7189C>T ; NM_004006.2(DMD):c.7241_7243delACCinsGTTT ; NM_004006.2(DMD):c.7247T>A ; NM_004006.2(DMD):c.7247dupT ; NM_004006.2(DMD):c.7252C>T ; NM_004006.2(DMD):c.7268delA ; NM_004006.2(DMD):c.7295_7296delCC ; NM_004006.2(DMD):c.7309+1G>A ; NM_004006.2(DMD):c.7310-1G>A ; NM_004006.2(DMD):c.7402G>T ; NM_004006.2(DMD):c.7444delC ; NM_004006.2(DMD):c.748G>T ; NM_004006.2(DMD):c.7657C>T ; NM_004006.2(DMD):c.7661-1G>C ; NM_004006.2(DMD):c.7661-2A>G ; NM_004006.2(DMD):c.7672C>T ; NM_004006.2(DMD):c.7682G>A ; NM_004006.2(DMD):c.7683G>A ; NM_004006.2(DMD):c.7755G>A ; c.7764dup ; NM_004006.2(DMD):c.776_777del ; NM_004006.2(DMD):c.7771G>T ; NM_004006.2(DMD):c.7781delA ; NM_004006.2:c.7814C-G ; NM_004006.2(DMD):c.7817G>A ; NM_004006.2(DMD):c.7894C>T ; NM_004006.2(DMD):c.7899G>A ; NM_004006.2(DMD):c.7922delA ; NM_004006.2(DMD):c.8010G>A ; NM_004006.2(DMD):c.8027+1G>A ; NM_004006.2(DMD):c.8027+2T>A ; NM_004006.2:c.8027.2T-C ; NM_004006.2(DMD):c.8038C>T ; NM_004006.2(DMD):c.8061del ; NM_004006.2(DMD):c.8064_8065delTA ; NM_004006.2(DMD):c.8066_8070delGATTA ; NM_004006.2(DMD):c.8069T>G ; NM_004006.2(DMD):c.8077C>T ; c.8086del ; NM_004006.2(DMD):c.8096_8112delAAAAGTTTCTTGCCTGG ; NM_004006.2(DMD):c.8111_8112insTTGCCTG ; NM_000109.3(DMD):c.8173G>T ; NM_004006.2(DMD):c.8184delC ; NM_004006.2(DMD):c.8196del ; NM_004006.2(DMD):c.8209C>T ; NM_004006.2(DMD):c.8218-2A>G ; NM_004006.2(DMD):c.8263delC ; NM_004006.2(DMD):c.831+1G>A ; NM_004006.2(DMD):c.831+1G>T ; NM_004006.2(DMD):c.8357G>A ; NM_004006.2:c.8358G-A ; NM_004006.2(DMD):c.835A>G ; NM_004006.2(DMD):c.8374_8375delAA ; NM_004006.2(DMD):c.8390+1G>A ; NM_004006.2(DMD):c.8390+1G>C ; NM_004006.2(DMD):c.8390+2T>C ; NM_004006.2(DMD):c.8443C>T ; NM_004006.2:c.8464C-T ; NM_004006.2(DMD):c.8524C>T ; NM_004006.2(DMD):c.8548-1G>C ; NM_004006.2(DMD):c.8575G>T ; NM_004006.2(DMD):c.8579delC ; NM_004006.2(DMD):c.857dup ; NM_004006.2(DMD):c.8604dup ; NM_004006.2(DMD):c.8608C>T ; NM_004006.2(DMD):c.8647A>T ; NM_004006.2(DMD):c.8652_8653delCT ; NM_004006.2(DMD):c.8655C>A ; NM_004006.2(DMD):c.8656C>T ; NM_004006.2(DMD):c.8669-1G>C ; NM_004006.2(DMD):c.8669-2A>C ; NM_004006.2(DMD):c.8675delC ; NM_004006.2(DMD):c.8680G>T ; NM_004006.2(DMD):c.8683dup ; NM_004006.2(DMD):c.8713C>T ; NM_004006.2:c.8729_8734delAGGTCAinsTGGTCG ; NM_000109.3(DMD):c.8758A>T ; NM_004006.2(DMD):c.8775G>A ; NM_004006.2(DMD):c.883C>T ; NM_004006.2(DMD):c.8880G>A ; NM_004006.2(DMD):c.8912_8913delTC ; NM_004006.2(DMD):c.8914C>T ; NM_004006.2(DMD):c.8937+1G>T ; NM_004006.2(DMD):c.8944C>T ; NM_004006.2(DMD):c.8970_8971delGA ; NM_004006.2(DMD):c.9040dupC ; NM_004006.2(DMD):c.9100C>T ; NM_004006.2(DMD):c.9125delA ; NM_004006.2(DMD):c.9148C>T ; NM_004006.2(DMD):c.9158_9161delTTTC ; NM_004006.2(DMD):c.9163+2T>G ; NM_004006.2:c.9164-1G-T ; NM_004006.2(DMD):c.9164-1G>C ; NM_004006.2:c.9180delC ; NM_004006.2(DMD):c.9183G>A ; NM_004006.2(DMD):c.918T>A ; NM_004006.2(DMD):c.9197C>A ; NM_004006.2(DMD):c.9204_9207delCAAA ; NM_004006.2(DMD):c.9216C>G ; NM_004006.2(DMD):c.9224+1G>A ; NM_004006.2(DMD):c.9238_9241delACAA ; NM_004006.2(DMD):c.93+1G>A ; NM_004006.2(DMD):c.93+1G>C ; NM_004006.2(DMD):c.93+1_93+5delGTAAG ; NM_004006.2(DMD):c.9337C>T ; NM_004006.2(DMD):c.9361+1G>A ; NM_004006.2(DMD):c.9361+1G>C ; NM_004006.2(DMD):c.9370_9371delTT ; NM_004006.2:c.9380C-G ; NM_004006.2(DMD):c.94-1G>A ; NM_004006.2(DMD):c.94-1G>T ; NM_004006.2(DMD):c.9434delT ; NM_004006.2(DMD):c.9471_9474delTTAT ; NM_004006.2(DMD):c.9503delT ; NM_000109.3(DMD):c.9536A>G ; NM_004006.2(DMD):c.9551dup ; NM_004006.2(DMD):c.9563+1G>A ; NM_004006.2(DMD):c.9564-1G>A ; NM_004006.2(DMD):c.9568C>T ; NM_004006.2(DMD):c.9621T>A ; NM_004006.2(DMD):c.9634G>T ; NM_004006.2(DMD):c.9649+1G>A ; NM_004006.2(DMD):c.9650-2A>G ; NM_004006.2(DMD):c.9691C>T ; NM_004006.2(DMD):c.9727C>T ; NM_004006.2(DMD):c.9767dupG ; NM_004006.2(DMD):c.9807+1G>T ; NM_004006.2(DMD):c.9854_9863delTGAGACTGGA ; NM_004006.2(DMD):c.9862G>T ; NM_004006.2(DMD):c.9880_9881dup ; NM_004006.2(DMD):c.9881_9890delGGCTGCCCGT ; NM_004006.2(DMD):c.9928C>T ; NM_004006.2(DMD):c.9938_9941dup ; NM_004006.2(DMD):c.9975-1G>A ; NM_004006.2(DMD):c.9975-2A>C ; NM_004006.2(DMD):c.9978C>G ; NM_004006.2(DMD):c.9G>A ; NC_000023.11:g.31147307G>A ; NC_000023.11:g.31178710G>T ; NC_000023.11:g.31182563A>T ; NC_000023.11:g.31209496A>T ; NC_000023.11:g.31209593del ; NC_000023.11:g.31348625C>A ; NC_000023.11:g.31444574del ; NC_000023.11:g.31478162G>A ; NC_000023.11:g.31478243C>A ; NC_000023.11:g.31729679dup ; NC_000023.11:g.31729711A>T ; NC_000023.11:g.31774048C>T ; NC_000023.11:g.31774102A>T ; NC_000023.11:g.31875220G>A ; NC_000023.11:g.31875229_31875238del ; NC_000023.11:g.32287536G>A ; NC_000023.11:g.32386377dup ; NC_000023.11:g.32389586A>C ; NC_000023.11:g.32472244G>A ; NC_000023.11:g.32485018G>A ; NC_000023.11:g.32491433_32491434TC[1] ; NC_000023.11:g.32573624del ; NC_000023.11:g.32573639T>C ; NC_000023.11:g.32644208_32644209dup ; NC_000023.11:g.32699111C>G ; NC_000023.11:g.32809526G>A ; NC_000023.11:g.32816625dup ; NC_000023.11:g.32823348_32823360del ; NC_000023.11:g.32844861C>A ; NC_000023.11:g.33020194_33020198del ; NC_000023.11:g.33211284del ; CNVs (Deletions and duplications)

GENE

DPYD

DISEASES
1p21.3 microdeletion syndrome
SUMMARY

1p21.3 microdeletion syndrome is an extremely rare chromosomal anomaly characterized by severe speech and language delay, intellectual deficiency, autism spectrum disorder(see this term).

CLINICAL DESCRIPTION

1p21.3 microdeletion syndrome is characterized by severe speech and language delay, a borderline-mild to mild-moderate intellectual deficiency, autism spectrum disorder (see this term) features, and minor dysmorphic facial features such as long ears, deep set eyes, a broad nasal tip and a thick lower lip. Affected individuals have normal gross motor development without major abnormalities, they are often very shy and friendly with a tendency to overeat.

Dihydropyrimidine dehydrogenase deficiency
SUMMARY

Dihyropyrimidine dehydrogenase deficiency shows large phenotypic variability, ranging from no symptoms to a convulsive disorder with motor and mental retardation in homozygous patients. In addition, homozygous and heterozygous mutation carriers can develop severe toxicity after the administration of the antineoplastic drug 5-fluorouracil (5FU), which is also catabolized by the DPYD enzyme.

CLINICAL DESCRIPTION

A rare disorder of pyrimidine metabolism characterized by a variable phenotype ranging from absence of symptoms to severe neurological involvement with developmental delay, intellectual disability, and seizures. Additional signs and symptoms may include hypotonia, microcephaly, ocular abnormalities (such as microphthalmia, nystagmus, and strabismus), and autistic behavior, among others. Analysis of urine typically shows high levels of uracil and thymine. Patients are at risk of suffering from severe toxicity after the administration of the anti-neoplastic agent 5-fluorouracil.

VARIANTS

NM_000110.3(DPYD):c.1109_1110delTA

GENE

DYSF

DISEASES
Congenital myopathy, Paradas type
SUMMARY

A rare congenital muscular dystrophy characterized by early onset of hypotonia, delayed motor development, and variably progressive generalized muscle weakness. Predominant involvement of pelvic and neck flexor muscles has been reported, as well as early involvement of hamstrings and medial gastrocnemius visible on muscle MRI. Serum creatine kinase levels are markedly elevated (in some cases already from early childhood). Muscle biopsy shows absence of dysferlin.

CLINICAL DESCRIPTION

Distal myopathy with anterior tibial onset
SUMMARY

Distal myopathy with anterior tibial onset is a rare, genetic neuromuscular disease characterized by a progressive muscle weakness starting in the anterior tibial muscles, later involving lower and upper limb muscles, associated with an increased serum creatine kinase levels and absence of dysferlin on muscle biopsy. Patients become wheelchair dependent.

CLINICAL DESCRIPTION

Onset of the disorder is between 14 and 28 years of age and the anterior tibial muscles are the first muscle group to be involved. The disorder has a rapidly progressive course successively involving the lower and upper proximal muscles, with patients being confined to a wheelchair 11 to 22 years from onset. The cranial muscles are spared. Serum creatine kinase level is increased 20 to 70 times the normal value and muscle histopathologic studies show moderate myopathic changes without vacuoles.

Dysferlin-related limb-girdle muscular dystrophy R2
SUMMARY

A subtype of autosomal recessive limb-girdle muscular dystrophy characterized by an onset in late adolescence or early adulthood of slowly progressive, proximal weakness and atrophy of shoulder and pelvic girdle muscles. Cardiac and respiratory muscles are not involved. Hypertrophy of the calf muscles and highly elevated serum creatine kinase levels are frequently observed.

CLINICAL DESCRIPTION

Age at onset ranges from 15 to 25 years with difficulty in climbing stairs, fatigue, weakness, and markedly elevated serum creatine kinase. EMG showed myopathic changes and skeletal muscle biopsies showed severe myopathic changes with variation of fiber size, fiber splitting, increased connective tissue, and some necrotic changes. Disease progression was relatively slow.

Miyoshi myopathy
SUMMARY

A recessive distal myopathy characterized by weakness in the distal lower extremity posterior compartment (gastrocnemius and soleus muscles) and associated with difficulties in standing on tip toes.

CLINICAL DESCRIPTION

The typical age of onset of MM lies between 15 and 30 years (median 19 years) and the disease is characterized by muscle atrophy usually symmetric especially of the calf muscles (soleus and gastrocnemius). Onset in the anterior tibial muscles has been rarely reported. Ankle muscle stretch reflexes are lost and difficulties for toe walking or climbing stairs are encountered. Exercise-induced myalgia and aching discomfort in the calves can be an early symptom. Anterior compartment muscles of the distal lower extremities eventually become weak as well. As the disease progresses, patients will develop proximal leg and arm weakness to varying degrees. Decrease in respiratory functions have been reported only in few patients with moderate to severe disease. Bulbar or symptoms have not been reported.

VARIANTS

NM_003494.3(DYSF):c.1555G>A ; NM_003494.3(DYSF):c.5999G>A ; NM_003494.3(DYSF):c.1053+1G>A ; NM_003494.3(DYSF):c.1398-1G>A ; NM_003494.3:c.1861G-C ; NM_003494.3(DYSF):c.3041A>G ; NM_003494.3(DYSF):c.4253G>A ; NM_003494.3(DYSF):c.5077C>T ; NM_003494.3(DYSF):c.6124C>T ; NM_003494.3(DYSF):c.701G>A ; NM_001130987.1(DYSF):c.853C>T ; NM_003494.3(DYSF):c.895G>A ; NM_003494.3(DYSF):c.1284+2T>C ; NM_003494.3(DYSF):c.1368C>A ; NM_001130987.1(DYSF):c.1372G>A ; NM_003494.3(DYSF):c.1392dupA ; NM_003494.3(DYSF):c.1398-2A>G ; NM_003494.3(DYSF):c.1481-1G>A ; NM_003494.3:c.1620delA ; NM_003494.3(DYSF):c.1638+2T>A ; NM_003494.3(DYSF):c.1663C>T ; NM_001130978.1(DYSF):c.1813C>T ; NM_003494.3(DYSF):c.1834C>T ; NM_001130978.1(DYSF):c.1873G>T ; NM_001130978.1(DYSF):c.200_201delTGinsAT ; NM_003494.3(DYSF):c.2869C>T ; NM_003494.3(DYSF):c.2870_2874delAGACC ; NM_003494.3(DYSF):c.2997G>T ; NM_003494.3(DYSF):c.3112C>T ; c.3175-2A>T ; NM_003494.3(DYSF):c.3444_3445delTGinsAA ; NM_003494.3:c.3477C-A ; NM_003494.3(DYSF):c.3478C>T ; NM_003494.3(DYSF):c.3641delC ; NM_003494.3:c.3708delA ; NM_003494.3(DYSF):c.3805G>T ; c.3903+1del ; NM_003494.3(DYSF):c.393_394delCC ; NM_003494.3:c.3957delC ; NM_003494.3(DYSF):c.4090C>T ; c.4108_4109del ; NM_003494.3(DYSF):c.4756C>T ; NM_003494.4:c.4872_4876delGCCCGinsCCCC ; NM_001130978.1(DYSF):c.5264A>G ; NM_003494.3(DYSF):c.5266C>T ; NM_003494.3(DYSF):c.5341-2A>C ; NM_003494.3(DYSF):c.5429+1G>T ; NM_003494.3(DYSF):c.5429G>A ; NM_003494.3(DYSF):c.5497G>T ; NM_003494.3(DYSF):c.5509G>A ; NM_003494.3(DYSF):c.5525+1G>A ; NM_003494.3(DYSF):c.5594delG ; NM_003494.3(DYSF):c.5644C>T ; NM_003494.3(DYSF):c.5698_5699delAG ; NM_003494.3(DYSF):c.5713C>T ; NM_003494.3(DYSF):c.5836_5839delCAGC ; NM_003494.3(DYSF):c.5979dupA ; NM_003494.3:c.5992G-T ; NM_003494.3(DYSF):c.610C>T ; NM_003494.3(DYSF):c.663+1G>C ; NM_001130978.1(DYSF):c.895G>T ; NM_003494.3(DYSF):c.937+1G>A

GENE

EDA

DISEASES
Oligodontia
SUMMARY

Oligodontia is a rare developmental dental anomaly in humans characterized by the absence of six or more teeth.

CLINICAL DESCRIPTION

Clinical features of oligodontia include six or more missing teeth, lack of development of maxillary and mandibular alveolar bone height and reduced lower facial height. Variation in tooth morphology is also observed along with problems in tooth development, eruption and exfoliation.

X-linked hypohidrotic ectodermal dysplasia
SUMMARY

0

CLINICAL DESCRIPTION

Hypohidrotic, or anhidrotic, ectodermal dysplasia (HED/EDA) is characterized by a triad of signs comprising sparse hair (hypotrichosis), abnormal or missing teeth (anodontia or hypodontia), and inability to sweat (anhidrosis or hypohidrosis). Typical clinical manifestations also include dryness of the skin, eyes, airways, and mucous membranes presumably due to the defective development of several exocrine glands. Hypohidrotic ectodermal dysplasia can be associated with dysmorphic features (forehead bumps, rings under the eyes, everted nose, and prominent lips) and occasionally with absent nipples. Ectodermal dysplasia-1, due to mutation in the EDA gene, is the most frequent form of hypohidrotic ectodermal dysplasia.

VARIANTS

NM_001399.4(EDA):c.1069C>T ; NM_001399.4(EDA):c.206G>T ; NM_001399.4(EDA):c.494G>C ; NM_001399.4(EDA):c.794A>G ; NM_001399.4(EDA):c.1067C>T ; NM_001399.4(EDA):c.1094T>C ; NM_001399.4(EDA):c.1100delCinsTCAAGATGG ; NM_001399.4(EDA):c.1123A>G ; NM_001399.4(EDA):c.1137C>A ; NM_001399.4(EDA):c.1144G>A ; NM_001399.5(EDA):c.161A>T ; NM_001399.4(EDA):c.164T>A ; NM_001399.4(EDA):c.181T>C ; NM_001399.4(EDA):c.477A>T ; NM_001399.4(EDA):c.526+5G>A ; NM_001399.4(EDA):c.526+5G>T ; NM_001399.4(EDA):c.607C>T ; NM_001399.4(EDA):c.612_629del18 ; NM_001399.4(EDA):c.617C>T ; NM_001399.4(EDA):c.646C>T ; NM_001399.4(EDA):c.659_676del18 ; NM_001399.4(EDA):c.764G>A ; NM_001399.4(EDA):c.769G>C ; NM_001399.4(EDA):c.822G>T ; NM_001399.4(EDA):c.827G>T ; NM_001399.4(EDA):c.865C>T ; NM_001399.4(EDA):c.866G>A ; NM_001399.4(EDA):c.895G>A ; NM_001399.4(EDA):c.902A>G ; NM_001399.4(EDA):c.911A>C ; NM_001399.4(EDA):c.917A>G ; NM_001399.4(EDA):c.923A>G ; NM_001399.4(EDA):c.931T>C ; NM_001399.4(EDA):c.932A>C ; NM_001399.5(EDA):c.956G>A ; NM_001399.4(EDA):c.998C>G ; NC_000023.11:g.70023216del ; NC_000023.11:g.70035428G>A ; NM_001399.4(EDA):c.1001G>A ; NM_001399.4(EDA):c.1013C>T ; NM_001399.4(EDA):c.1045G>A ; NM_001399.4(EDA):c.1072C>G ; NM_001399.4(EDA):c.1133C>T ; NM_001399.4(EDA):c.135_136insGGGT ; NM_001399.4(EDA):c.180C>A ; NM_001399.4(EDA):c.183C>G ; NM_001399.4(EDA):c.187G>A ; NM_001399.4(EDA):c.193C>G ; NM_001399.4(EDA):c.228_234delCCGCCTTinsAA ; NM_001399.4(EDA):c.239dup ; NM_001399.4(EDA):c.245delG ; NM_001005609.1:c.252delT ; NM_001399.4(EDA):c.272_273insG ; NM_001399.4(EDA):c.2T>C ; NM_001399.4(EDA):c.319_322dupGGGC ; NM_001399.4(EDA):c.329C>A ; NM_001399.4(EDA):c.347T>A ; NM_001399.4(EDA):c.390delG ; NM_001399.4(EDA):c.396+1G>A ; NM_001399.4(EDA):c.396+2T>C ; NM_001399.4(EDA):c.396+2T>G ; NM_001399.4(EDA):c.396+4dup ; NM_001399.4(EDA):c.457C>T ; NM_001399.4(EDA):c.459dup ; NM_001399.4(EDA):c.463C>T ; NM_001399.4(EDA):c.466C>T ; NM_001399.4(EDA):c.467G>A ; NM_001399.4(EDA):c.474A>C ; NM_001399.4(EDA):c.502+1G>A ; NM_001399.4(EDA):c.521_522delAAinsT ; NM_001399.4(EDA):c.527-2A>T ; NM_001399.4(EDA):c.546_581delTGGACCCAATGGCCCTCCAGGACCCCCAGGACCTCC ; NM_001399.4(EDA):c.553_588del ; NM_001399.4(EDA):c.560dup ; NM_001399.4(EDA):c.562_589del ; NM_001399.4(EDA):c.572_589delCAGGACCTCCAGGACCCC ; NM_001399.5(EDA):c.573_574insT ; NM_001399.4(EDA):c.593delG ; NM_001399.4(EDA):c.599dup ; NM_001399.4(EDA):c.628G>T ; NM_001399.4(EDA):c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC ; NM_001399.4(EDA):c.663_697delTCCTCCTGGTCCTCAAGGACCCCCTGGCCTCCAGG ; NM_001399.4(EDA):c.671G>C ; NM_001399.4(EDA):c.676C>T ; NM_001399.4(EDA):c.67C>T ; NM_001399.4(EDA):c.681_697delACCCCCTGGCCTCCAGG ; NM_001399.4(EDA):c.706+1G>A ; NM_001399.4(EDA):c.707-1G>A ; NM_001399.4(EDA):c.730C>T ; NM_001399.4(EDA):c.741G>A ; NM_001399.4(EDA):c.755A>T ; NM_001399.4(EDA):c.766C>T ; NM_001399.4(EDA):c.776C>A ; NM_001399.4(EDA):c.809delT ; NM_001399.4(EDA):c.822G>A ; NM_001399.4(EDA):c.822delG ; NM_001399.4(EDA):c.826C>T ; NM_001399.4(EDA):c.871G>A ; NM_001399.4(EDA):c.872G>A ; NM_001399.5(EDA):c.912_913dup ; NM_001399.4(EDA):c.922G>T ; NM_001399.4(EDA):c.948delC ; NM_001399.4(EDA):c.960T>G ; NM_001399.4(EDA):c.961G>T ; NM_001399.4(EDA):c.991C>T ; NC_000023.11:g.70027929del ; NC_000023.11:g.70028016dup ; NC_000023.11:g.70028041G>T

GENE

EDAR

DISEASES
Hypohidrotic ectodermal dysplasia
SUMMARY

Hypohidrotic ectodermal dysplasia (HED) is a genetic disorder of ectoderm development characterized by malformation of ectodermal structures such as skin, hair, teeth and sweat glands. It comprises three clinically almost indistinguishable subtypes with impaired sweating as the key symptom: Christ-Siemens-Touraine (CST) syndrome (X-linked), autosomal recessive (AR), and autosomal dominant (AD) HED, as well as a fourth rare subtype with immunodeficiency as the key symptom (HED with immunodeficiency)

CLINICAL DESCRIPTION

HED is characterized by a triad of signs comprising sparse hair (atrichosis/hypotrichosis), abnormal (e.g. conical) or missing teeth (anodontia/hypodontia), and decreased or absent sudation due to a lack of sweat glands (anhidrosis/hypohidrosis) which leads to heat intolerance and may cause recurrent, potentially life-threatening hyperthermic episodes. The skin is thin, dry and eczematous with regional hyperkeratosis. Most of the patients suffer from ''dry eye'' problems (e.g. chronic conjunctivitis, blepharitis), nasopharyngeal dryness and asthma-like symptoms. HED is associated with typical facial features such as a protruding forehead, sparse and fine eyebrows and eyelashes, wrinkles under the eyes, characteristic periorbital hyperpigmentation, a saddle-bridged nose, and hypoplasia of the mandible. Hair pigmentation is often absent or light. Failure to thrive may be observed. The AD and AR forms affect both sexes equally. In the X-linked form, female carriers can be asymptomatic or have a milder phenotype that may include oligodontia, conical incisors, hypotrichosis and moderate hypohidrosis.

VARIANTS

NM_022336.3(EDAR):c.1024+1G>A ; NM_022336.3(EDAR):c.1132G>A ; NM_022336.3(EDAR):c.1163T>C ; NM_022336.3(EDAR):c.1229A>G ; NM_022336.3(EDAR):c.1259G>A ; NM_022336.3(EDAR):c.1284T>A ; NM_022336.3(EDAR):c.1284T>G ; NM_022336.3(EDAR):c.175-2A>G ; NM_022336.3(EDAR):c.265C>T ; NM_022336.3(EDAR):c.292C>T ; NM_022336.3(EDAR):c.1060G>T ; NM_022336.3(EDAR):c.1072C>T ; NM_022336.3(EDAR):c.1073G>A ; NM_022336.3(EDAR):c.1089delG ; NM_022336.3(EDAR):c.1121G>A ; NM_022336.3(EDAR):c.1124G>A ; NM_022336.3(EDAR):c.1144G>A ; NM_022336.3(EDAR):c.1169dup ; NM_022336.3:c.1193_1194delTT ; NM_022336.3(EDAR):c.212G>A ; NM_022336.3(EDAR):c.266G>A ; NM_022336.3(EDAR):c.278G>C ; NM_022336.3:c.284delG ; NM_022336.3(EDAR):c.329A>C ; NM_022336.3(EDAR):c.442+1G>A ; NM_022336.3:c.479delC ; NM_022336.3(EDAR):c.51+1G>A ; NM_022336.4(EDAR):c.52-25_52-8del ; NM_022336.3(EDAR):c.529+1G>A ; c.719_722del ; NM_022336.3(EDAR):c.803+1G>A ; NM_022336.3(EDAR):c.883_889delCAGGGCTinsTGATGAGGAGCCCG ; NM_022336.3(EDAR):c.903C>A ; NM_022336.3(EDAR):c.931G>T

GENE

EIF2AK3

DISEASES
Wolcott-Rallison syndrome
SUMMARY

Wolcott-Rallison syndrome (WRS) is a very rare genetic disease, characterized by permanent neonatal diabetes mellitus (PNDM) with multiple epiphyseal dysplasia and other clinical manifestations, including recurrent episodes of acute liver failure.

CLINICAL DESCRIPTION

Diabetes occurs early, generally before six months of age, is permanent and insulin-dependent from the onset. Skeletal dysplasia generally manifests within the 1st or 2nd year of life, and is associated with short stature (dwarfism with short trunk). Deficient mineralization or dysplastic changes, affecting the long bones, pelvis and vertebrae, but usually not the skull, may be seen on radiography as early as diabetes onset. Hepatic dysfunction is a 3rd characteristic feature and the most life-threatening complication, and manifests by elevated hepatic enzymes, liver enlargement and recurrent acute liver failure. Other manifestations vary between patients in type and severity and include renal dysfunction, exocrine pancreas insufficiency, intellectual deficit, hypothyroidism, neutropenia and recurrent infections. Clinical course is variable, including within the same sibship.

VARIANTS

NM_004836.6(EIF2AK3):c.1763G>A ; NM_004836.6(EIF2AK3):c.994G>T

GENE

EMD

DISEASES
X-linked Emery-Dreifuss muscular dystrophy
SUMMARY

A neuromuscular disease that is characterized by muscular weakness and atrophy, with early joint contractures and cardiomyopathy.

CLINICAL DESCRIPTION

The clinical triad is comprised of joint contractures of the Achilles, elbow and posterior neck tendons (beginning during early childhood and worsening to result in limited joint movement). It presents slowly progressive muscle weakness and atrophy (initially and generally with a humeroperoneal distribution but later becoming more diffuse). Cardiac anomalies (conduction defects, rhythm disturbances and dilated cardiomyopathy) that usually manifest at the turn of the 2nd to the 3rd decade of life and may lead to sudden death (sometimes the presenting feature of the disease) and ischemic accidents due to embolism. Disease course and severity vary between families and between patients from the same family.

VARIANTS

NM_000117.2(EMD):c.450-2A>G ; NM_000117.2(EMD):c.470G>A ; NM_000117.2(EMD):c.82G>A ; NM_000117.2(EMD):c.83-2A>G ; NM_000117.2(EMD):c.16delG ; NM_000117.2(EMD):c.284_298delATGAAGAGAGCTACT ; NM_000117.2(EMD):c.600G>A ; NM_000117.2(EMD):c.60delC ; NM_000117.2(EMD):c.640_644dup ; NM_000117.2(EMD):c.703_704insA ; NM_000117.2(EMD):c.101dup ; c.102C>G ; NM_000117.2(EMD):c.103G>T ; NM_000117.2(EMD):c.116_143del ; NM_000117.2(EMD):c.121_155del35 ; NM_000117.2(EMD):c.123C>A ; c.123C>G ; NM_000117.2(EMD):c.12C>G ; NM_000117.2(EMD):c.130C>T ; NM_000117.2(EMD):c.135dup ; NM_000117.2(EMD):c.153dupC ; NM_000117.2:c.153dupC ; NM_000117.2(EMD):c.184dup ; NM_000117.2(EMD):c.187+1G>T ; NM_000117.2:c.187.1G-A ; NM_000117.2(EMD):c.1A>G ; NM_000117.2(EMD):c.217_218dup ; NM_000117.2:c.239_240delAG ; NM_000117.2(EMD):c.239_240insT ; NM_000117.2(EMD):c.251_255delTCTAC ; NM_000117.2:c.256C-T ; NM_000117.2(EMD):c.266-2A>G ; NM_000117.2:c.2T-G ; NM_000117.2:c.314_315delAT ; c.315T>G ; NM_000117.2:c.325G-T ; NM_000117.2(EMD):c.355C>T ; NM_000117.2:c.359_362delCAGT ; NM_000117.2(EMD):c.3G>A ; NM_000117.2(EMD):c.419T>A ; NM_000117.2(EMD):c.430G>T ; NM_000117.2:c.441C-A ; NM_000117.2(EMD):c.468_471del ; NM_000117.2(EMD):c.484C>T ; NM_000117.2(EMD):c.512C>A ; NM_000117.2(EMD):c.547C>A ; NM_000117.2(EMD):c.548C>A ; NM_000117.2(EMD):c.581_582delCA ; NM_000117.2(EMD):c.607delC ; c.617_620del ; NM_000117.2(EMD):c.621delG ; NM_000117.2:c.631_635delCGTGC ; NM_000117.2(EMD):c.650_654dupTGGGC ; NM_000117.2(EMD):c.674_678delTCTGG ; c.677G>A ; NM_000117.2(EMD):c.82+1G>T

GENE

ERCC2

DISEASES
COFS syndrome
SUMMARY

Cerebrooculofacioskeletal (COFS) syndrome is a rare genetic disorder, belonging to a family of diseases of DNA repair, characterized by a severe sensorineural involvement.

CLINICAL DESCRIPTION

COFS syndrome constitutes the prenatal extreme form of Cockayne syndrome (see this term). Clinically, the following criteria are found: congenital microcephaly, congenital cataract and/or microphthalmia, arthrogryposis, severe psychomotor developmental delay, height-weight growth delay (principally postnatal) and facial dysmorphism (prominent metopic suture, micrognathism). The axial hypotonia contrasts with the peripheral hypertonia and is associated with feeding difficulties. Cutaneous photosensitivity, peripheral neuropathy, sensorineural hearing loss and pigmentary retinopathy can be observed.

Trichothiodystrophy
SUMMARY

Trichothiodystrophy or TTD is a heterogeneous group disorders characterized by short, brittle hair with low-sulphur content (due to an abnormal synthesis of the sulphur containing keratins).

CLINICAL DESCRIPTION

Within the spectrum of the TTD syndromes are numerous syndromes affecting mainly organs derived from the neuroectoderm. The clinical appearance is always characterized by brittle and fragile hair, often combined with growth retardation and intellectual deficit, congenital ichthyosis and nail abnormalities, among other symptoms. The abnormalities are usually obvious at birth, with variable clinical expression. The variants of TTD, depending on their different associations, are: BIDS syndrome (or TTD type D or Amish Brittle Hair syndrome), IBIDS syndrome (or Tay syndrome or TTD typeE), PIBIDS syndrome (or TTD type F), Sabinas syndrome (TTD type B), SIBIDS syndrome, ONMRS (Itin syndrome) and Pollitt syndrome (TTD type C).

Xeroderma pigmentosum
SUMMARY

Xeroderma pigmentosum (XP) is a rare genodermatosis characterized by extreme sensitivity to ultraviolet (UV)-induced changes in the skin and eyes, and multiple skin cancers. It is subdivided into 8 complementation groups, according to the affected gene: classical XP (XPA to XPG) and XP variant (XPV) (see these terms).

CLINICAL DESCRIPTION

The severity of the clinical manifestations and the age of onset are extremely variable and are in part dependent on exposure to sunlight and the complementation group. Approximately 50% of affected individuals have acute sun sensitivity from the first few months of life, presenting with severe sunburn and/or persistent erythema which takes weeks to resolve. Others do not show any sunburn reaction and gradually develop marked freckling at sun exposed sites. Individuals have dry skin and hypo- or hyperpigmented lesions. There is a greater than 10,000-fold increased risk of non-melanoma skin cancers, and a 2,000 fold increased risk of melanoma under the age of 20 when compared to the general population. Patients with classical XP develop skin cancer generally before the age of 20, while patients with XP variant start to develop skin cancer at about 20-30 years of age. Ocular abnormalities include keratitis resulting in corneal opacification and vascularization. Photophobia is common. Ocular squamous cell carcinoma and melanoma are common. Neurologic abnormalities of varying severity have been reported in about 30% of cases. These include acquired microcephaly, diminished or absent deep tendon stretch reflexes, progressive sensorineural hearing loss, spasticity, ataxia, seizures and progressive cognitive impairment. De Sanctis-Cacchione syndrome is a term that was originally attributed to XP cases with severe neurological abnormalities but it is no longer in general use.

Xeroderma pigmentosum-Cockayne syndrome complex
SUMMARY

Xeroderma pigmentosum/Cockayne syndrome complex (XP/CS complex) is characterized by the cutaneous features of xeroderma pigmentosum (XP) (see this term) together with the systemic and neurological features of Cockayne syndrome (CS; see this term).

CLINICAL DESCRIPTION

The disease manifests during infancy. Patients present with cutaneous UV-sensitive lesions that generally develop into skin cancer, and also develop characteristic CS manifestations such as microcephaly, hydrocephalus, cachexia, premature aging, dwarfism, skin atrophy, arteriosclerosis, progressive hearing loss, cognitive deficit, spasticity, ataxia, pigmentary retinopathy and optic atrophy. In contrast to the neurological abnormalities of XP which are predominantly secondary to neuronal degeneration, in XP/CS complex, dysmyelination typical of CS is observed.

VARIANTS

NM_000400.3(ERCC2):c.1703_1704delTT ; NM_000400.3(ERCC2):c.2047C>T ; c.1308-1G>A ; c.1354C>T ; NM_000400.3(ERCC2):c.1381C>G ; NM_000400.3(ERCC2):c.1454T>C ; NM_000400.3(ERCC2):c.1621A>C ; NM_000400.3:c.567G-A ; c.719-1G>A ; c.949+1G>A ; c.950-2A>G ; NM_000400.3(ERCC2):c.1972C>T ; NM_000400.3(ERCC2):c.2176C>T ; NM_000400.3:c.2230_2233dupCTAG

GENE

ERCC3

DISEASES
Trichothiodystrophy
SUMMARY

Trichothiodystrophy or TTD is a heterogeneous group disorders characterized by short, brittle hair with low-sulphur content (due to an abnormal synthesis of the sulphur containing keratins).

CLINICAL DESCRIPTION

Within the spectrum of the TTD syndromes are numerous syndromes affecting mainly organs derived from the neuroectoderm. The clinical appearance is always characterized by brittle and fragile hair, often combined with growth retardation and intellectual deficit, congenital ichthyosis and nail abnormalities, among other symptoms. The abnormalities are usually obvious at birth, with variable clinical expression. The variants of TTD, depending on their different associations, are: BIDS syndrome (or TTD type D or Amish Brittle Hair syndrome), IBIDS syndrome (or Tay syndrome or TTD typeE), PIBIDS syndrome (or TTD type F), Sabinas syndrome (TTD type B), SIBIDS syndrome, ONMRS (Itin syndrome) and Pollitt syndrome (TTD type C).

Xeroderma pigmentosum
SUMMARY

Xeroderma pigmentosum (XP) is a rare genodermatosis characterized by extreme sensitivity to ultraviolet (UV)-induced changes in the skin and eyes, and multiple skin cancers. It is subdivided into 8 complementation groups, according to the affected gene: classical XP (XPA to XPG) and XP variant (XPV) (see these terms).

CLINICAL DESCRIPTION

The severity of the clinical manifestations and the age of onset are extremely variable and are in part dependent on exposure to sunlight and the complementation group. Approximately 50% of affected individuals have acute sun sensitivity from the first few months of life, presenting with severe sunburn and/or persistent erythema which takes weeks to resolve. Others do not show any sunburn reaction and gradually develop marked freckling at sun exposed sites. Individuals have dry skin and hypo- or hyperpigmented lesions. There is a greater than 10,000-fold increased risk of non-melanoma skin cancers, and a 2,000 fold increased risk of melanoma under the age of 20 when compared to the general population. Patients with classical XP develop skin cancer generally before the age of 20, while patients with XP variant start to develop skin cancer at about 20-30 years of age. Ocular abnormalities include keratitis resulting in corneal opacification and vascularization. Photophobia is common. Ocular squamous cell carcinoma and melanoma are common. Neurologic abnormalities of varying severity have been reported in about 30% of cases. These include acquired microcephaly, diminished or absent deep tendon stretch reflexes, progressive sensorineural hearing loss, spasticity, ataxia, seizures and progressive cognitive impairment. De Sanctis-Cacchione syndrome is a term that was originally attributed to XP cases with severe neurological abnormalities but it is no longer in general use.

Xeroderma pigmentosum-Cockayne syndrome complex
SUMMARY

Xeroderma pigmentosum/Cockayne syndrome complex (XP/CS complex) is characterized by the cutaneous features of xeroderma pigmentosum (XP) (see this term) together with the systemic and neurological features of Cockayne syndrome (CS; see this term).

CLINICAL DESCRIPTION

The disease manifests during infancy. Patients present with cutaneous UV-sensitive lesions that generally develop into skin cancer, and also develop characteristic CS manifestations such as microcephaly, hydrocephalus, cachexia, premature aging, dwarfism, skin atrophy, arteriosclerosis, progressive hearing loss, cognitive deficit, spasticity, ataxia, pigmentary retinopathy and optic atrophy. In contrast to the neurological abnormalities of XP which are predominantly secondary to neuronal degeneration, in XP/CS complex, dysmyelination typical of CS is observed.

VARIANTS

NM_000122.1(ERCC3):c.1273C>T ; NM_000122.1(ERCC3):c.1633C>T ; c.1757del ; NM_000122.1:c.1858delG ; NM_000122.1(ERCC3):c.296T>C

GENE

ERCC4

DISEASES
Cockayne syndrome type 1
SUMMARY

Cockayne syndrome (CS) is a multisystem condition characterized by short stature, a characteristic facial appearance, premature aging, photosensitivity, progressive neurological dysfunction, and intellectual deficit.

CLINICAL DESCRIPTION

Disease severity and the age of onset are variable. In classical type I CS, the first symptoms usually appear during the first year of life. Early-onset cases with more severe symptoms (type II) and late-onset cases with milder symptoms (type III) have also been described. Common signs of the disease include progressive growth failure, intellectual deficit, cerebellar ataxia, spasticity, peripheral demyelinating neuropathy, pigmentary retinopathy, sensorineural hearing loss and dental anomalies (presence of caries). The typical facial appearance includes microcephaly, large ears, a thin nose, and enophthalmia. Cataracts and cutaneous photosensitivity are observed in some patients. Subcutaneous lipoatrophy is present and can lead to signs of premature aging of the skin. COFS syndrome (see this term) is the extreme prenatal form of the CS clinical spectrum characterized by congenital microphthalmia and arthrogryposis.

Fanconi anemia
SUMMARY

A rare genetic multisystem disorder characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors.

CLINICAL DESCRIPTION

The first signs of Fanconi anemia (FA) are typically non-hematological features. Limb anomalies typically affect the extremities, are unilateral or (usually asymmetric) bilateral. Minor anomalies can also be present such as low birth length and weight, microcephaly and/or microphthalmia. Skin pigmentation abnormalities (café-au-lait spots) and hypoplastic thenar eminence are frequent. Almost 20% of patients have ear malformations with or without hearing loss. Congenital malformations may involve other organ systems and vary within families. Short stature is syndromic and/or associated to endocrinopathies. Fertility is frequently impaired in males, and is highly disturbed in half of females. When congenital malformations are not prominent, diagnosis may be delayed until the onset of hematological anomalies. Bone marrow failure (BMF) occurs at a median age of 7 years, developing in 90% of patients by 40 years of age. The first manifestations are macrocytosis (very early) and thrombocytopenia. In patients with somatic mosaïcism, blood counts may stay normal until occurrence of hematological malignancy. In general, patients are highly predisposed to solid tumors (most frequently head and neck or anogenital regions).

Xeroderma pigmentosum
SUMMARY

Xeroderma pigmentosum (XP) is a rare genodermatosis characterized by extreme sensitivity to ultraviolet (UV)-induced changes in the skin and eyes, and multiple skin cancers. It is subdivided into 8 complementation groups, according to the affected gene: classical XP (XPA to XPG) and XP variant (XPV) (see these terms).

CLINICAL DESCRIPTION

The severity of the clinical manifestations and the age of onset are extremely variable and are in part dependent on exposure to sunlight and the complementation group. Approximately 50% of affected individuals have acute sun sensitivity from the first few months of life, presenting with severe sunburn and/or persistent erythema which takes weeks to resolve. Others do not show any sunburn reaction and gradually develop marked freckling at sun exposed sites. Individuals have dry skin and hypo- or hyperpigmented lesions. There is a greater than 10,000-fold increased risk of non-melanoma skin cancers, and a 2,000 fold increased risk of melanoma under the age of 20 when compared to the general population. Patients with classical XP develop skin cancer generally before the age of 20, while patients with XP variant start to develop skin cancer at about 20-30 years of age. Ocular abnormalities include keratitis resulting in corneal opacification and vascularization. Photophobia is common. Ocular squamous cell carcinoma and melanoma are common. Neurologic abnormalities of varying severity have been reported in about 30% of cases. These include acquired microcephaly, diminished or absent deep tendon stretch reflexes, progressive sensorineural hearing loss, spasticity, ataxia, seizures and progressive cognitive impairment. De Sanctis-Cacchione syndrome is a term that was originally attributed to XP cases with severe neurological abnormalities but it is no longer in general use.

Xeroderma pigmentosum-Cockayne syndrome complex
SUMMARY

Xeroderma pigmentosum/Cockayne syndrome complex (XP/CS complex) is characterized by the cutaneous features of xeroderma pigmentosum (XP) (see this term) together with the systemic and neurological features of Cockayne syndrome (CS; see this term).

CLINICAL DESCRIPTION

The disease manifests during infancy. Patients present with cutaneous UV-sensitive lesions that generally develop into skin cancer, and also develop characteristic CS manifestations such as microcephaly, hydrocephalus, cachexia, premature aging, dwarfism, skin atrophy, arteriosclerosis, progressive hearing loss, cognitive deficit, spasticity, ataxia, pigmentary retinopathy and optic atrophy. In contrast to the neurological abnormalities of XP which are predominantly secondary to neuronal degeneration, in XP/CS complex, dysmyelination typical of CS is observed.

VARIANTS

NM_005236.2(ERCC4):c.2395C>T ; c.1467dup ; c.2281_2284del ; NM_005236.2:c.2T-C ; NM_005236.2:c.49G-T ; NM_005236.2:c.538_539delAG ; NM_005236.2(ERCC4):c.706T>C

GENE

ERCC5

DISEASES
COFS syndrome
SUMMARY

Cerebrooculofacioskeletal (COFS) syndrome is a rare genetic disorder, belonging to a family of diseases of DNA repair, characterized by a severe sensorineural involvement.

CLINICAL DESCRIPTION

COFS syndrome constitutes the prenatal extreme form of Cockayne syndrome (see this term). Clinically, the following criteria are found: congenital microcephaly, congenital cataract and/or microphthalmia, arthrogryposis, severe psychomotor developmental delay, height-weight growth delay (principally postnatal) and facial dysmorphism (prominent metopic suture, micrognathism). The axial hypotonia contrasts with the peripheral hypertonia and is associated with feeding difficulties. Cutaneous photosensitivity, peripheral neuropathy, sensorineural hearing loss and pigmentary retinopathy can be observed.

Xeroderma pigmentosum
SUMMARY

Xeroderma pigmentosum (XP) is a rare genodermatosis characterized by extreme sensitivity to ultraviolet (UV)-induced changes in the skin and eyes, and multiple skin cancers. It is subdivided into 8 complementation groups, according to the affected gene: classical XP (XPA to XPG) and XP variant (XPV) (see these terms).

CLINICAL DESCRIPTION

The severity of the clinical manifestations and the age of onset are extremely variable and are in part dependent on exposure to sunlight and the complementation group. Approximately 50% of affected individuals have acute sun sensitivity from the first few months of life, presenting with severe sunburn and/or persistent erythema which takes weeks to resolve. Others do not show any sunburn reaction and gradually develop marked freckling at sun exposed sites. Individuals have dry skin and hypo- or hyperpigmented lesions. There is a greater than 10,000-fold increased risk of non-melanoma skin cancers, and a 2,000 fold increased risk of melanoma under the age of 20 when compared to the general population. Patients with classical XP develop skin cancer generally before the age of 20, while patients with XP variant start to develop skin cancer at about 20-30 years of age. Ocular abnormalities include keratitis resulting in corneal opacification and vascularization. Photophobia is common. Ocular squamous cell carcinoma and melanoma are common. Neurologic abnormalities of varying severity have been reported in about 30% of cases. These include acquired microcephaly, diminished or absent deep tendon stretch reflexes, progressive sensorineural hearing loss, spasticity, ataxia, seizures and progressive cognitive impairment. De Sanctis-Cacchione syndrome is a term that was originally attributed to XP cases with severe neurological abnormalities but it is no longer in general use.

Xeroderma pigmentosum-Cockayne syndrome complex
SUMMARY

Xeroderma pigmentosum/Cockayne syndrome complex (XP/CS complex) is characterized by the cutaneous features of xeroderma pigmentosum (XP) (see this term) together with the systemic and neurological features of Cockayne syndrome (CS; see this term).

CLINICAL DESCRIPTION

The disease manifests during infancy. Patients present with cutaneous UV-sensitive lesions that generally develop into skin cancer, and also develop characteristic CS manifestations such as microcephaly, hydrocephalus, cachexia, premature aging, dwarfism, skin atrophy, arteriosclerosis, progressive hearing loss, cognitive deficit, spasticity, ataxia, pigmentary retinopathy and optic atrophy. In contrast to the neurological abnormalities of XP which are predominantly secondary to neuronal degeneration, in XP/CS complex, dysmyelination typical of CS is observed.

VARIANTS

NM_000123.3:c.2144dupA ; NM_000123.3(ERCC5):c.215C>A ; NM_000123.3(ERCC5):c.2573T>C ; NM_000123.3(ERCC5):c.2751del ; c.381-2A>G ; NM_000123.3(ERCC5):c.406C>T ; NM_000123.3:c.463_464insA ; NM_000123.3(ERCC5):c.526C>T ; NM_000123.3(ERCC5):c.787C>T ; c.88+2T>C

GENE

ERCC6

DISEASES
Cockayne syndrome type 1
SUMMARY

Cockayne syndrome (CS) is a multisystem condition characterized by short stature, a characteristic facial appearance, premature aging, photosensitivity, progressive neurological dysfunction, and intellectual deficit.

CLINICAL DESCRIPTION

Disease severity and the age of onset are variable. In classical type I CS, the first symptoms usually appear during the first year of life. Early-onset cases with more severe symptoms (type II) and late-onset cases with milder symptoms (type III) have also been described. Common signs of the disease include progressive growth failure, intellectual deficit, cerebellar ataxia, spasticity, peripheral demyelinating neuropathy, pigmentary retinopathy, sensorineural hearing loss and dental anomalies (presence of caries). The typical facial appearance includes microcephaly, large ears, a thin nose, and enophthalmia. Cataracts and cutaneous photosensitivity are observed in some patients. Subcutaneous lipoatrophy is present and can lead to signs of premature aging of the skin. COFS syndrome (see this term) is the extreme prenatal form of the CS clinical spectrum characterized by congenital microphthalmia and arthrogryposis.

Cockayne syndrome type 2
SUMMARY

Cockayne syndrome (CS) is a multisystem condition characterized by short stature, a characteristic facial appearance, premature aging, photosensitivity, progressive neurological dysfunction, and intellectual deficit.

CLINICAL DESCRIPTION

Disease severity and the age of onset are variable. In classical type I CS, the first symptoms usually appear during the first year of life. Early-onset cases with more severe symptoms (type II) and late-onset cases with milder symptoms (type III) have also been described. Common signs of the disease include progressive growth failure, intellectual deficit, cerebellar ataxia, spasticity, peripheral demyelinating neuropathy, pigmentary retinopathy, sensorineural hearing loss and dental anomalies (presence of caries). The typical facial appearance includes microcephaly, large ears, a thin nose, and enophthalmia. Cataracts and cutaneous photosensitivity are observed in some patients. Subcutaneous lipoatrophy is present and can lead to signs of premature aging of the skin. COFS syndrome (see this term) is the extreme prenatal form of the CS clinical spectrum characterized by congenital microphthalmia and arthrogryposis.

Cockayne syndrome type 3
SUMMARY

Cockayne syndrome (CS) is a multisystem condition characterized by short stature, a characteristic facial appearance, premature aging, photosensitivity, progressive neurological dysfunction, and intellectual deficit.

CLINICAL DESCRIPTION

Disease severity and the age of onset are variable. In classical type I CS, the first symptoms usually appear during the first year of life. Early-onset cases with more severe symptoms (type II) and late-onset cases with milder symptoms (type III) have also been described. Common signs of the disease include progressive growth failure, intellectual deficit, cerebellar ataxia, spasticity, peripheral demyelinating neuropathy, pigmentary retinopathy, sensorineural hearing loss and dental anomalies (presence of caries). The typical facial appearance includes microcephaly, large ears, a thin nose, and enophthalmia. Cataracts and cutaneous photosensitivity are observed in some patients. Subcutaneous lipoatrophy is present and can lead to signs of premature aging of the skin. COFS syndrome (see this term) is the extreme prenatal form of the CS clinical spectrum characterized by congenital microphthalmia and arthrogryposis.

COFS syndrome
SUMMARY

Cerebrooculofacioskeletal (COFS) syndrome is a rare genetic disorder, belonging to a family of diseases of DNA repair, characterized by a severe sensorineural involvement.

CLINICAL DESCRIPTION

COFS syndrome constitutes the prenatal extreme form of Cockayne syndrome (see this term). Clinically, the following criteria are found: congenital microcephaly, congenital cataract and/or microphthalmia, arthrogryposis, severe psychomotor developmental delay, height-weight growth delay (principally postnatal) and facial dysmorphism (prominent metopic suture, micrognathism). The axial hypotonia contrasts with the peripheral hypertonia and is associated with feeding difficulties. Cutaneous photosensitivity, peripheral neuropathy, sensorineural hearing loss and pigmentary retinopathy can be observed.

NON RARE IN EUROPE: Primary ovarian failure
SUMMARY

Premature ovarian failure is a heterogeneous disorder. The terms 'hypergonadotropic ovarian failure' and 'hypergonadotropic ovarian dysgenesis' have been used to indicate a group of disorders in which amenorrhea associated with elevated levels of serum gonadotropins occurs long before the age of 40 years.

CLINICAL DESCRIPTION

Premature ovarian failure-11 (POF11) is characterized by secondary amenorrhea and hypergonadotropic ovarian insufficiency, with elevated serum follicle-stimulating hormone (FSH) levels before age 40 years.

UV-sensitive syndrome
SUMMARY

A rare photodermatosis characterized by cutaneous photosensitivity and slight dyspigmentation, without an increased risk of developing skin tumors. Telangiectasia may also be observed, but no other clinical abnormalities. Patients present in infancy or childhood, mode of inheritance is autosomal recessive.

CLINICAL DESCRIPTION

UV-sensitive syndrome-1 is an autosomal recessive disorder characterized by cutaneous photosensitivity and mild freckling, without an increased risk of skin tumors. Patient cells show impaired recovery of RNA synthesis (RRS) after UV irradiation due to defective preferential repair of DNA damage in actively transcribing genes, although unscheduled DNA repair is normal. The cellular findings are consistent with a defect in transcription-coupled nucleotide excision repair (TC-NER) of UV damage.

VARIANTS

NM_000124.3(ERCC6):c.2047C>T ; NM_000124.3(ERCC6):c.207dup ; NM_000124.3(ERCC6):c.3591_3592dup ; NM_000124.3(ERCC6):c.422+1G>A ; NM_000124.3(ERCC6):c.1357C>T ; NM_000124.3(ERCC6):c.1550G>A ; NM_000124.3(ERCC6):c.2203C>T ; c.2587C>T ; NM_000124.3(ERCC6):c.3862C>T ; NM_000124.3:c.48_49delCT

GENE

ERCC8

DISEASES
Cockayne syndrome type 1
SUMMARY

Cockayne syndrome (CS) is a multisystem condition characterized by short stature, a characteristic facial appearance, premature aging, photosensitivity, progressive neurological dysfunction, and intellectual deficit.

CLINICAL DESCRIPTION

Disease severity and the age of onset are variable. In classical type I CS, the first symptoms usually appear during the first year of life. Early-onset cases with more severe symptoms (type II) and late-onset cases with milder symptoms (type III) have also been described. Common signs of the disease include progressive growth failure, intellectual deficit, cerebellar ataxia, spasticity, peripheral demyelinating neuropathy, pigmentary retinopathy, sensorineural hearing loss and dental anomalies (presence of caries). The typical facial appearance includes microcephaly, large ears, a thin nose, and enophthalmia. Cataracts and cutaneous photosensitivity are observed in some patients. Subcutaneous lipoatrophy is present and can lead to signs of premature aging of the skin. COFS syndrome (see this term) is the extreme prenatal form of the CS clinical spectrum characterized by congenital microphthalmia and arthrogryposis.

Cockayne syndrome type 2
SUMMARY

Cockayne syndrome (CS) is a multisystem condition characterized by short stature, a characteristic facial appearance, premature aging, photosensitivity, progressive neurological dysfunction, and intellectual deficit.

CLINICAL DESCRIPTION

Disease severity and the age of onset are variable. In classical type I CS, the first symptoms usually appear during the first year of life. Early-onset cases with more severe symptoms (type II) and late-onset cases with milder symptoms (type III) have also been described. Common signs of the disease include progressive growth failure, intellectual deficit, cerebellar ataxia, spasticity, peripheral demyelinating neuropathy, pigmentary retinopathy, sensorineural hearing loss and dental anomalies (presence of caries). The typical facial appearance includes microcephaly, large ears, a thin nose, and enophthalmia. Cataracts and cutaneous photosensitivity are observed in some patients. Subcutaneous lipoatrophy is present and can lead to signs of premature aging of the skin. COFS syndrome (see this term) is the extreme prenatal form of the CS clinical spectrum characterized by congenital microphthalmia and arthrogryposis.

Cockayne syndrome type 3
SUMMARY

Cockayne syndrome (CS) is a multisystem condition characterized by short stature, a characteristic facial appearance, premature aging, photosensitivity, progressive neurological dysfunction, and intellectual deficit.

CLINICAL DESCRIPTION

Disease severity and the age of onset are variable. In classical type I CS, the first symptoms usually appear during the first year of life. Early-onset cases with more severe symptoms (type II) and late-onset cases with milder symptoms (type III) have also been described. Common signs of the disease include progressive growth failure, intellectual deficit, cerebellar ataxia, spasticity, peripheral demyelinating neuropathy, pigmentary retinopathy, sensorineural hearing loss and dental anomalies (presence of caries). The typical facial appearance includes microcephaly, large ears, a thin nose, and enophthalmia. Cataracts and cutaneous photosensitivity are observed in some patients. Subcutaneous lipoatrophy is present and can lead to signs of premature aging of the skin. COFS syndrome (see this term) is the extreme prenatal form of the CS clinical spectrum characterized by congenital microphthalmia and arthrogryposis.

UV-sensitive syndrome
SUMMARY

A rare photodermatosis characterized by cutaneous photosensitivity and slight dyspigmentation, without an increased risk of developing skin tumors. Telangiectasia may also be observed, but no other clinical abnormalities. Patients present in infancy or childhood, mode of inheritance is autosomal recessive.

CLINICAL DESCRIPTION

UV-sensitive syndrome-1 is an autosomal recessive disorder characterized by cutaneous photosensitivity and mild freckling, without an increased risk of skin tumors. Patient cells show impaired recovery of RNA synthesis (RRS) after UV irradiation due to defective preferential repair of DNA damage in actively transcribing genes, although unscheduled DNA repair is normal. The cellular findings are consistent with a defect in transcription-coupled nucleotide excision repair (TC-NER) of UV damage.

VARIANTS

NM_000082.3(ERCC8):c.37G>T ; c.593_594dup ; NM_000082.3(ERCC8):c.618-1G>A ; NM_000082.3:c.966C>A

GENE

ESCO2

DISEASES
Roberts syndrome
SUMMARY

Roberts syndrome (RBS) is characterized by pre- and postnatal growth retardation, severe symmetric limb reduction defects, craniofacial anomalies and severe intellectual deficit. SC phocomelia is a milder form of RBS.

CLINICAL DESCRIPTION

Upper limbs are more frequently and severely affected than lower limbs. The defect is mostly mesomelic with the radius being the most affected in the upper limbs, and the fibula in the lower limbs. The most severe defects result in phocomelia. Aplastic or hypoplastic thumbs, oligodactyly, clinodactyly or syndactyly can also occur. Craniofacial anomalies include microcephaly (more severe in males than in females), hypoplastic nasal alae, malar hypoplasia, hypertelorism, micrognathia, capillary hemangioma, exophthalmos, downslanting palpebral fissures, dysplastic or small ears, cloudy cornea or cataracts, and cleft lip and palate. There is a correlation between the degree of limb and facial malformations. Other malformations such as congenital heart defects, cystic kidney and large genitalia (enlarged phallus or clitoris), may occur. Severe intellectual deficit is observed in patients surviving the newborn period.

VARIANTS

NM_001017420.2(ESCO2):c.1269G>A ; NM_001017420.3(ESCO2):c.1597dup ; NM_001017420.2(ESCO2):c.1615T>G ; NM_001017420.2:c.294_297delGAGA ; NM_001017420.2(ESCO2):c.308_309delAA ; NM_001017420.2(ESCO2):c.505C>T ; NM_001017420.2(ESCO2):c.604C>T ; NM_001017420.2(ESCO2):c.875_878delACAG ; NM_001017420.2(ESCO2):c.879_880delAG

GENE

ETFA

DISEASES
Multiple acyl-CoA dehydrogenase deficiency, mild type
SUMMARY

Multiple acyl-CoA dehydrogenation deficiency (MADD) is a disorder of fatty acid and amino acid oxidation and is a clinically heterogeneous disorder ranging from a severe neonatal presentation with metabolic acidosis, cardiomyopathy and liver disease, to a mild childhood/adult disease with episodic metabolic decompensation, muscle weakness, and respiratory failure.

CLINICAL DESCRIPTION

Patients with MADD fall into 3 broad clinical phenotypes: 1) neonatal onset with congenital anomalies, 2) neonatal onset without anomalies, (together called MADD-severe (S); see this term) and 3) mild and/or late onset (MADD-mild (M); see this term). The first group of MADD-S patients are often premature presenting with severe non-ketotic hypoglycemia, hypotonia, hepatomegaly and severe metabolic acidosis within the first 24 hours of life. They usually have dysplastic kidneys with multiple cysts and may also have facial dysmorphism (low-set ears, high forehead, hypertelorism and hypoplastic midface), rocker-bottom feet and anomalies of external genitalia. Death usually occurs within the first week of life. The second group of patients usually present within the first 24-48 hours of life with hypotonia, tachypnea, hepatomegaly, metabolic acidosis and hypoketotic hypoglycemia. Most die during the first week(s) of life but some have survived for several months, usually dying with severe cardiomyopathy. MADD-M patients show a broad clinical spectrum of disease ranging from onset of intermittent episodes of vomiting, metabolic acidosis and hypoketotic hypoglycaemia (+/- cardiac involvement) during the first few months of life to adolescent/adult presentation with acute Reye-like illness with ketoacidosis and lipid storage myopathy. The latter subgroup often responds to pharmacological doses of riboflavin (rr-MADD).

Multiple acyl-CoA dehydrogenase deficiency, severe neonatal type
SUMMARY

Multiple acyl-CoA dehydrogenation deficiency (MADD) is a disorder of fatty acid and amino acid oxidation and is a clinically heterogeneous disorder ranging from a severe neonatal presentation with metabolic acidosis, cardiomyopathy and liver disease, to a mild childhood/adult disease with episodic metabolic decompensation, muscle weakness, and respiratory failure.

CLINICAL DESCRIPTION

Patients with MADD fall into 3 broad clinical phenotypes: 1) neonatal onset with congenital anomalies, 2) neonatal onset without anomalies, (together called MADD-severe (S); see this term) and 3) mild and/or late onset (MADD-mild (M); see this term). The first group of MADD-S patients are often premature presenting with severe non-ketotic hypoglycemia, hypotonia, hepatomegaly and severe metabolic acidosis within the first 24 hours of life. They usually have dysplastic kidneys with multiple cysts and may also have facial dysmorphism (low-set ears, high forehead, hypertelorism and hypoplastic midface), rocker-bottom feet and anomalies of external genitalia. Death usually occurs within the first week of life. The second group of patients usually present within the first 24-48 hours of life with hypotonia, tachypnea, hepatomegaly, metabolic acidosis and hypoketotic hypoglycemia. Most die during the first week(s) of life but some have survived for several months, usually dying with severe cardiomyopathy. MADD-M patients show a broad clinical spectrum of disease ranging from onset of intermittent episodes of vomiting, metabolic acidosis and hypoketotic hypoglycaemia (+/- cardiac involvement) during the first few months of life to adolescent/adult presentation with acute Reye-like illness with ketoacidosis and lipid storage myopathy. The latter subgroup often responds to pharmacological doses of riboflavin (rr-MADD).

VARIANTS

NM_000126.3(ETFA):c.470T>G ; NM_000126.3(ETFA):c.797C>T

GENE

ETFB

DISEASES
Multiple acyl-CoA dehydrogenase deficiency, mild type
SUMMARY

Multiple acyl-CoA dehydrogenation deficiency (MADD) is a disorder of fatty acid and amino acid oxidation and is a clinically heterogeneous disorder ranging from a severe neonatal presentation with metabolic acidosis, cardiomyopathy and liver disease, to a mild childhood/adult disease with episodic metabolic decompensation, muscle weakness, and respiratory failure.

CLINICAL DESCRIPTION

Patients with MADD fall into 3 broad clinical phenotypes: 1) neonatal onset with congenital anomalies, 2) neonatal onset without anomalies, (together called MADD-severe (S); see this term) and 3) mild and/or late onset (MADD-mild (M); see this term). The first group of MADD-S patients are often premature presenting with severe non-ketotic hypoglycemia, hypotonia, hepatomegaly and severe metabolic acidosis within the first 24 hours of life. They usually have dysplastic kidneys with multiple cysts and may also have facial dysmorphism (low-set ears, high forehead, hypertelorism and hypoplastic midface), rocker-bottom feet and anomalies of external genitalia. Death usually occurs within the first week of life. The second group of patients usually present within the first 24-48 hours of life with hypotonia, tachypnea, hepatomegaly, metabolic acidosis and hypoketotic hypoglycemia. Most die during the first week(s) of life but some have survived for several months, usually dying with severe cardiomyopathy. MADD-M patients show a broad clinical spectrum of disease ranging from onset of intermittent episodes of vomiting, metabolic acidosis and hypoketotic hypoglycaemia (+/- cardiac involvement) during the first few months of life to adolescent/adult presentation with acute Reye-like illness with ketoacidosis and lipid storage myopathy. The latter subgroup often responds to pharmacological doses of riboflavin (rr-MADD).

Multiple acyl-CoA dehydrogenase deficiency, severe neonatal type
SUMMARY

Multiple acyl-CoA dehydrogenation deficiency (MADD) is a disorder of fatty acid and amino acid oxidation and is a clinically heterogeneous disorder ranging from a severe neonatal presentation with metabolic acidosis, cardiomyopathy and liver disease, to a mild childhood/adult disease with episodic metabolic decompensation, muscle weakness, and respiratory failure.

CLINICAL DESCRIPTION

Patients with MADD fall into 3 broad clinical phenotypes: 1) neonatal onset with congenital anomalies, 2) neonatal onset without anomalies, (together called MADD-severe (S); see this term) and 3) mild and/or late onset (MADD-mild (M); see this term). The first group of MADD-S patients are often premature presenting with severe non-ketotic hypoglycemia, hypotonia, hepatomegaly and severe metabolic acidosis within the first 24 hours of life. They usually have dysplastic kidneys with multiple cysts and may also have facial dysmorphism (low-set ears, high forehead, hypertelorism and hypoplastic midface), rocker-bottom feet and anomalies of external genitalia. Death usually occurs within the first week of life. The second group of patients usually present within the first 24-48 hours of life with hypotonia, tachypnea, hepatomegaly, metabolic acidosis and hypoketotic hypoglycemia. Most die during the first week(s) of life but some have survived for several months, usually dying with severe cardiomyopathy. MADD-M patients show a broad clinical spectrum of disease ranging from onset of intermittent episodes of vomiting, metabolic acidosis and hypoketotic hypoglycaemia (+/- cardiac involvement) during the first few months of life to adolescent/adult presentation with acute Reye-like illness with ketoacidosis and lipid storage myopathy. The latter subgroup often responds to pharmacological doses of riboflavin (rr-MADD).

VARIANTS

NM_001985.2:c.278_279insG ; NM_001985.2(ETFB):c.382G>A ; NM_001985.2(ETFB):c.491G>A ; c.61C>T

GENE

ETFDH

DISEASES
Multiple acyl-CoA dehydrogenase deficiency, mild type
SUMMARY

Multiple acyl-CoA dehydrogenation deficiency (MADD) is a disorder of fatty acid and amino acid oxidation and is a clinically heterogeneous disorder ranging from a severe neonatal presentation with metabolic acidosis, cardiomyopathy and liver disease, to a mild childhood/adult disease with episodic metabolic decompensation, muscle weakness, and respiratory failure.

CLINICAL DESCRIPTION

Patients with MADD fall into 3 broad clinical phenotypes: 1) neonatal onset with congenital anomalies, 2) neonatal onset without anomalies, (together called MADD-severe (S); see this term) and 3) mild and/or late onset (MADD-mild (M); see this term). The first group of MADD-S patients are often premature presenting with severe non-ketotic hypoglycemia, hypotonia, hepatomegaly and severe metabolic acidosis within the first 24 hours of life. They usually have dysplastic kidneys with multiple cysts and may also have facial dysmorphism (low-set ears, high forehead, hypertelorism and hypoplastic midface), rocker-bottom feet and anomalies of external genitalia. Death usually occurs within the first week of life. The second group of patients usually present within the first 24-48 hours of life with hypotonia, tachypnea, hepatomegaly, metabolic acidosis and hypoketotic hypoglycemia. Most die during the first week(s) of life but some have survived for several months, usually dying with severe cardiomyopathy. MADD-M patients show a broad clinical spectrum of disease ranging from onset of intermittent episodes of vomiting, metabolic acidosis and hypoketotic hypoglycaemia (+/- cardiac involvement) during the first few months of life to adolescent/adult presentation with acute Reye-like illness with ketoacidosis and lipid storage myopathy. The latter subgroup often responds to pharmacological doses of riboflavin (rr-MADD).

Multiple acyl-CoA dehydrogenase deficiency, severe neonatal type
SUMMARY

Multiple acyl-CoA dehydrogenation deficiency (MADD) is a disorder of fatty acid and amino acid oxidation and is a clinically heterogeneous disorder ranging from a severe neonatal presentation with metabolic acidosis, cardiomyopathy and liver disease, to a mild childhood/adult disease with episodic metabolic decompensation, muscle weakness, and respiratory failure.

CLINICAL DESCRIPTION

Patients with MADD fall into 3 broad clinical phenotypes: 1) neonatal onset with congenital anomalies, 2) neonatal onset without anomalies, (together called MADD-severe (S); see this term) and 3) mild and/or late onset (MADD-mild (M); see this term). The first group of MADD-S patients are often premature presenting with severe non-ketotic hypoglycemia, hypotonia, hepatomegaly and severe metabolic acidosis within the first 24 hours of life. They usually have dysplastic kidneys with multiple cysts and may also have facial dysmorphism (low-set ears, high forehead, hypertelorism and hypoplastic midface), rocker-bottom feet and anomalies of external genitalia. Death usually occurs within the first week of life. The second group of patients usually present within the first 24-48 hours of life with hypotonia, tachypnea, hepatomegaly, metabolic acidosis and hypoketotic hypoglycemia. Most die during the first week(s) of life but some have survived for several months, usually dying with severe cardiomyopathy. MADD-M patients show a broad clinical spectrum of disease ranging from onset of intermittent episodes of vomiting, metabolic acidosis and hypoketotic hypoglycaemia (+/- cardiac involvement) during the first few months of life to adolescent/adult presentation with acute Reye-like illness with ketoacidosis and lipid storage myopathy. The latter subgroup often responds to pharmacological doses of riboflavin (rr-MADD).

VARIANTS

NM_004453.3(ETFDH):c.1773_1774delAT ; NM_004453.3(ETFDH):c.1001T>C ; NM_004453.3(ETFDH):c.413T>G ; NM_004453.3(ETFDH):c.1234G>T ; NM_004453.3(ETFDH):c.1367C>T ; NM_004453.3(ETFDH):c.1570_1571delCT ; NM_004453.3(ETFDH):c.1823delG ; NM_004453.3(ETFDH):c.1832G>A ; NM_004453.3(ETFDH):c.250G>A ; NM_004453.3(ETFDH):c.2T>C ; NM_004453.3(ETFDH):c.524G>T

GENE

ETHE1

DISEASES
Ethylmalonic encephalopathy
SUMMARY

Ethylmalonic acid encephalopathy (EE) is defined by elevated excretion of ethylmalonic acid (EMA) with recurrent petechiae, orthostatic acrocyanosis and chronic diarrhoea associated with neurodevelopmental delay, psychomotor regression and hypotonia with brain magnetic resonance imaging (MRI) abnormalities.

CLINICAL DESCRIPTION

The disease manifests at birth or in the first few months of life. Spastic tetraplegia may be present. In addition to increased excretion of EMA, methylsuccinic acid and C4-C6-acylglycines (isobutyryl-, isovaleryl-, 2-methylbutyryl-, hexanoylglycine) may also be found in small, but elevated, amounts in the urine. Blood levels of C4-C6-carnitines (butyryl-, isobutyryl-, isovaleryl- and hexanoylcarnitine) may be elevated.

VARIANTS

NM_014297.4(ETHE1):c.221dupA ; NM_014297.4(ETHE1):c.440_450delACAGCATGGCC ; NM_014297.3(ETHE1):c.487C>T ; NM_014297.3(ETHE1):c.488G>A ; NM_014297.4(ETHE1):c.554T>G ; NM_014297.4(ETHE1):c.604dup

GENE

EYS

DISEASES
Retinitis pigmentosa
SUMMARY

Retinitis pigmentosa (RP) is an inherited retinal dystrophy leading to progressive loss of the photoreceptors and retinal pigment epithelium and resulting in blindness usually after several decades.

CLINICAL DESCRIPTION

Retinitis pigmentosa is slowly progressive but relentless. There is however broad variability in age of onset, rate of progression and secondary clinical manifestations. Affected individuals generally first develop night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and over time loss of central vision, usually at late stages, often around midlife. Central visual acuity loss may occur at any age as a result of cystoid macular edema or photoreceptor loss. Posterior subcapsular cataracts are common and severity is age dependent. Reduced color vision may also be found. Fundus examination reveals bone spicule pigment deposits, attenuated retinal vessels, retinal atrophy and waxy optic nerve pallor. Severity is partly correlated with the pattern of inheritance with X-linked cases having the most severe course, autosomal recessive and single occurrence cases having intermediate severity, and autosomal dominant the most favorable course.

VARIANTS

NM_001142800.1(EYS):c.2826_2827delAT ; NM_001142800.1(EYS):c.4045C>T ; NM_001142800.1:c.8648_8655delCATGCAGA ; NM_001142800.1(EYS):c.9405T>A ; NC_000006.12:g.65384480dup ; NM_001142800.1(EYS):c.103C>T ; c.4120C>T ; NM_001142800.1(EYS):c.4350_4356delTATAGCT ; c.4462_4469dup ; c.4597_4613del ; NM_001142800.1(EYS):c.490C>T ; c.571dup ; NM_001142800.1:c.5757_5758insT ; NM_001142800.1(EYS):c.5857G>T ; NM_001142800.1(EYS):c.5928-2A>G ; NM_001142800.1:c.6102_6103insT ; NM_001142800.1:c.6170delA ; NM_001142800.1(EYS):c.7095T>G ; c.7822C>T ; NM_001142800.1:c.8408dupA ; NM_001142800.1:c.8569G-T ; NM_001142800.1:c.8629_8632dupACAG ; NM_001142800.1:c.9036delT ; NM_001142800.1:c.9299_9302delCTCA ; NC_000006.12:g.65495181del

GENE

F11

DISEASES
Congenital factor XI deficiency
SUMMARY

A rare inherited bleeding disorder characterized by reduced levels and/or activity of factor XI (FXI) resulting in moderate bleeding symptoms, usually occurring after trauma or surgery.

CLINICAL DESCRIPTION

Bleeding may manifest at any age, usually occuring after circumcision, dental extractions, trauma, or surgery (in particular surgery in the otorhinological and urogenital areas). Patients usually do not present spontaneous bleeding but women can present with menorrhagia. Hemorrhages are usually moderate. Undiagnosed and untreated patients can develop significant hematomas after a surgical procedure.

VARIANTS

NM_000128.3(F11):c.809A>T ; NM_000128.3(F11):c.1613C>T ; NM_000128.3(F11):c.166T>C ; NM_000128.3(F11):c.1693G>A ; NM_000128.3(F11):c.438C>A ; NM_000128.3(F11):c.1211C>A ; NM_000128.4:c.403G>T ; NM_000128.4:c.901T>C

GENE

F8

DISEASES
Mild hemophilia A
SUMMARY

Mild hemophilia A is a form of hemophilia A (see this term) characterized by a small deficiency of factor VIII leading to abnormal bleeding as a result of minor injuries, or following surgery or tooth extraction.

CLINICAL DESCRIPTION

The biological activity of factor VIII is between 5 and 40%. Spontaneous hemorrhages do not occur.

Moderately severe hemophilia A
SUMMARY

Moderately severe hemophilia A is a form of hemophilia A (see this term) characterized by factor VIII deficiency leading to abnormal bleeding as a result of minor injuries, or following surgery or tooth extraction.

CLINICAL DESCRIPTION

The biological activity of factor VIII is between 1% and 5%. Spontaneous hemorrhages are rare.

Severe hemophilia A
SUMMARY

Severe hemophilia A is a form of hemophilia A (see this term) characterized by a large deficiency of factor VIII leading to frequent spontaneous hemorrhage and abnormal bleeding as a result of minor injuries, or following surgery or tooth extraction.

CLINICAL DESCRIPTION

The biological activity of factor VIII is below 1%.

Symptomatic form of hemophilia A in female carriers
SUMMARY

Symptomatic hemophilia A in female carriers is a form of hemophilia A (see this term) that manifests in some women with mutations in the F8 gene (Xq28), encoding coagulation factor VIII.

CLINICAL DESCRIPTION

Symptoms include abnormal bleeding as a result of minor injuries, or following surgery or tooth extraction. Spontaneous hemorrhages may occur occasionally.

VARIANTS

NM_000132.3(F8):c.3169G>A ; NM_000132.3(F8):c.599A>G ; NM_000132.3(F8):c.1648C>G ; NM_000132.3(F8):c.1660A>G ; NM_000132.3(F8):c.1748A>G ; NM_000132.3(F8):c.1778T>A ; NM_000132.3(F8):c.1952A>C ; NM_000132.3(F8):c.2149C>T ; NM_000132.3(F8):c.2161A>C ; NM_000132.3(F8):c.222G>A ; NM_000132.3(F8):c.3144G>A ; NM_000132.3(F8):c.4767_4768insATAACCAA ; NM_000132.3(F8):c.5417C>T ; NM_000132.3(F8):c.5530C>T ; NM_019863.2(F8):c.562C>G ; NM_000132.3(F8):c.6278A>T ; NM_000132.3(F8):c.6320G>A ; NM_000132.3(F8):c.6533G>A ; NM_000132.3(F8):c.7031G>A ; NM_000132.3(F8):c.877C>G ; NC_000023.11:g.154837721G>T ; NC_000023.11:g.154837733T>G ; NC_000023.11:g.154860556A>T ; NC_000023.11:g.154861849C>T ; NC_000023.11:g.154863220A>G ; NC_000023.11:g.154904008T>G ; NC_000023.11:g.154906490C>T ; NC_000023.11:g.154928569A>G ; NC_000023.11:g.154928573G>A ; NC_000023.11:g.154929477dup ; NC_000023.11:g.154930542_154930543AT[1] ; NC_000023.11:g.154947712G>A ; NC_000023.11:g.154953897A>C ; NC_000023.11:g.154953901del ; NC_000023.11:g.154957009A>G ; NC_000023.11:g.154957055A>G ; NC_000023.11:g.154966604A>G ; NC_000023.11:g.154966628dup ; NC_000023.11:g.154966663A>G ; NC_000023.11:g.154984741G>A ; NC_000023.11:g.154992979G>T ; NC_000023.11:g.154993077T>G ; NC_000023.11:g.155022410C>T ; NM_019863.2(F8):c.101G>A ; NM_000132.3(F8):c.1026T>A ; NM_000132.3:c.1033G-C ; NM_000132.3(F8):c.1033G>T ; NM_000132.3(F8):c.1043G>C ; NM_000132.3(F8):c.104A>G ; NM_000132.3(F8):c.1063C>T ; NM_000132.3(F8):c.1075_1078delAATG ; NM_000132.3(F8):c.1078_1079delGA ; NM_000132.3(F8):c.1094A>G ; NM_000132.3:c.1164delC ; NM_000132.3(F8):c.1171C>T ; NM_000132.3(F8):c.1174T>C ; NM_000132.3:c.1175C-G ; NM_000132.3(F8):c.1175C>A ; NM_000132.3:c.1189_1190insC ; NM_000132.3(F8):c.1197_1198delAA ; c.1200_1201del ; NM_000132.3:c.1200_1201delTT ; c.1203G>A ; c.120del ; NM_000132.3(F8):c.1214T>G ; NM_000132.3(F8):c.1226A>G ; NM_000132.3:c.1282delA ; NM_000132.3:c.128dupT ; NM_000132.3(F8):c.1293G>T ; NM_000132.3(F8):c.1293delG ; NM_000132.3:c.1310delG ; NM_000132.3:c.1331_1332delAAinsT ; c.1331_1332delinsT ; NM_000132.3:c.1335dupC ; NM_000132.3(F8):c.1336C>T ; c.1338del ; NM_000132.3(F8):c.1350C>A ; NM_000132.3:c.1352_1353delCA ; c.1357G>T ; c.1390G>T ; NM_000132.3:c.1394C-G ; NM_000132.3:c.1410_1413delTTTA ; NM_000132.3(F8):c.1417T>C ; NM_000132.3(F8):c.1418A>G ; c.143+1G>A ; NM_000132.3:c.1438_1439delCT ; NM_000132.3:c.1440_1441insA ; c.1442_1443dup ; c.1443+2T>C ; NM_000132.3:c.1443.1G-A ; NM_000132.3(F8):c.1481T>C ; NM_000132.3(F8):c.1492G>A ; NM_000132.3:c.1529T-A ; c.1538-1G>T ; c.1538-2A>T ; NM_000132.3:c.1560delT ; NM_000132.3(F8):c.1569G>T ; NM_000132.3(F8):c.1589A>G ; NM_000132.3:c.1595G-A ; c.1596G>A ; NM_000132.3(F8):c.1596_1597insG ; NM_000132.3(F8):c.1630G>A ; NM_000132.3(F8):c.1636C>T ; NM_000132.3(F8):c.1648C>T ; NM_000132.3(F8):c.1649G>A ; NM_000132.3:c.1653T-G ; c.1675G>T ; c.169+1G>T ; NM_000132.3(F8):c.1726G>T ; NM_000132.3(F8):c.1729T>C ; NM_000132.3(F8):c.1730C>T ; NM_000132.3:c.173delC ; NM_000132.3(F8):c.1750C>A ; NM_000132.3(F8):c.1754T>C ; NM_000132.3(F8):c.1804C>T ; NM_000132.3(F8):c.1808G>T ; NM_000132.3:c.1811G-A ; NM_000132.3(F8):c.1812G>C ; NM_000132.3(F8):c.1814A>C ; NM_000132.3:c.1831C-T ; NM_000132.3(F8):c.1834C>T ; c.185C>G ; NM_000132.3(F8):c.1892A>G ; c.1904-1G>A ; c.1925_1928del ; NM_000132.3:c.1941_1944delAGTT ; c.1947_1950del ; NM_000132.3(F8):c.1957G>A ; NM_000132.3(F8):c.1958T>C ; c.195C>A ; NM_000132.3(F8):c.1965C>G ; NM_000132.3(F8):c.1988C>T ; c.1990_1991del ; NM_000132.3:c.1992_1995dupGACT ; c.1996_1999del ; NM_000132.3(F8):c.199_200delAA ; NM_000132.3:c.1A-G ; c.2000del ; NM_000132.3(F8):c.2029T>C ; NM_000132.3:c.202_203insGA ; NM_000132.3:c.2032A-T ; NM_000132.3(F8):c.2044G>T ; NM_000132.3:c.2060T-C ; NM_000132.3(F8):c.207_210delGTTT ; NM_000132.3:c.2088_2089delTG ; NM_000132.3:c.2101_2105delATGGA ; NM_000132.3(F8):c.2167G>A ; c.2186del ; NM_000132.3(F8):c.2215G>A ; c.224del ; c.2338del ; NM_000132.3:c.2360delA ; NM_000132.3:c.2372dupG ; NM_000132.3:c.2374delT ; NM_000132.3:c.2384_2388delGAACA ; NM_000132.3:c.2397delT ; NM_000132.3:c.2404C-T ; NM_000132.3:c.2409delT ; c.2412_2421del ; NM_000132.3:c.2419dupA ; NM_000132.3:c.2462_2463delGG ; c.265+1G>T ; NM_000132.3(F8):c.266G>A ; NM_000132.3(F8):c.270delG ; NM_000132.3(F8):c.2734_2735delAA ; NM_000132.3(F8):c.275G>T ; c.289C>T ; NM_000132.3(F8):c.2945_2946insA ; NM_000132.3:c.2945delA ; NM_000132.3(F8):c.2962_2963delAG ; NM_000132.3(F8):c.296T>A ; NM_000132.3:c.3031A-T ; NM_000132.3:c.3053delA ; c.3072dup ; NM_000132.3(F8):c.3091_3094delAAGA ; NM_000132.3(F8):c.311T>A ; NM_000132.3:c.3150_3151insTC ; c.3152del ; c.3168_3187del ; NM_000132.3:c.3202_3203delAG ; c.3224del ; NM_000132.3(F8):c.323A>C ; NM_000132.3:c.3251C-G ; NM_000132.3:c.3255_3258delTAAA ; c.3275dup ; NM_000132.3:c.3289C-T ; NM_000132.3(F8):c.328A>G ; NM_000132.3:c.3295delA ; c.3298A>T ; c.3302_3303del ; c.3344del ; c.3371C>A ; NM_000132.3:c.3385delC ; c.3388del ; c.3402del ; NM_000132.3:c.3409_3410delCT ; NM_000132.3:c.3416_3417delCT ; c.3417dup ; c.3421C>T ; NM_000132.3:c.3490delT ; NM_000132.3:c.3493G-T ; NM_000132.3:c.3496A-T ; NM_000132.3:c.3500dupA ; c.3505del ; NM_000132.3(F8):c.350T>G ; c.3540del ; NM_000132.3(F8):c.3548_3549delAA ; c.355C>T ; c.3565dup ; c.3607G>T ; NM_000132.3:c.3624delT ; NM_000132.3:c.3631A-T ; NM_000132.3(F8):c.364_365delGT ; c.3651del ; NM_000132.3:c.3652delG ; NM_000132.3(F8):c.3692delC ; c.3702_3705del ; NM_000132.3:c.3710delC ; NM_000132.3:c.3735_3744delCCTTTTCTTAinsATTTCTTTTTCTTT ; c.3736del ; c.3756del ; NM_000132.3:c.3766G-T ; c.3772del ; NM_000132.3:c.379delG ; c.3827C>G ; c.3830del ; c.3833del ; NM_000132.3:c.3842_3844delAGAinsGG ; NM_000132.3:c.3844A-T ; c.3851_3852del ; NM_000132.3:c.3858delT ; c.3863dup ; c.3870dup ; c.3887del ; NM_000132.3(F8):c.388G>C ; NM_000132.3:c.3902delA ; c.3907_3911del ; NM_000132.3:c.3913C-T ; NM_000132.3:c.3922G-T ; c.392del ; c.3964C>T ; NM_000132.3:c.3967C-T ; NM_000132.3(F8):c.396A>C ; NM_000132.3:c.3982C-T ; c.3984dup ; NM_000132.3(F8):c.398A>G ; c.3991_3992del ; NM_000132.3:c.3994_3997delAGAG ; c.399del ; NM_000132.3:c.4006C-T ; NM_000132.3:c.4034delA ; NM_000132.3(F8):c.4042A>T ; NM_000132.3:c.4045delA ; NM_000132.3(F8):c.404A>G ; c.4072C>T ; c.4094_4100del ; NM_000132.3:c.4100delC ; NM_000132.3(F8):c.410C>T ; ENST00000360256.9:c.4114_4154dup ; NM_000132.3(F8):c.4121_4124delTAGA ; c.4156C>T ; c.415C>T ; c.4199del ; NM_000132.3:c.4201C-T ; c.420T>A ; NM_000132.3:c.421G-T ; NM_000132.3:c.4241C-A ; c.4242dup ; NM_000132.3:c.4264_4265delTA ; NM_000132.3:c.4272delC ; NM_000132.3:c.4280delT ; NM_000132.3(F8):c.4293_4297delCTCTT ; c.4318del ; NM_000132.3(F8):c.4328_4331delAAGA ; NM_000132.3:c.4336delG ; c.4339del ; c.4345G>T ; c.4345del ; NM_000132.3:c.4363C-T ; c.4382_4383del ; NM_000132.3(F8):c.43C>T ; NM_000132.3:c.4408G-T ; NM_000132.3:c.4423C-T ; NM_000132.3:c.4424_4425delAA ; NM_000132.3:c.4426_4427delAG ; NM_000132.3:c.4446dupG ; c.4450del ; c.4460del ; c.446del ; NM_000132.3:c.4473C-G ; NM_000132.3(F8):c.4473C>A ; c.4474A>T ; NM_000132.3:c.4483G-T ; c.4483del ; NM_000132.3:c.4491_4492delTG ; NM_000132.3:c.4491_4495delTGTTC ; NM_000132.3:c.4492delG ; NM_000132.3:c.4512delG ; c.4513_4515delinsGCAAAGTTGGTTTGCCAAAACCATGTTGCCG ; c.4519del ; c.452_462del ; c.4542del ; c.4543_4544delinsA ; NM_000132.3:c.4549_4550delGT ; c.4561C>T ; c.4619del ; NM_000132.3:c.4658delA ; c.4662G>A ; c.4662_4663del ; c.4672_4675del ; c.4686del ; c.4687del ; c.4694_4697del ; NM_000132.3:c.4697_4701dupTGAGA ; NM_000132.3:c.4710_4713delAGAA ; c.4719_4729del ; c.471G>A ; NM_000132.3:c.4720delG ; NM_000132.3:c.472C-T ; NM_000132.3:c.4770T-A ; NM_000132.3:c.4798A-T ; c.4805_4806del ; c.4806del ; NM_000132.3:c.4814C-A ; NM_000132.3:c.4825dupA ; c.4841del ; c.4848del ; NM_000132.3(F8):c.4858delC ; NM_000132.3:c.4895delT ; c.4895dup ; NM_000132.3:c.4899delT ; c.4918G>T ; NM_000132.3(F8):c.491G>T ; c.4922dup ; c.4926del ; c.4934G>A ; NM_000132.3:c.4935G-A ; NM_000132.3(F8):c.493C>T ; c.4942C>T ; NM_000132.3:c.4969C-T ; c.4987A>T ; c.4996C>T ; c.4999del ; c.5010del ; NM_000132.3(F8):c.5096A>T ; c.510del ; NM_000132.3(F8):c.5113C>T ; NM_000132.3(F8):c.5122C>T ; NM_000132.3(F8):c.5123G>A ; NM_000132.3(F8):c.5143C>G ; NM_000132.3(F8):c.5143C>T ; c.514_515del ; NM_000132.3:c.514_515insTCAAGATA ; NM_000132.3(F8):c.5167G>A ; NM_000132.3(F8):c.5183A>G ; NM_000132.3(F8):c.5186G>A ; NM_000132.3:c.519_523delTACCT ; c.5220-1G>A ; NM_000132.3:c.5226_5227delGA ; NM_000132.3:c.5243delA ; NM_000132.3:c.5251A-T ; c.5254del ; c.525C>A ; c.5271del ; c.5301C>A ; NM_000132.3(F8):c.5305G>A ; NM_000132.3(F8):c.5323T>G ; NM_000132.3(F8):c.5325G>C ; NM_000132.3(F8):c.5336G>A ; c.5337del ; NM_000132.3:c.5343T-A ; NM_000132.3:c.5348_5357delGAGCAGAAGT ; NM_000132.3(F8):c.5372T>C ; NM_000132.3(F8):c.5398C>G ; NM_000132.3(F8):c.5398C>T ; NM_000132.3(F8):c.5399G>A ; NM_000132.3(F8):c.5408C>A ; NM_000132.3(F8):c.541G>A ; NM_000132.3(F8):c.5422C>T ; NM_000132.3(F8):c.5443C>T ; NM_000132.3(F8):c.5479A>T ; NM_000132.3(F8):c.5526G>A ; NM_000132.3(F8):c.5533A>C ; NM_000132.3:c.5536A-T ; NM_000132.3(F8):c.554A>C ; NM_000132.3(F8):c.5558C>T ; c.5561G>A ; NM_000132.3:c.557_559delACT ; NM_000132.3(F8):c.5593G>A ; NM_000132.3(F8):c.5593G>T ; NM_000132.3(F8):c.5600A>G ; NM_000132.3(F8):c.5605G>A ; NM_000132.3(F8):c.5618C>G ; NM_000132.3(F8):c.5622_5623insT ; c.566C>A ; NM_000132.3:c.5675dupT ; NM_000132.3(F8):c.5677C>T ; NM_000132.3:c.5689_5690delCT ; c.5696dup ; NM_000132.3:c.5697delC ; NM_000132.3(F8):c.5710G>A ; NM_000132.3(F8):c.5719_5720insA ; NM_000132.3:c.5752delT ; NM_000132.3(F8):c.575T>C ; NM_000132.3:c.5766C-A ; NM_000132.3(F8):c.5821A>G ; NM_000132.3(F8):c.5822A>G ; c.5869C>T ; NM_000132.3(F8):c.5878C>T ; NM_000132.3(F8):c.5879G>T ; NM_000132.3(F8):c.5882G>A ; NM_000132.3(F8):c.5900G>A ; NM_000132.3:c.5914_5915delAT ; c.591G>A ; c.5923dup ; NM_000132.3(F8):c.5936G>T ; NM_000132.3(F8):c.5938C>T ; NM_000132.3(F8):c.5953C>T ; NM_000132.3:c.5954G-C ; NM_000132.3:c.5954delG ; NM_000132.3:c.5955delA ; NM_000132.3:c.5960_5964delAAGAG ; NM_000132.3(F8):c.5961delA ; NM_000132.3:c.5964_5967dupGGAG ; NM_000132.3:c.5985C-A ; NM_000132.3(F8):c.601+1632G>A ; NM_000132.3(F8):c.6016G>T ; NM_000132.3(F8):c.6049delG ; NM_000132.3:c.605_621delGTCTGGCCAAGGAAAAGinsAGTCTGGCCAAGGAAAAGA ; NM_000132.3:c.6070dupC ; c.6078_6079del ; c.6084del ; NM_000132.3(F8):c.6089G>A ; c.6089dup ; NM_000132.3:c.6099delT ; NM_000132.3(F8):c.6103G>A ; NM_000132.3(F8):c.6113A>G ; c.6115+1G>A ; c.6115+2T>C ; NM_000132.3:c.6116-2A-G ; NM_000132.3:c.6116_6117delAG ; NM_000132.3:c.6120T-A ; NM_000132.3:c.6120_6135delTCAGACTCCCCTGGGA ; NM_000132.3:c.6127delC ; NM_000132.3:c.6135dupA ; NM_000132.3(F8):c.6193T>C ; NM_000132.3:c.6194G-A ; ENST00000360256.9:c.6202_6257dup ; c.6250A>T ; c.6253G>T ; NM_000132.3(F8):c.6263C>T ; NM_000132.3:c.6273.1G-A ; NM_000132.3(F8):c.6278A>G ; c.628_635del ; NM_000132.3(F8):c.6360T>G ; NM_000132.3(F8):c.6371A>G ; c.63_64del ; NM_000132.3(F8):c.6403C>T ; NM_000132.3(F8):c.6404G>C ; NM_000132.3(F8):c.6412_6413delTC ; NM_000132.3(F8):c.6413C>A ; NM_000132.3(F8):c.6464_6465delAA ; NM_000132.3:c.6464_6465delAA ; NM_000132.3:c.6473delT ; NM_000132.3:c.6494delC ; NM_000132.3(F8):c.6496C>T ; NM_000132.3:c.6497delG ; c.64_65del ; NM_000132.3(F8):c.6518C>T ; NM_000132.3(F8):c.6532C>T ; NM_000132.3(F8):c.6545G>A ; NM_000132.3(F8):c.6554T>C ; NM_000132.3:c.6565_6566delGA ; NM_000132.3:c.6574.1G-A ; NM_000132.3(F8):c.6631G>C ; NM_000132.3(F8):c.665A>T ; NM_000132.3(F8):c.6682C>G ; NM_000132.3(F8):c.6682C>T ; NM_000132.3(F8):c.6683G>A ; NM_000132.3(F8):c.6683G>T ; NM_000132.3(F8):c.6699delG ; NM_000132.3(F8):c.670G>T ; NM_000132.3:c.6738delA ; NM_000132.3:c.6739G-T ; NM_000132.3:c.6739_6740delGA ; NM_000132.3(F8):c.6744G>T ; NM_000132.3:c.6760delC ; NM_000132.3(F8):c.6794A>G ; c.680G>A ; c.685_686del ; NM_000132.3(F8):c.6865C>T ; NM_000132.3:c.6870G-A ; NM_000132.3(F8):c.687_688delAG ; NM_000132.3:c.6886delA ; NM_000132.3:c.6900.1G-A ; NM_000132.3:c.6901-2A-G ; NM_000132.3(F8):c.6912_6916delAAATC ; NM_000132.3:c.6921delC ; NM_000132.3(F8):c.6955C>T ; NM_000132.3(F8):c.6956C>T ; c.695_698del ; NM_000132.3(F8):c.6967C>T ; NM_000132.3(F8):c.6968G>A ; NM_000132.3(F8):c.6977G>A ; NM_000132.3(F8):c.6977G>T ; NM_000132.3:c.6988delC ; NM_000132.3:c.6997delG ; NM_000132.3:c.7012delC ; NM_000132.3:c.7021G-T ; c.709C>T ; NM_000132.3:c.709_712dupCAGG ; c.729del ; NM_000132.3:c.73delT ; NM_000132.3:c.749delT ; NM_000132.3(F8):c.766T>A ; NM_000132.3:c.770_771insCC ; NM_000132.3:c.787.2T-C ; NM_000132.3:c.788-1G-A ; NM_000132.3:c.788-1G-C ; c.788-1G>T ; NM_000132.3:c.788-2A-T ; c.796G>T ; NM_000132.3(F8):c.797G>A ; c.821G>A ; NM_000132.3(F8):c.822G>A ; NM_000132.3(F8):c.832G>A ; NM_000132.3(F8):c.849delT ; c.84del ; NM_000132.3:c.850G-T ; NM_000132.3(F8):c.854T>G ; c.871G>T ; NM_000132.3(F8):c.872A>G ; NM_000132.3(F8):c.881C>T ; c.889del ; NM_000132.3(F8):c.896A>T ; NM_000132.3(F8):c.89A>T ; NM_000132.3(F8):c.907delG ; NM_000132.3:c.920T-G ; NM_000132.3(F8):c.923C>T ; NM_000132.3(F8):c.935T>C ; NM_000132.3:c.935delT ; NM_000132.3(F8):c.940A>G ; NM_000132.3(F8):c.943delG ; NM_000132.3:c.948_951delAACA ; c.96del ; NM_000132.3:c.974_975delTT ; NM_000132.3(F8):c.980T>C ; NM_000132.3(F8):c.985T>C ; NM_000132.3:c.985dupT ; NM_000132.3:c.986G-C ; NM_000132.3(F8):c.986G>A ; NM_000132.3:c.98G-A ; NC_000023.11:g.154861755A>G ; NC_000023.11:g.154861756G>A ; NC_000023.11:g.154863110T>C ; NC_000023.11:g.154863223A>C ; NC_000023.11:g.154902062A>G ; NC_000023.11:g.154902084C>T ; NC_000023.11:g.154903986T>A ; NC_000023.11:g.154947768C>G ; NC_000023.11:g.154953991G>C ; NC_000023.11:g.154957088T>A ; NC_000023.11:g.154966049A>C ; NC_000023.11:g.154966677T>G ; NC_000023.11:g.154969361G>C ; intron22 inversion

GENE

F9

DISEASES
Mild hemophilia B
SUMMARY

Mild hemophilia B is a form of hemophilia B (see this term) characterized by a small deficiency of factor IX leading to abnormal bleeding as a result of minor injuries, or following surgery or tooth extraction.

CLINICAL DESCRIPTION

The biological activity of factor IX is between 5 and 40%. Spontaneous hemorrhages do not occur.

Moderately severe hemophilia B
SUMMARY

Moderately severe hemophilia B is a form of hemophilia B (see this term) characterized by factor IX deficiency leading to abnormal bleeding as a result of minor injuries, or following surgery or tooth extraction.

CLINICAL DESCRIPTION

The biological activity of factor IX is between 1% and 5%. Spontaneous hemorrhages are rare.

Severe hemophilia B
SUMMARY

Severe hemophilia B is a form of hemophilia B (see this term) characterized by a large deficiency of factor IX leading to frequent spontaneous hemorrhage and abnormal bleeding as a result of minor injuries, or following surgery or tooth extraction.

CLINICAL DESCRIPTION

The biological activity of factor IX is below 1%.

Symptomatic form of hemophilia B in female carriers
SUMMARY

Symptomatic hemophilia B in female carriers is a form of hemophilia B (see this term) that manifests in some women with mutations in the F9 gene (Xq28), encoding coagulation factor IX.

CLINICAL DESCRIPTION

Symptoms include abnormal bleeding as a result of minor injuries, or following surgery or tooth extraction. Spontaneous hemorrhages may occur occasionally.

VARIANTS

NM_000133.3(F9):c.1025C>T ; NM_000133.3(F9):c.1069G>A ; NM_000133.3(F9):c.1115T>C ; NM_000133.3(F9):c.1256T>G ; NM_000133.3(F9):c.1289G>A ; NM_000133.3(F9):c.141T>A ; NM_000133.3(F9):c.148G>A ; NM_000133.3(F9):c.161A>T ; NM_000133.3(F9):c.224G>A ; NM_000133.3(F9):c.280G>A ; NM_000133.3(F9):c.519dupA ; NM_000133.3(F9):c.756T>G ; NM_000133.3(F9):c.835G>A ; NC_000023.11:g.139530853G>A ; NC_000023.11:g.139530857G>T ; NC_000023.11:g.139560736_139560748del ; NC_000023.11:g.139560774G>A ; NC_000023.11:g.139560819T>A ; NC_000023.11:g.139561530A>G ; NC_000023.11:g.139561752G>T ; NC_000023.11:g.139561791T>C ; NC_000023.11:g.139562030C>T ; NM_000133.3(F9):c.1009G>C ; NM_000133.3(F9):c.1031T>C ; NM_000133.3(F9):c.1058T>C ; NM_000133.3(F9):c.1064G>T ; NM_000133.3(F9):c.1070G>A ; NM_000133.3(F9):c.1088G>T ; NM_000133.3(F9):c.1120G>T ; NM_000133.3(F9):c.1135C>T ; NM_000133.3(F9):c.1136G>A ; NM_000133.3(F9):c.1144T>C ; NM_000133.3(F9):c.1150C>T ; NM_000133.3(F9):c.1151G>C ; NM_000133.3(F9):c.1151G>T ; NM_000133.3(F9):c.1180A>G ; NM_000133.3(F9):c.1187G>C ; NM_000133.3(F9):c.1189G>C ; NM_000133.3:c.118delA ; NM_000133.3(F9):c.1217C>T ; NM_000133.3(F9):c.1228G>C ; NM_000133.3(F9):c.1231A>G ; NM_000133.3(F9):c.1232G>T ; NM_000133.3(F9):c.1240C>A ; NM_000133.3(F9):c.1256T>A ; c.127del ; c.1292G>A ; c.1293G>A ; NM_000133.3(F9):c.1307C>A ; NM_000133.3(F9):c.1307C>T ; NM_000133.3(F9):c.1324G>A ; NM_000133.3(F9):c.1328T>C ; NM_000133.3(F9):c.1357T>C ; NM_000133.3(F9):c.1369A>T ; NM_000133.3(F9):c.169C>T ; NM_000133.3(F9):c.218A>T ; NM_000133.3(F9):c.223C>T ; NM_000133.3(F9):c.237A>C ; NM_000133.3(F9):c.253-1G>C ; NM_000133.3(F9):c.277+2T>C ; NM_000133.3(F9):c.278-3A>G ; NM_000133.3(F9):c.278A>G ; NM_000133.3(F9):c.287A>C ; NM_000133.3(F9):c.301C>G ; NM_000133.3(F9):c.316G>A ; NM_000133.3(F9):c.31T>A ; NM_000133.3(F9):c.328G>A ; NM_000133.3(F9):c.329A>G ; NM_000133.3:c.454A-T ; NM_000133.3(F9):c.479G>C ; NM_000133.3(F9):c.484C>T ; NM_000133.3(F9):c.496A>T ; NM_000133.3(F9):c.52T>C ; NM_000133.3(F9):c.540_541del ; NM_000133.3(F9):c.541G>T ; NM_000133.3(F9):c.571C>T ; NM_000133.3(F9):c.572G>A ; NM_000133.3(F9):c.655C>T ; c.66T>G ; NM_000133.3(F9):c.676C>T ; NM_000133.3(F9):c.677G>A ; NM_000133.3(F9):c.682G>C ; NM_000133.3(F9):c.682G>T ; NM_000133.3(F9):c.697G>A ; NM_000133.3(F9):c.709C>T ; NM_000133.3(F9):c.710A>T ; NM_000133.3:c.719G-A ; NM_000133.3:c.723.1G-A ; NM_000133.3(F9):c.755G>C ; NM_000133.3(F9):c.79G>A ; NM_000133.3(F9):c.804T>G ; NM_000133.3(F9):c.82T>C ; NM_000133.3:c.862G-T ; NM_000133.3(F9):c.872A>T ; NM_000133.3(F9):c.880C>T ; NM_000133.3(F9):c.881G>A ; NM_000133.3(F9):c.892C>T ; NM_000133.3(F9):c.917A>G ; NM_000133.3:c.946_953dupATTGCCCT ; NM_000133.3:c.974T-G ; NM_000133.3(F9):c.998C>T ; NC_000023.11:g.139530730G>A ; NC_000023.11:g.139530852G>A ; NC_000023.11:g.139530852G>C ; NC_000023.11:g.139537160_139537161AC[1] ; NC_000023.11:g.139537385del ; NC_000023.11:g.139548378T>C ; NC_000023.11:g.139561694G>A

GENE

FAH

DISEASES
Tyrosinemia type 1
SUMMARY

Tyrosinemia type 1 (HTI) is an inborn error of tyrosine catabolism caused by defective activity of fumarylacetoacetate hydrolase (FAH) and is characterized by progressive liver disease, renal tubular dysfunction, porphyria-like crises and a dramatic improvement in prognosis following treatment with nitisinone.

CLINICAL DESCRIPTION

HT1 is clinically heterogenous. Symptoms may start during the first few months (acute type), in second half of the first year (subacute type) or in the following years up to adulthood (chronic type). In the acute type, manifestations of hepatic failure predominate (bleeding diathesis, hypoglycemia, ascites etc) with frequent sepsis and rapid deterioration. Mild proximal tubular disease is usually present. Subacute type manifests a similar but less severe clinical picture presenting usually with hepatomegaly or hypophosphatemic rickets (due to tubular dysfunction). Intercurrent illness may precipitate hepatic crisis. Chronic type presents with hepatomegaly secondary to cirrhosis and often tubulopathy, leading to rickets and renal failure. Neurological crises are infrequent presenting symptoms; however they can complicate any type of the disease when untreated. The crises resemble those of acute intermittent porphyria, manifesting with painful parasthesias (causing patients to assume ophisthotonic position, self mutilation), autonomic signs (hypertension, tachycardia, ileus) and respiratory decompensation. All patients stand a high risk of developing hepatocellular carcinoma (HCC) secondary to cirrhosis.

VARIANTS

NM_000137.2(FAH):c.1009G>A ; NM_000137.2(FAH):c.1027G>T ; NM_000137.2(FAH):c.1069G>T ; NM_000137.2(FAH):c.401C>A ; NM_000137.2(FAH):c.456G>A ; NM_000137.2(FAH):c.1062+5G>A ; NM_000137.2(FAH):c.1090G>T ; NM_000137.2(FAH):c.1141A>G ; NM_000137.2(FAH):c.192G>T ; NM_000137.2(FAH):c.47A>T ; NM_000137.2(FAH):c.554-1G>T ; NM_000137.2(FAH):c.707-1G>A ; NM_000137.3:c.782C>T ; NM_000137.2(FAH):c.786G>A ; NM_000137.2:c.837.1G-A ; NM_000137.2:c.939delC ; c.982C>T

GENE

FANCA

DISEASES
Fanconi anemia
SUMMARY

A rare genetic multisystem disorder characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors.

CLINICAL DESCRIPTION

The first signs of Fanconi anemia (FA) are typically non-hematological features. Limb anomalies typically affect the extremities, are unilateral or (usually asymmetric) bilateral. Minor anomalies can also be present such as low birth length and weight, microcephaly and/or microphthalmia. Skin pigmentation abnormalities (café-au-lait spots) and hypoplastic thenar eminence are frequent. Almost 20% of patients have ear malformations with or without hearing loss. Congenital malformations may involve other organ systems and vary within families. Short stature is syndromic and/or associated to endocrinopathies. Fertility is frequently impaired in males, and is highly disturbed in half of females. When congenital malformations are not prominent, diagnosis may be delayed until the onset of hematological anomalies. Bone marrow failure (BMF) occurs at a median age of 7 years, developing in 90% of patients by 40 years of age. The first manifestations are macrocytosis (very early) and thrombocytopenia. In patients with somatic mosaïcism, blood counts may stay normal until occurrence of hematological malignancy. In general, patients are highly predisposed to solid tumors (most frequently head and neck or anogenital regions).

VARIANTS

NM_000135.3(FANCA):c.2303T>C ; NM_000135.2(FANCA):c.1115_1118delTTGG ; c.131dup ; NM_000135.2:c.233_236delTTGA ; NM_000135.3(FANCA):c.3558dup ; c.3763G>T ; NM_000135.4:c.3788_3790delTCT ; c.4130C>G

GENE

FANCC

DISEASES
Fanconi anemia
SUMMARY

A rare genetic multisystem disorder characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors.

CLINICAL DESCRIPTION

The first signs of Fanconi anemia (FA) are typically non-hematological features. Limb anomalies typically affect the extremities, are unilateral or (usually asymmetric) bilateral. Minor anomalies can also be present such as low birth length and weight, microcephaly and/or microphthalmia. Skin pigmentation abnormalities (café-au-lait spots) and hypoplastic thenar eminence are frequent. Almost 20% of patients have ear malformations with or without hearing loss. Congenital malformations may involve other organ systems and vary within families. Short stature is syndromic and/or associated to endocrinopathies. Fertility is frequently impaired in males, and is highly disturbed in half of females. When congenital malformations are not prominent, diagnosis may be delayed until the onset of hematological anomalies. Bone marrow failure (BMF) occurs at a median age of 7 years, developing in 90% of patients by 40 years of age. The first manifestations are macrocytosis (very early) and thrombocytopenia. In patients with somatic mosaïcism, blood counts may stay normal until occurrence of hematological malignancy. In general, patients are highly predisposed to solid tumors (most frequently head and neck or anogenital regions).

VARIANTS

NM_000136.2(FANCC):c.1103_1104delTG ; NM_000136.2(FANCC):c.1642C>T ; NM_000136.2(FANCC):c.37C>T ; NM_000136.2(FANCC):c.996+1G>T ; c.1015del ; NM_000136.2(FANCC):c.1487T>G ; NM_000136.2(FANCC):c.67delG

GENE

FANCG

DISEASES
Fanconi anemia
SUMMARY

A rare genetic multisystem disorder characterized by progressive pancytopenia with bone marrow failure, variable congenital malformations and predisposition to develop hematological or solid tumors.

CLINICAL DESCRIPTION

The first signs of Fanconi anemia (FA) are typically non-hematological features. Limb anomalies typically affect the extremities, are unilateral or (usually asymmetric) bilateral. Minor anomalies can also be present such as low birth length and weight, microcephaly and/or microphthalmia. Skin pigmentation abnormalities (café-au-lait spots) and hypoplastic thenar eminence are frequent. Almost 20% of patients have ear malformations with or without hearing loss. Congenital malformations may involve other organ systems and vary within families. Short stature is syndromic and/or associated to endocrinopathies. Fertility is frequently impaired in males, and is highly disturbed in half of females. When congenital malformations are not prominent, diagnosis may be delayed until the onset of hematological anomalies. Bone marrow failure (BMF) occurs at a median age of 7 years, developing in 90% of patients by 40 years of age. The first manifestations are macrocytosis (very early) and thrombocytopenia. In patients with somatic mosaïcism, blood counts may stay normal until occurrence of hematological malignancy. In general, patients are highly predisposed to solid tumors (most frequently head and neck or anogenital regions).

VARIANTS

NM_004629.1(FANCG):c.1077-2A>G ; NM_004629.1(FANCG):c.1480+1G>C ; NM_004629.1:c.1794_1803delCTGGATCCGT ; NM_004629.1(FANCG):c.313G>T ; c.510+1G>A ; NM_004629.1(FANCG):c.637_643del ; c.907_908dup

GENE

FH

DISEASES
Fumaric aciduria
SUMMARY

Fumaric aciduria (FA), an autosomal recessive metabolic disorder, is most often characterized by early onset but non-specific clinical signs: hypotonia, severe psychomotor impairment, convulsions, respiratory distress, feeding difficulties and frequent cerebral malformations, along with a distinctive facies. Some patients present with only moderate intellectual impairment.

CLINICAL DESCRIPTION

Newborns are frequently microcephalic and may present with facial dysmorphisms. Severe encephalopathy manifests with poor feeding, failure to thrive, hypotonia, lethargy and epileptic seizures. In the most severe cases APGAR scores are low immediately following birth, and bradycardia and respiratory failure may follow. Most children do not achieve visual fixation and are unable to speak or walk. Less severely affected individuals survive beyond childhood, most nonetheless displaying moderate cognitive impairment. Some patients have been reported to present with only moderate cognitive deficits. An increased risk of certain tumors has also been reported, in particular familial leiomyomatosis (see this term).

Hereditary leiomyomatosis and renal cell cancer
SUMMARY

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a hereditary cancer syndrome characterized by a predisposition to cutaneous and uterine leiomyomas and, in some families, to renal cell cancer.

CLINICAL DESCRIPTION

Disease onset can occur at any age, but is more common in young adults and elderly patients. Multiple or single benign cutaneous leiomyomas are common and usually present at around the age of 25 (range from 10-47 years) as firm papules or nodules that are skin colored to light brown. They are usually localized to the trunk and extremities but sometimes on the face. They tend to increase in size and number with age and are usually sensitive to touch and/or cold temperature and, in some, are painful. Uterine leiomyomas (present in 77% of women with HLRCC), also known as fibroids, usually appear around the age of 30 but age at diagnosis can range from 18-52 years. Symptoms of pelvic pain and irregular or heavy menstrual bleeding often occur before they are discovered. Renal tumors (mean age of presentation: 44) are less commonly seen in this syndrome (10-16% of cases) and may present with back pain, although some may be asymptomatic. They are mainly papillary type II renal cell carcinoma and are usually aggressive, often rapidly progressing to metastatic disease and death.

Hereditary pheochromocytoma-paraganglioma
SUMMARY

A rare, hereditary, pheochromocytoma/paraganglioma tumor arising from neuroendocrine chromaffin cells of the adrenal medulla (pheochromocytoma) or from any paraganglia from the skull base to the pelvic floor (paraganglioma). Clinical manifestations are often linked to excess catecholamines production causing sustained or paroxysmal elevations in blood pressure, headache, episodic profuse sweating, palpitations, pallor and apprehension or anxiety. Hereditary pheochromocytoma/paraganglioma tumors tend to present at younger ages, to be multi-focal, bilateral, and recurrent, or to have multiple synchronous neoplasms.

CLINICAL DESCRIPTION

VARIANTS

NM_000143.3(FH):c.1431_1433dupAAA ; NM_000143.3(FH):c.40dupC ; NM_000143.3(FH):c.521C>G ; NM_000143.3(FH):c.1067T>A ; NM_000143.3(FH):c.1093A>G ; NM_000143.3(FH):c.1236+1G>C ; NM_000143.3(FH):c.1255T>C ; NM_000143.3(FH):c.1394A>G ; NM_000143.3(FH):c.320A>C ; NM_000143.3(FH):c.1189G>A ; NM_000143.3(FH):c.1200delT ; NM_000143.3(FH):c.1293delA ; NM_000143.3(FH):c.1446_1449delAAAG ; NM_000143.3(FH):c.697C>T ; NM_000143.3(FH):c.698G>A ; NM_000143.3(FH):c.760C>T ; NM_000143.3(FH):c.793G>A ; c.901dup

GENE

FKRP

DISEASES
Congenital muscular dystrophy with cerebellar involvement
SUMMARY

Congenital muscular dystrophy with cerebellar involvement is a rare, congenital muscular dystrophy due to dystroglycanopathy characterized by proximal muscule weakness with a tendency for muscle hypertrophy and pseudohypertrophy, variable cognitive impairment, microcephaly, cerebellar hypoplasia with or without cysts, and other structural brain anomalies.

CLINICAL DESCRIPTION

Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies (type A), which includes both the more severe Walker-Warburg syndrome (WWS) and the slightly less severe muscle-eye-brain disease (MEB), is an autosomal recessive disorder with characteristic brain and eye malformations, profound mental retardation, congenital muscular dystrophy, and death usually in the first years of life. It represents the most severe end of a phenotypic spectrum of similar disorders resulting from defective glycosylation of DAG1 (128239), collectively known as 'dystroglycanopathies'.

Congenital muscular dystrophy with intellectual disability
SUMMARY

MDDGB5 is an autosomal recessive congenital muscular dystrophy with impaired intellectual development and structural brain abnormalities.

CLINICAL DESCRIPTION

Congenital muscular dystrophy with intellectual disability is a rare, genetic, congenital muscular dystrophy due to dystroglycanopathy disorder characterized by a wide phenotypic spectrum which includes hypotonia and muscular weakness present at birth or early infancy and delayed or arrested motor development, associated with mild to severe intellectual disability and variable brain abnormalities on neuroimaging studies. Feeding difficulties, joint and spinal deformities, respiratory insufficiency, and ocular anomalies (e.g. strabismus, retinal dystrophy, oculomotor apraxia) may be associated. Decreased or absent alpha-dystroglycan on immunohistochemical muscle staining and elevated serum creatine kinase are observed.

Congenital muscular dystrophy without intellectual disability
SUMMARY

MDDGB5 is an autosomal recessive congenital muscular dystrophy with impaired intellectual development and structural brain abnormalities.

CLINICAL DESCRIPTION

Congenital muscular dystrophy with intellectual disability is a rare, genetic, congenital muscular dystrophy due to dystroglycanopathy disorder characterized by a wide phenotypic spectrum which includes hypotonia and muscular weakness present at birth or early infancy and delayed or arrested motor development, associated with mild to severe intellectual disability and variable brain abnormalities on neuroimaging studies. Feeding difficulties, joint and spinal deformities, respiratory insufficiency, and ocular anomalies (e.g. strabismus, retinal dystrophy, oculomotor apraxia) may be associated. Decreased or absent alpha-dystroglycan on immunohistochemical muscle staining and elevated serum creatine kinase are observed.

FKRP-related limb-girdle muscular dystrophy R9
SUMMARY

A form of autosomal recessive limb-girdle muscular dystrophy that presents a highly variable age of onset and phenotypic spectrum typically characterized by slowly progressive proximal weakness of the pelvic and shoulder girdle musculature (predominantly affecting the lower limbs), frequently associated with waddling gait, scapular winging, calf and tongue hypertrophy, exercise-induced myalgia, abdominal muscle weakness, cardiomyopathy, respiratory muscle involvement, and myoglobinuria and/or elevated creatine kinase serum levels.

CLINICAL DESCRIPTION

The age of onset is correlated to the genotype and residual expression of fukutin-related protein. Thus, patients homozygous for the common, mild mutation (c.826C>A) usually have an onset in the third decade, while patients compound heterozygous for this mutation have onset before age 10, and loose ambulation around age 20 and need assisted ventilation 5-10 years after that. The manifesting symptoms start in the lower extremities with difficulties raising from a chair, climbing stairs and running. Later proximal weakness starts in the arms with visible scapular winging. Of note, a third of patients may present with myoglobinuria on physical exertion, before weakness is noticed. Patients may develop a cardiomyopathy that requires medical treatment. In rare cases, a cardiac transplant is required. Left ventricular ejection fraction drops on average 0.4% per year. Patients homozygous for the c.826C>A mutation in FKRP loose ambulation around age 60 and may need assisted ventilation at night, but the timing of these losses is highly variable.

Muscle-eye-brain disease
SUMMARY

A rare, congenital muscular dystrophy due to dystroglycanopathy characterized by early onset muscular dystrophy, severe muscular hypotonia, severe mental retardation and typical brain and eye malformations, including pachygyria, polymicrogyria, agyria, brainstem and cerebellar structural anomalies, severe myopia, glaucoma, optic nerve and retinal hypoplasia. Patients may present with seizures, macrocephaly or microcephaly, microphthalmia, and congenital contractures. Depending on the severity, limited motor function is acquired. Less severe cases have been reported.

CLINICAL DESCRIPTION

Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies (type A), which includes both the more severe Walker-Warburg syndrome (WWS) and the slightly less severe muscle-eye-brain disease (MEB), is an autosomal recessive disorder with characteristic brain and eye malformations, profound mental retardation, congenital muscular dystrophy, and death usually in the first years of life. It represents the most severe end of a phenotypic spectrum of similar disorders resulting from defective glycosylation of DAG1, collectively known as 'dystroglycanopathies'.

Walker-Warburg syndrome
SUMMARY

Walker-Warburg Syndrome (WWS) is a rare form of congenital muscular dystrophy associated with brain and eye abnormalities.

CLINICAL DESCRIPTION

Patients present at birth with generalized severe hypotonia, muscle weakness, absent or very poor psychomotor development, eye involvement and seizures. Brain MRI shows type II cobblestone lissencephaly, hydrocephalus (see these terms), severe brainstem and cerebellar hypoplasia (Dandy-Walker malformation is possible, see this term). White matter abnormalities are also observed.

VARIANTS

NM_024301.4(FKRP):c.1343C>T ; NM_024301.4(FKRP):c.1154C>A ; NM_024301.4(FKRP):c.1387A>G ; NM_000352.5:c.160C>T

GENE

FKTN

DISEASES
Congenital muscular dystrophy without intellectual disability
SUMMARY

MDDGB5 is an autosomal recessive congenital muscular dystrophy with impaired intellectual development and structural brain abnormalities.

CLINICAL DESCRIPTION

Congenital muscular dystrophy with intellectual disability is a rare, genetic, congenital muscular dystrophy due to dystroglycanopathy disorder characterized by a wide phenotypic spectrum which includes hypotonia and muscular weakness present at birth or early infancy and delayed or arrested motor development, associated with mild to severe intellectual disability and variable brain abnormalities on neuroimaging studies. Feeding difficulties, joint and spinal deformities, respiratory insufficiency, and ocular anomalies (e.g. strabismus, retinal dystrophy, oculomotor apraxia) may be associated. Decreased or absent alpha-dystroglycan on immunohistochemical muscle staining and elevated serum creatine kinase are observed.

Congenital muscular dystrophy, Fukuyama type
SUMMARY

Fukuyama type muscular dystrophy (FCMD) is a congenital progressive muscular dystrophy characterized by brain malformation (cobblestone lissencephaly), dystrophic changes in skeletal muscle, severe intellectual deficit, epilepsy and motor impairment.

CLINICAL DESCRIPTION

Disease onset typically occurs in early infancy. Initial symptoms include a poor suck, weak cry, floppiness and developmental delay. Symmetrical generalized muscle weakness and hypotonia are present. Patients have contractures of the hips, knees and interphalangeal joints. Later features include myopathic facial appearance, pseudohypertrophy of the calves and forearms, and ophthalmologic abnormalities (visual impairment and retinal dysplasia). Progressive cardiac involvement, and swallowing and feeding disturbances (leading to recurrent aspiration pneumonia and death) occur in infants with severe FCMD and in patients over ten years of age. Seizures (generalized tonic-clonic convulsions, complex partial seizures and partial seizures with secondary generalization, infantile spasms, tonic seizures and myoclonic seizures) occur in over 50% of affected individuals (median age of seizure onset 1-3 years of age). All patients have severe intellectual deficit and the intelligence quotient (IQ) is usually between 30 and 60.

Familial isolated dilated cardiomyopathy
SUMMARY

A rare familial cardiomyopathy characterized by the dilation of left ventricle and progressively impairing of systolic ventricular function, in the absence of abnormal loading conditions or coronary artery disease sufficient to cause global systolic impairment. The disease may cause heart failure or arrhythmia. The disease is isolated when no additional atypical cardiac or extracardiac manifestations are present.

CLINICAL DESCRIPTION

The disease is defined by the presence of two major clinical criteria: left ventricular (LV) fractional shortening less than 25% and/or LV ejection fraction less than 45% with LV end diastolic diameter greater than 117% of the predicted value (corrected for age and body surface area based on Henry's formula), in the absence of abnormal loading conditions or coronary artery disease sufficient to cause global systolic impairment. The disease can develop at any age, in either sex. LV mass is often greatly increased in this disorder but LV wall thickness is normal. Symptoms of heart failure may be present as well as arrhythmias. Other presentations include the incidental detection of asymptomatic cardiomegaly and symptoms related to coexisting conduction disturbance or thromboembolic complications. Typically, there is a history of DCM in the family.

Fukutin-related limb-girdle muscular dystrophy R13
SUMMARY

A form of limb-girdle muscular dystrophy characterized by an infantile onset of hypotonia, axial and proximal lower limb weakness (with severe weakness noted after febrile illnesses), cardiomyopathy and normal or reduced intelligence. Hypertrophy of calves, thighs, and triceps have also been reported in some cases.

CLINICAL DESCRIPTION

MDDGA4 is a severe autosomal recessive muscular dystrophy-dystroglycanopathy with characteristic brain and eye malformations, seizures, and mental retardation. Cardiac involvement in FCMD/MEB occurs in the second decade of life in those who survive. FKTN-related Walker-Warburg syndrome is a more severe manifestation of the disorder, with death usually in the first year of life.

Muscle-eye-brain disease
SUMMARY

A rare, congenital muscular dystrophy due to dystroglycanopathy characterized by early onset muscular dystrophy, severe muscular hypotonia, severe mental retardation and typical brain and eye malformations, including pachygyria, polymicrogyria, agyria, brainstem and cerebellar structural anomalies, severe myopia, glaucoma, optic nerve and retinal hypoplasia. Patients may present with seizures, macrocephaly or microcephaly, microphthalmia, and congenital contractures. Depending on the severity, limited motor function is acquired. Less severe cases have been reported.

CLINICAL DESCRIPTION

Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies (type A), which includes both the more severe Walker-Warburg syndrome (WWS) and the slightly less severe muscle-eye-brain disease (MEB), is an autosomal recessive disorder with characteristic brain and eye malformations, profound mental retardation, congenital muscular dystrophy, and death usually in the first years of life. It represents the most severe end of a phenotypic spectrum of similar disorders resulting from defective glycosylation of DAG1, collectively known as 'dystroglycanopathies'.

Walker-Warburg syndrome
SUMMARY

Walker-Warburg Syndrome (WWS) is a rare form of congenital muscular dystrophy associated with brain and eye abnormalities.

CLINICAL DESCRIPTION

Patients present at birth with generalized severe hypotonia, muscle weakness, absent or very poor psychomotor development, eye involvement and seizures. Brain MRI shows type II cobblestone lissencephaly, hydrocephalus (see these terms), severe brainstem and cerebellar hypoplasia (Dandy-Walker malformation is possible, see this term). White matter abnormalities are also observed.

VARIANTS

NM_001079802.1(FKTN):c.1112A>G ; NM_006731.2(FKTN):c.411C>A ; NM_001079802.1:c.1167dupA ; NM_001079802.1(FKTN):c.509C>A ; NM_001079802.1(FKTN):c.527T>C ; c.766C>T

GENE

G6PC

DISEASES
Glycogen storage disease due to glucose-6-phosphatase deficiency type Ia
SUMMARY

Glycogenosis due to glucose-6-phosphatase deficiency (G6P) type a, or glycogen storage disease (GSD) type 1a, is a type of glycogenosis due to G6P deficiency (see this term).

CLINICAL DESCRIPTION

The disease may manifest at birth by enlarged liver or, more commonly, between the ages of three to four months by symptoms of fast-induced hypoglycemia (tremors, seizures, cyanosis, and apnea). Patients present disturbed glucose homeostasis usually characterized by poor tolerance to fasting, significant hepatomegaly (sometimes eight to ten cm below the right costal margin), growth retardation (short stature and delayed puberty), generally improved by an appropriate diet, osteopenia and, in some cases, osteoporosis, round doll-like facial appearance with full cheeks, mild hypotonia, nephromegaly, and platelet dysfunction that may lead to frequent epistaxis. Diarrhea may be encountered. Late complications are hepatic (adenomas with rare but possible transformation into hepatocellular carcinoma) and renal (glomerular hyperfiltration leading to proteinuria and sometimes to renal failure), but also include anemia, sometimes severe, and a risk of hypoglycemic brain damage. Pulmonary hypertension has been reported in few cases.

VARIANTS

NM_000151.3(G6PC):c.229T>C ; NM_000151.3(G6PC):c.230+1G>C ; NM_000151.3(G6PC):c.379_380dupTA ; NM_000151.3(G6PC):c.447-1G>A ; NM_000151.3(G6PC):c.883C>T ; NM_000151.3(G6PC):c.1039C>T ; NM_000151.3(G6PC):c.113A>T ; NM_000151.4:c.247C>T ; NM_000151.3(G6PC):c.248G>A ; NM_000151.3(G6PC):c.370G>A ; NM_000151.3(G6PC):c.497T>G ; NM_000151.3(G6PC):c.508C>T ; NM_000151.3(G6PC):c.551G>A ; NM_000151.3(G6PC):c.562G>C

GENE

GAA

DISEASES
Glycogen storage disease due to acid maltase deficiency, infantile onset
SUMMARY

Glycogen storage disease due to acid maltase deficiency, infantile onset is the most severe form of glycogen storage disease due to acid maltase deficiency, characterized by cardiomegaly with respiratory distress, muscle weakness and feeding difficulties. It is often fatal.

CLINICAL DESCRIPTION

Glycogen storage disease II, an autosomal recessive disorder, is the prototypic lysosomal storage disease. In the classic infantile form (Pompe disease), cardiomyopathy and muscular hypotonia are the cardinal features; in the juvenile and adult forms, involvement of skeletal muscles dominates the clinical picture.

Glycogen storage disease due to acid maltase deficiency, late-onset
SUMMARY

Glycogen storage disease due to acid maltase deficiency, late onset (AMDL), a form of Glycogen storage disease due to acid maltase deficiency (AMD), a degenerative metabolic myopathy particularly affecting respiratory and skeletal muscles, is characterized by an accumulation of glycogen in lysosomes.

CLINICAL DESCRIPTION

Glycogen storage disease II, an autosomal recessive disorder, is the prototypic lysosomal storage disease. In the classic infantile form (Pompe disease), cardiomyopathy and muscular hypotonia are the cardinal features; in the juvenile and adult forms, involvement of skeletal muscles dominates the clinical picture.

VARIANTS

NM_000152.3(GAA):c.853C>T ; NM_000152.3(GAA):c.953T>C ; NM_000152.4(GAA):c.1115A>T ; NM_000152.4(GAA):c.1316T>A ; NM_000152.4(GAA):c.1465G>A ; NM_000152.3(GAA):c.1548G>A ; NM_000152.3(GAA):c.1552-3C>G ; NM_000152.4(GAA):c.1561G>A ; NM_000152.4(GAA):c.1799G>A ; NM_000152.4(GAA):c.1933G>T ; NM_000152.3(GAA):c.2015G>A ; NM_000152.4(GAA):c.2105G>T ; NM_000152.3(GAA):c.2238G>A ; NM_000152.4(GAA):c.2238G>C ; NM_000152.4(GAA):c.546G>A ; NM_000152.3(GAA):c.655G>A ; NM_000152.4(GAA):c.768dup ; NM_000152.3(GAA):c.925G>A ; NM_000152.5:c.1064T>C ; NM_000152.3(GAA):c.118C>T ; c.1327-2A>G ; NM_000152.3:c.1431delT ; NM_000152.4(GAA):c.1585_1586delTCinsGT ; NM_000152.4(GAA):c.1634C>T ; NM_000152.3:c.1650dupG ; NM_000152.3:c.1827_1828insA ; c.1847dup ; NM_000152.4(GAA):c.1912G>T ; NM_000152.4(GAA):c.1927G>A ; NM_000152.4(GAA):c.1935C>A ; NM_000152.4(GAA):c.2012T>G ; c.2041-1G>A ; NM_000152.4(GAA):c.2066_2070dup ; NM_000152.3(GAA):c.2237G>A ; NM_000152.4(GAA):c.236_246delCCACACAGTGC ; NM_000152.4(GAA):c.2512C>T ; NM_000152.4(GAA):c.2544del ; NM_000152.3(GAA):c.2560C>T ; NM_000152.3(GAA):c.307T>G ; NM_000152.3(GAA):c.525delT ; c.546+2_546+5del ; NM_000152.4(GAA):c.546G>C ; c.698del ; NM_000152.4(GAA):c.877G>A

GENE

GALC

DISEASES
Adult Krabbe disease
SUMMARY

A rare lysosomal disorder that affects the white matter of the central and peripheral nervous systems characterized by neurodegeneration with severity depending on the age of onset (infantile, late-infantile, juvenile, adolescent and adulthood).

CLINICAL DESCRIPTION

The infantile form has an onset at 2-6 months of age and is divided into 3 stages. In the first stage, symptoms include irritability, stiffness, poor head control, feeding difficulties, intermittent thumb clasp, episodes of increased temperature, and developmental delay. In the second stage, hypertonic episodes occur with opisthotonus, myoclonic seizures, developmental regression, fisting and vision deficits. In the third stage, hypotonia, blindness and deafness occur. Patients progress into a vegetative state and usually die before the age of 2-3 years, generally due to respiratory infections. In the late infantile/juvenile (1-16 years) and adult (>16 years) forms, the presenting symptoms vary greatly and progression is variable (generally slower in older patients). Patients with late infantile /juvenile onset most resemble infantile patients, while the first signs in adult forms are often weakness, gait disturbances (spastic paraparesis or ataxia), burning paresthesias, hemiplegia, and/or vision loss, with or without peripheral neuropathy. Cognitive regression is variable and often absent in adult forms. In the later-onset forms the disease progresses at a slower rate than infantile patients with some adults living until the sixth decade with mild symptoms.

Infantile Krabbe disease
SUMMARY

A rare lysosomal disorder that affects the white matter of the central and peripheral nervous systems characterized by neurodegeneration with severity depending on the age of onset (infantile, late-infantile, juvenile, adolescent and adulthood).

CLINICAL DESCRIPTION

The infantile form has an onset at 2-6 months of age and is divided into 3 stages. In the first stage, symptoms include irritability, stiffness, poor head control, feeding difficulties, intermittent thumb clasp, episodes of increased temperature, and developmental delay. In the second stage, hypertonic episodes occur with opisthotonus, myoclonic seizures, developmental regression, fisting and vision deficits. In the third stage, hypotonia, blindness and deafness occur. Patients progress into a vegetative state and usually die before the age of 2-3 years, generally due to respiratory infections. In the late infantile/juvenile (1-16 years) and adult (>16 years) forms, the presenting symptoms vary greatly and progression is variable (generally slower in older patients). Patients with late infantile /juvenile onset most resemble infantile patients, while the first signs in adult forms are often weakness, gait disturbances (spastic paraparesis or ataxia), burning paresthesias, hemiplegia, and/or vision loss, with or without peripheral neuropathy. Cognitive regression is variable and often absent in adult forms. In the later-onset forms the disease progresses at a slower rate than infantile patients with some adults living until the sixth decade with mild symptoms.

Late-infantile/juvenile Krabbe disease
SUMMARY

A rare lysosomal disorder that affects the white matter of the central and peripheral nervous systems characterized by neurodegeneration with severity depending on the age of onset (infantile, late-infantile, juvenile, adolescent and adulthood).

CLINICAL DESCRIPTION

The infantile form has an onset at 2-6 months of age and is divided into 3 stages. In the first stage, symptoms include irritability, stiffness, poor head control, feeding difficulties, intermittent thumb clasp, episodes of increased temperature, and developmental delay. In the second stage, hypertonic episodes occur with opisthotonus, myoclonic seizures, developmental regression, fisting and vision deficits. In the third stage, hypotonia, blindness and deafness occur. Patients progress into a vegetative state and usually die before the age of 2-3 years, generally due to respiratory infections. In the late infantile/juvenile (1-16 years) and adult (>16 years) forms, the presenting symptoms vary greatly and progression is variable (generally slower in older patients). Patients with late infantile /juvenile onset most resemble infantile patients, while the first signs in adult forms are often weakness, gait disturbances (spastic paraparesis or ataxia), burning paresthesias, hemiplegia, and/or vision loss, with or without peripheral neuropathy. Cognitive regression is variable and often absent in adult forms. In the later-onset forms the disease progresses at a slower rate than infantile patients with some adults living until the sixth decade with mild symptoms.

VARIANTS

NM_000153.3(GALC):c.1543G>A ; NM_000153.3(GALC):c.334A>G ; NM_000153.3(GALC):c.1586C>T ; NM_000153.3(GALC):c.1591C>T ; NM_000153.3(GALC):c.1592G>A ; NM_000153.3(GALC):c.1700A>C ; NM_000153.4(GALC):c.1814dup ; NM_000153.3(GALC):c.388G>A ; NM_000153.3(GALC):c.658C>T ; NM_000153.3(GALC):c.1153G>T ; NM_000153.3(GALC):c.1161+2T>G ; NM_000153.3(GALC):c.1472delA ; NM_000153.3(GALC):c.1488_1489+2delTGGT ; c.1489+2_1489+3del ; NM_000153.3:c.1489.1G-A ; NM_000153.3:c.1695delT ; NM_000153.3:c.1723_1724insT ; NM_000153.4:c.1796T>G ; c.1964del ; c.2056T>C ; NM_000153.3(GALC):c.205C>T ; NM_000153.3(GALC):c.430delA ; c.582+1G>A ; NM_000153.3(GALC):c.628A>T ; c.655C>T ; NM_000153.3(GALC):c.953C>G ; NC_000014.9:g.87965534T>C ; NC_000014.9:g.87984523C>T

GENE

GALT

DISEASES
Classic galactosemia
SUMMARY

A life-threatening metabolic disease with onset in the neonatal period. Infants usually develop feeding difficulties, lethargy, and severe liver disease.

CLINICAL DESCRIPTION

When ingesting breast milk or lactose-containing formula, infants develop feeding problems, failure to thrive, and signs of liver damage (jaundice, bleeding tendency, hypoglycemia). In the absence of appropriate treatment (galactose restriction), sepsis (E-coli) and neonatal death may occur. Despite adequate treatment, long-term complications appear including cognitive impairments, motor deficits, ovarian dysfunction with reduced fertility in women and diminished bone density. Male fertility has not yet been thoroughly studied.

VARIANTS

NM_000155.3(GALT):c.1030C>A ; NM_000155.3(GALT):c.552C>A ; NM_000155.3(GALT):c.607G>A ; NM_000155.3(GALT):c.772C>T ; NM_000155.3(GALT):c.1048delA ; NM_000155.3(GALT):c.1052delC ; NM_000155.3(GALT):c.132delG ; NM_000155.3(GALT):c.18delC ; NM_000155.3(GALT):c.203A>C ; NM_000155.3(GALT):c.289_291delAAC ; NM_000155.3(GALT):c.290A>G ; NM_000155.3(GALT):c.292G>A ; NM_000155.3(GALT):c.329-2A>C ; NM_000155.3(GALT):c.404C>T ; NM_000155.3(GALT):c.413C>T ; NM_000155.3(GALT):c.41delCinsTT ; NM_000155.3(GALT):c.443G>A ; NM_000155.3(GALT):c.508-1G>C ; NM_000155.3(GALT):c.512T>C ; NM_000155.3(GALT):c.568T>C ; NM_000155.3(GALT):c.598delC ; NM_000155.3(GALT):c.602G>A ; NM_000155.3(GALT):c.610C>T ; NM_000155.3(GALT):c.619C>T ; NM_000155.3(GALT):c.626A>G ; NM_000155.3(GALT):c.634C>T ; NM_000155.3(GALT):c.688-2A>C ; NM_000155.3(GALT):c.775C>T ; NM_000155.3(GALT):c.790_792invCTA ; NM_000155.3(GALT):c.820+13A>G ; NM_000155.3(GALT):c.844C>G ; NM_000155.3(GALT):c.947G>A ; NM_000155.3(GALT):c.957C>A ; NM_000155.3(GALT):c.985T>C ; NM_000155.3(GALT):c.997C>T ; NM_000155.3(GALT):c.998G>A ; NM_000155.3(GALT):c.1138T>C ; NM_000155.3(GALT):c.113A>C ; NM_000155.3:c.118G-T ; NM_000155.3(GALT):c.130G>A ; c.158G>A ; NM_000155.3(GALT):c.199C>T ; NM_000155.3(GALT):c.220_221delCT ; NM_000155.3(GALT):c.221T>C ; NM_000155.3(GALT):c.253-2A>G ; NM_000155.3(GALT):c.265T>G ; NM_001258332.1(GALT):c.274C>T ; NM_000155.3(GALT):c.367C>T ; NM_000155.3(GALT):c.386T>C ; NM_000155.3(GALT):c.425T>A ; NM_000155.3(GALT):c.428C>T ; NM_000155.3(GALT):c.442C>T ; NM_000155.3(GALT):c.445dup ; NM_000155.3(GALT):c.505C>A ; NM_000155.3(GALT):c.563A>G ; NM_000155.3(GALT):c.565_578delGTATGGGCCAGCAG ; NM_000155.3(GALT):c.580T>C ; NM_000155.3(GALT):c.584T>C ; NM_000155.3(GALT):c.692G>A ; NM_000155.3(GALT):c.719_728delTAGTACTGGT ; NM_000155.3(GALT):c.71_72insA ; NM_001258332.1(GALT):c.73delT ; c.790del ; NM_000155.3(GALT):c.855G>T ; NM_000155.3(GALT):c.904+1G>T ; NM_000155.3(GALT):c.905-2A>G ; c.939G>A ; NM_000155.3(GALT):c.997C>G

GENE

GAMT

DISEASES
Guanidinoacetate methyltransferase deficiency
SUMMARY

Guanidinoacetate methyltransferase (GAMT) deficiency is a creatine deficiency syndrome characterized by global developmental delay/intellectual disability (DD/ID), prominent speech delay, autistic/hyperactive behavioral disorders, seizures, and various types of pyramidal and/or extra-pyramidal manifestations.

CLINICAL DESCRIPTION

Onset of manifestations of GAMT deficiency occurs between 3 months and 3 years of age. Affected individuals have mild to severe intellectual disability with a distinctive deficit in expressive language, regardless of the degree of the intellectual deficit. Seizures, of different types, are observed in most individuals and are often intractable. Behavioral disorders such as hyperactivity and autistic features are also frequent. Patients may also have movement disorders which mainly affect the extra-pyramidal system and manifest as chorea, athetosis and ataxia.

VARIANTS

NM_000156.5(GAMT):c.506G>A

GENE

GBA

DISEASES
Fetal Gaucher disease
SUMMARY

Fetal Gaucher disease is the perinatal lethal form of Gaucher disease (GD; see this term).

CLINICAL DESCRIPTION

This form is particularly severe. The disease manifests in the fetus with a decrease or absence of fetal movements, fetal and placental anasarca, hepatosplenomegaly, ichthyosis, arthrogryposis, facial dysmorphism and fetal thrombocytopenia. Death usually occurs in utero or shortly after birth (<3 months).

Gaucher disease type 1
SUMMARY

Gaucher disease type 1 is the chronic non-neurological form of Gaucher disease (GD; see this term) characterized by organomegaly, bone involvement and cytopenia.

CLINICAL DESCRIPTION

Although the disease can be diagnosed at any age, half of patients are under the age of 20 at diagnosis. The clinical presentation is heterogeneous with occasional asymptomatic forms. It is characterized by the association of frequent asthenia, growth retardation or delayed puberty, splenomegaly (90% of cases) that may be complicated by splenic infarctions (sometimes superinfected), hepatomegaly (80% of cases) and in rare cases can progress towards fibrosis followed by cirrhosis. Bone anomalies are present in 80% of cases. They manifest as deformations, osteopenia that sometimes causes pathological fractures or vertebral compression, bone infarctions or even aseptic osteonecrosis. Involvement of other organs (rarely symptomatic pulmonary, renal and cardiac involvement) is less common. Pancytopenia is frequent and is associated with various degrees of thrombocytopenia (sometimes severe), anemia and, less frequently, leukoneutropenia. Polyclonal hypergammaglobulinemia is often present and is sometimes complicated by monoclonal gammapathy.

Gaucher disease type 2
SUMMARY

Gaucher disease type 2 is the acute neurological form of Gaucher disease (GD; see this term). It is characterized by early-onset and severe neurological involvement of the brainstem, associated with an organomegaly and generally leading to death before the age of 2.

CLINICAL DESCRIPTION

The disease usually presents in infants aged 3 to 6 months with systemic manifestations of hepatosplenomegaly and an early onset and severe neurological syndrome. The first signs are oculomotor paralysis or bilateral fixed strabismus associated with bulbar signs, in particular severe swallowing difficulties, progressive spasticity and dystonic movements. Seizures occur later and manifest as myoclonic epilepsy that is refractory to treatment with antiepileptics.

Gaucher disease type 3
SUMMARY

Gaucher disease type 3 is the subacute neurological form of Gaucher disease (GD; see this term) characterized by progressive encephalopathy and associated with the systemic manifestations (organomegaly, bone involvement, cytopenia) of GD type 1 (see this term).

CLINICAL DESCRIPTION

The clinical presentation is very heterogeneous. Neurological disease appears in childhood or adolescence, a much later onset than in GD type 2 (see this term). Encephalopathy can be the presenting sign of the disease or may occur later in the disease course. Some patients have moderate systemic involvement associated with ophthalmoplegia as the only neurological symptom. For the more severe forms, the neurological signs encountered are variable: supranuclear horizontal ophthalmoplegia, progressive myoclonic epilepsy, cerebellar ataxia, spasticity and dementia. GD type 3 is also associated with the clinical and biological signs of ''systemic'' disease, such as frequent asthenia, growth retardation or delayed puberty, splenomegaly and hepatomegaly. Bone anomalies may also be present and manifest as deformations, osteopenia, which sometimes leads to pathological fractures or vertebral compression, bone infarctions or even aseptic osteonecrosis. Involvement of other organs (rarely symptomatic pulmonary, renal and cardiac) is less common. Pancytopenia is frequent and involves varying degrees of thrombocytopenia (sometimes severe), anemia and, less frequently, leukoneutropenia. Polyclonal hypergammaglobulinemia is often present and is sometimes complicated by monoclonal gammapathy.

Gaucher disease-ophthalmoplegia-cardiovascular calcification syndrome
SUMMARY

Gaucher disease - ophthalmoplegia - cardiovascular calcification is a variant of Gaucher disease, also known as a Gaucher-like disease that is characterized by cardiac involvement.

CLINICAL DESCRIPTION

The principle manifestation is progressive calcification of the aorta, and of the aortic and/or mitral valves. Other common features include mild splenomegaly, corneal opacities, and supranuclear ophthalmoplegia.

Hereditary late-onset Parkinson disease
SUMMARY

Hereditary late-onset Parkinson disease (LOPD) is a form of Parkinson disease (PD), characterized by an age of onset of more than 50 years, tremor at rest, gait complaints and falls, bradykinesia, rigidity and painful cramps. Patients usually present a low risk of developing non motor symptoms, dystonia, dyskinesia and levodopa-induced dyskinesia (LID).

CLINICAL DESCRIPTION

Onset of LOPD is > 50 years with predominant symptoms including tremor at rest (70% of cases), gait complaints and falls (20%), bradykinesia (20%), rigidity and painful cramps (8%). Compared to young onset PD (YOPD; see this term), a higher risk of developing gait freezing and falls but a lower risk of developing dystonia, dyskinesia and LID have been reported. Patients with hereditary LOPD are also more affected by severe diplopia, cognitive impairment, and gastrointestinal and urinary disorders. LOPD patients report a lower prevalence of non-motor symptoms such as depression, hallucinations, behavioral disturbances (i.e. agitation or impulse control disorder), dementia and apathy.

NON RARE IN EUROPE: Dementia with Lewy body
SUMMARY

Dementia with Lewy bodies (DLB) is a neurodegenerative disorder clinically characterized by dementia and parkinsonism, often with fluctuating cognitive function, visual hallucinations, falls, syncopal episodes, and sensitivity to neuroleptic medication.

CLINICAL DESCRIPTION

NON RARE IN EUROPE: Parkinson disease
SUMMARY

Parkinson disease was first described by James Parkinson in 1817. It is the second most common neurodegenerative disorder after Alzheimer disease (AD), affecting approximately 1% of the population over age 50.

CLINICAL DESCRIPTION

The diagnosis of classic idiopathic PD is primarily clinical, with manifestations including resting tremor, muscular rigidity, bradykinesia, and postural instability. Additional features are characteristic postural abnormalities, dysautonomia, dystonic cramps, and dementia. The disease is progressive and usually has an insidious onset in mid to late adulthood. Pathologic features of classic PD include by a loss of dopaminergic neurons in the substantia nigra (SN) and the presence of Lewy bodies, intracellular inclusions, in surviving neurons in various areas of the brain, particularly the SN.

VARIANTS

NM_001005741.2(GBA):c.1060G>C ; NM_001005741.2(GBA):c.1226A>G ; NM_001005741.2(GBA):c.535G>C ; NM_001005741.2(GBA):c.1090G>A ; NM_001005741.2(GBA):c.1171G>C ; NM_001005741.2(GBA):c.1192C>T ; c.1240G>C ; NM_001005741.2(GBA):c.1240G>T ; NM_000157.3(GBA):c.1342G>C ; NM_001005741.2(GBA):c.1343A>T ; NM_001005741.2(GBA):c.431T>G ; NM_001005741.3(GBA):c.497A>T ; NM_001005741.2(GBA):c.1043C>T ; NM_001005741.2(GBA):c.1049A>G ; NM_001005741.2(GBA):c.1053G>T ; NM_001005741.2(GBA):c.1085C>T ; c.1098dup ; NM_001005741.2(GBA):c.1141T>G ; NM_001005741.3:c.115+1G>A ; NM_001005741.2(GBA):c.1174C>G ; NM_001005741.2(GBA):c.1208G>C ; NM_001005741.2(GBA):c.1228C>G ; NM_000157.3(GBA):c.1246G>A ; NM_001005741.2(GBA):c.1265_1319del55 ; NM_001005741.2:c.1274dupA ; NM_001005741.3:c.1297G>T ; NM_001005741.2(GBA):c.1309G>T ; NM_001005741.2(GBA):c.1319C>T ; NM_001005741.2(GBA):c.1348T>A ; NM_001005741.2(GBA):c.1361C>G ; NM_000157.4:c.1448T>C ; NM_000157.4:c.1448T>G ; NM_001005741.2(GBA):c.1504C>T ; NM_000157.4:c.1604G>A ; NM_000157.4(GBA):c.160G>T ; NM_001005741.2(GBA):c.254G>A ; NM_001005741.2(GBA):c.259C>T ; NM_001005741.2(GBA):c.354G>C ; NM_001005741.2:c.407C-A ; NM_000157.3(GBA):c.475C>T ; NM_000157.3(GBA):c.476G>A ; NM_001005741.2(GBA):c.481C>T ; NM_001005741.2(GBA):c.487delG ; NM_001005741.2(GBA):c.508C>T ; NM_000157.3(GBA):c.509G>T ; NM_001005741.2(GBA):c.586A>C ; NM_001005741.3:c.84dupG ; c.914del

GENE

GBE1

DISEASES
Adult polyglucosan body disease
SUMMARY

A glycogen storage disease of adults characterized by progressive upper and lower motor neuron dysfunction, progressive neurogenic bladder and cognitive difficulties that can lead to dementia.

CLINICAL DESCRIPTION

APBD presents after the age of 40, with urinary incontinence (indicative of neurogenic bladder) often being the first manifestation. Progressive spasticity and weakness are also present due to upper and lower motor neuron involvement and patients have difficulty walking. Severity of gait difficulties varies between patients with some requiring a wheelchair at an advanced disease stage. Sensory loss in the distal lower extremities occurs in most individuals and can lead to foot injuries. Cognitive difficulties (such as problems with executive functioning) can be mild but in some cases can lead to dementia.

Glycogen storage disease due to glycogen branching enzyme deficiency, adult neuromuscular form
SUMMARY

Glycogen branching enzyme (GBE) deficiency (Andersen's disease or amylopectinosis), or glycogen storage disease type 4 (GSD4), is a rare and severe form of glycogen storage disease which accounts for approximately 3% of all the glycogen storage diseases (see these terms).

CLINICAL DESCRIPTION

Clinical presentation is extremely heterogeneous and involves the liver or the neuromuscular system. In the classical form, children are normal at birth, but develop hepatomegaly, hypotonia, and developmental delay during their first months. The disease then rapidly progresses to cirrhosis with portal hypertension and ascites, ultimately causing death in early childhood. A non-progressing hepatic form has been reported in a few cases. In the neuromuscular presentation, the age of onset ranges from fetal to adult age. The most severe form starts before birth with decrease or absence of fetal movements, arthrogryposis, hypoplastic lungs, and perinatal death. Patients with congenital forms have severe hypotonia, cardiomyopathy, depressed respiration and neuronal involvement. Milder forms have been reported with later-onset, marked by muscular weakness or cardiomyopathy and heart failure. Neurological adult forms with central and peripheral nervous system dysfunction have also been described, such as Adult Polyglucosan Body Disease (APBD; see this term), which is characterized by widespread upper and lower motor neuron lesions.

Glycogen storage disease due to glycogen branching enzyme deficiency, childhood combined hepatic and myopathic form
SUMMARY

Glycogen branching enzyme (GBE) deficiency (Andersen's disease or amylopectinosis), or glycogen storage disease type 4 (GSD4), is a rare and severe form of glycogen storage disease which accounts for approximately 3% of all the glycogen storage diseases (see these terms).

CLINICAL DESCRIPTION

Clinical presentation is extremely heterogeneous and involves the liver or the neuromuscular system. In the classical form, children are normal at birth, but develop hepatomegaly, hypotonia, and developmental delay during their first months. The disease then rapidly progresses to cirrhosis with portal hypertension and ascites, ultimately causing death in early childhood. A non-progressing hepatic form has been reported in a few cases. In the neuromuscular presentation, the age of onset ranges from fetal to adult age. The most severe form starts before birth with decrease or absence of fetal movements, arthrogryposis, hypoplastic lungs, and perinatal death. Patients with congenital forms have severe hypotonia, cardiomyopathy, depressed respiration and neuronal involvement. Milder forms have been reported with later-onset, marked by muscular weakness or cardiomyopathy and heart failure. Neurological adult forms with central and peripheral nervous system dysfunction have also been described, such as Adult Polyglucosan Body Disease (APBD; see this term), which is characterized by widespread upper and lower motor neuron lesions.

Glycogen storage disease due to glycogen branching enzyme deficiency, childhood neuromuscular form
SUMMARY

Glycogen branching enzyme (GBE) deficiency (Andersen's disease or amylopectinosis), or glycogen storage disease type 4 (GSD4), is a rare and severe form of glycogen storage disease which accounts for approximately 3% of all the glycogen storage diseases (see these terms).

CLINICAL DESCRIPTION

Clinical presentation is extremely heterogeneous and involves the liver or the neuromuscular system. In the classical form, children are normal at birth, but develop hepatomegaly, hypotonia, and developmental delay during their first months. The disease then rapidly progresses to cirrhosis with portal hypertension and ascites, ultimately causing death in early childhood. A non-progressing hepatic form has been reported in a few cases. In the neuromuscular presentation, the age of onset ranges from fetal to adult age. The most severe form starts before birth with decrease or absence of fetal movements, arthrogryposis, hypoplastic lungs, and perinatal death. Patients with congenital forms have severe hypotonia, cardiomyopathy, depressed respiration and neuronal involvement. Milder forms have been reported with later-onset, marked by muscular weakness or cardiomyopathy and heart failure. Neurological adult forms with central and peripheral nervous system dysfunction have also been described, such as Adult Polyglucosan Body Disease (APBD; see this term), which is characterized by widespread upper and lower motor neuron lesions.

Glycogen storage disease due to glycogen branching enzyme deficiency, congenital neuromuscular form
SUMMARY

Glycogen branching enzyme (GBE) deficiency (Andersen's disease or amylopectinosis), or glycogen storage disease type 4 (GSD4), is a rare and severe form of glycogen storage disease which accounts for approximately 3% of all the glycogen storage diseases (see these terms).

CLINICAL DESCRIPTION

Clinical presentation is extremely heterogeneous and involves the liver or the neuromuscular system. In the classical form, children are normal at birth, but develop hepatomegaly, hypotonia, and developmental delay during their first months. The disease then rapidly progresses to cirrhosis with portal hypertension and ascites, ultimately causing death in early childhood. A non-progressing hepatic form has been reported in a few cases. In the neuromuscular presentation, the age of onset ranges from fetal to adult age. The most severe form starts before birth with decrease or absence of fetal movements, arthrogryposis, hypoplastic lungs, and perinatal death. Patients with congenital forms have severe hypotonia, cardiomyopathy, depressed respiration and neuronal involvement. Milder forms have been reported with later-onset, marked by muscular weakness or cardiomyopathy and heart failure. Neurological adult forms with central and peripheral nervous system dysfunction have also been described, such as Adult Polyglucosan Body Disease (APBD; see this term), which is characterized by widespread upper and lower motor neuron lesions.

Glycogen storage disease due to glycogen branching enzyme deficiency, fatal perinatal neuromuscular form
SUMMARY

Glycogen branching enzyme (GBE) deficiency (Andersen's disease or amylopectinosis), or glycogen storage disease type 4 (GSD4), is a rare and severe form of glycogen storage disease which accounts for approximately 3% of all the glycogen storage diseases (see these terms).

CLINICAL DESCRIPTION

Clinical presentation is extremely heterogeneous and involves the liver or the neuromuscular system. In the classical form, children are normal at birth, but develop hepatomegaly, hypotonia, and developmental delay during their first months. The disease then rapidly progresses to cirrhosis with portal hypertension and ascites, ultimately causing death in early childhood. A non-progressing hepatic form has been reported in a few cases. In the neuromuscular presentation, the age of onset ranges from fetal to adult age. The most severe form starts before birth with decrease or absence of fetal movements, arthrogryposis, hypoplastic lungs, and perinatal death. Patients with congenital forms have severe hypotonia, cardiomyopathy, depressed respiration and neuronal involvement. Milder forms have been reported with later-onset, marked by muscular weakness or cardiomyopathy and heart failure. Neurological adult forms with central and peripheral nervous system dysfunction have also been described, such as Adult Polyglucosan Body Disease (APBD; see this term), which is characterized by widespread upper and lower motor neuron lesions.

Glycogen storage disease due to glycogen branching enzyme deficiency, non progressive hepatic form
SUMMARY

Glycogen branching enzyme (GBE) deficiency (Andersen's disease or amylopectinosis), or glycogen storage disease type 4 (GSD4), is a rare and severe form of glycogen storage disease which accounts for approximately 3% of all the glycogen storage diseases (see these terms).

CLINICAL DESCRIPTION

Clinical presentation is extremely heterogeneous and involves the liver or the neuromuscular system. In the classical form, children are normal at birth, but develop hepatomegaly, hypotonia, and developmental delay during their first months. The disease then rapidly progresses to cirrhosis with portal hypertension and ascites, ultimately causing death in early childhood. A non-progressing hepatic form has been reported in a few cases. In the neuromuscular presentation, the age of onset ranges from fetal to adult age. The most severe form starts before birth with decrease or absence of fetal movements, arthrogryposis, hypoplastic lungs, and perinatal death. Patients with congenital forms have severe hypotonia, cardiomyopathy, depressed respiration and neuronal involvement. Milder forms have been reported with later-onset, marked by muscular weakness or cardiomyopathy and heart failure. Neurological adult forms with central and peripheral nervous system dysfunction have also been described, such as Adult Polyglucosan Body Disease (APBD; see this term), which is characterized by widespread upper and lower motor neuron lesions.

Glycogen storage disease due to glycogen branching enzyme deficiency, progressive hepatic form
SUMMARY

Glycogen branching enzyme (GBE) deficiency (Andersen's disease or amylopectinosis), or glycogen storage disease type 4 (GSD4), is a rare and severe form of glycogen storage disease which accounts for approximately 3% of all the glycogen storage diseases (see these terms).

CLINICAL DESCRIPTION

Clinical presentation is extremely heterogeneous and involves the liver or the neuromuscular system. In the classical form, children are normal at birth, but develop hepatomegaly, hypotonia, and developmental delay during their first months. The disease then rapidly progresses to cirrhosis with portal hypertension and ascites, ultimately causing death in early childhood. A non-progressing hepatic form has been reported in a few cases. In the neuromuscular presentation, the age of onset ranges from fetal to adult age. The most severe form starts before birth with decrease or absence of fetal movements, arthrogryposis, hypoplastic lungs, and perinatal death. Patients with congenital forms have severe hypotonia, cardiomyopathy, depressed respiration and neuronal involvement. Milder forms have been reported with later-onset, marked by muscular weakness or cardiomyopathy and heart failure. Neurological adult forms with central and peripheral nervous system dysfunction have also been described, such as Adult Polyglucosan Body Disease (APBD; see this term), which is characterized by widespread upper and lower motor neuron lesions.

VARIANTS

NM_000158.3(GBE1):c.986A>G ; NM_000158.3(GBE1):c.1604A>G ; NM_000158.3(GBE1):c.1543C>T ; NM_000158.3(GBE1):c.1570C>T ; NM_000158.3(GBE1):c.1571G>A ; NM_000158.3(GBE1):c.1774G>T ; NM_000158.3:c.2052.1G-A ; c.466_470del ; NM_000158.3(GBE1):c.771T>A ; NM_000158.4:c.986A>C

GENE

GCDH

DISEASES
Glutaryl-CoA dehydrogenase deficiency
SUMMARY

Glutaryl-CoA dehydrogenase (GCDH) deficiency (GDD) is an autosomal recessive neurometabolic disorder clinically characterized by encephalopathic crises resulting in striatal injury and a severe dystonic dyskinetic movement disorder.

CLINICAL DESCRIPTION

Neonates are mainly asymptomatic, although 75 % present with macrocephaly and possibly show hypotonia and irritability. If undiagnosed, the initial acute encephalopathic crisis occurs between 3-36 months, typically precipitated by an intercurrent febrile illness, vaccination or a surgical intervention, and characterized by hypotonia, loss of motor skills and convulsions resulting in bilateral striatal injury with severe secondary dystonia and occasionally subdural and retinal hemorrhage. GDD can exceptionally present with hypoglycemia or acidosis. With age (>6 years) and with appropriate treatment, the risk of encephalopathic crises subsides. In some patients, hypotonia and dystonia develop gradually with no encephalopathic crisis, which is known as late-onset or insidious-onset GDD.

VARIANTS

NM_000159.3(GCDH):c.1168G>C ; NM_000159.4(GCDH):c.416C>T ; NM_000159.3(GCDH):c.877G>A ; NM_000159.3(GCDH):c.1060G>A ; NM_000159.3(GCDH):c.1093G>A ; NM_000159.3(GCDH):c.1198G>A ; NM_000159.3(GCDH):c.1204C>T ; NM_000159.3(GCDH):c.271+1G>A ; NM_000159.3(GCDH):c.383G>A ; NM_000159.3(GCDH):c.572T>C ; NM_000159.3(GCDH):c.636-1G>A ; NM_000159.3(GCDH):c.680G>C ; NM_000159.3(GCDH):c.743C>T ; NM_000159.3(GCDH):c.764C>T ; NM_000159.3(GCDH):c.769C>T ; c.1002_1003del ; c.1199dup ; NM_000159.3(GCDH):c.1244-2A>C ; NM_000159.3(GCDH):c.1247C>T ; NM_000159.3(GCDH):c.1262C>T ; NM_000159.3(GCDH):c.542A>G ; NM_000159.3:c.74C-A ; NM_000159.3(GCDH):c.751C>T ; NM_000159.3(GCDH):c.883T>C ; NM_000159.4(GCDH):c.914C>T

GENE

GFM1

DISEASES
Hepatoencephalopathy due to combined oxidative phosphorylation defect type 1
SUMMARY

Combined oxidative phosphorylation deficiency is an autosomal recessive multisystem disorder with variable manifestations resulting from a defect in the mitochondrial oxidative phosphorylation (OXPHOS) system. Onset occurs at or soon after birth, and features can include growth retardation, microcephaly, hypertonicity, axial hypotonia, encephalopathy, cardiomyopathy, and liver dysfunction. Death usually occurs in the first weeks or years of life.

CLINICAL DESCRIPTION

Hepatoencephalopathy due to combined oxidative phosphorylation deficiency type 1 is a rare, inherited mitochondrial disorder due to a defect in mitochondrial protein synthesis characterized by intrauterine growth retardation, metabolic decompensation with recurrent vomiting, persistent severe lactic acidosis, encephalopathy, seizures, failure to thrive, severe global developmental delay, poor eye contact, severe muscular hypotonia or axial hypotonia with limb hypertonia, hepatomegaly and/or liver dysfunction and/or liver failure, leading to fatal outcome in severe cases. Neuroimaging abnormalities may include corpus callosum thinning, leukodystrophy, delayed myelination and basal ganglia involvement.

VARIANTS

NM_024996.5(GFM1):c.521A>G ; NM_024996.5(GFM1):c.748C>T ; c.1354_1357del ; NM_024996.5(GFM1):c.139C>T ; c.1589_1590del

GENE

GJB2

DISEASES
Autosomal dominant non-syndromic sensorineural deafness type DFNA
SUMMARY

Deafness is the most frequent form of sensorial deficit. In the vast majority of cases, the deafness is termed nonsyndromic or isolated and the hearing loss is the only clinical anomaly reported. In developed counties, 60-80% of cases of early-onset hearing loss are of genetic origin.

CLINICAL DESCRIPTION

The majority of cases presenting at birth concern perceptive deafness (with a neurosensory origin associated with the inner ear) rather than conductive deafness (anomalies in the amplification of sound waves between the middle ear - tympanum and auditory ossicles - and the outer ear). Autosomal dominant forms are characterised by very early onset and bilateral hearing loss with varying degrees of severity (ranging from mild to profound). No malformations of the inner ear can be detected by CT scan. Mutations in the PDS gene are responsible for 7% of cases of childhood deafness. In these cases, the deafness is marked by early-onset, usually bilateral (but sometimes asymmetric) hearing loss with autosomal recessive transmission. This form of deafness is always associated with malformations of the inner ear that can be detected by CT scan. In rare cases, thyroid gland disease may also be present. For the autosomal dominant forms of deafness, mutations in the COCH gene result in progressive postlingual deafness associated with severe attacks of vertigo and subjective tinnitus. This form of deafness should be distinguished from Meniere's disease (see this term). Autosomal dominant mutations in the WFS1 gene cause either a form of hearing loss affecting mainly low frequency sounds or deafness associated with optic atrophy.

Autosomal recessive non-syndromic sensorineural deafness type DFNB
SUMMARY

Deafness is the most frequent form of sensorial deficit. In the vast majority of cases, the deafness is termed nonsyndromic or isolated and the hearing loss is the only clinical anomaly reported. In developed counties, 60-80% of cases of early-onset hearing loss are of genetic origin.

CLINICAL DESCRIPTION

The majority of cases presenting at birth concern perceptive deafness (with a neurosensory origin associated with the inner ear) rather than conductive deafness (anomalies in the amplification of sound waves between the middle ear - tympanum and auditory ossicles - and the outer ear). Autosomal dominant forms are characterised by very early onset and bilateral hearing loss with varying degrees of severity (ranging from mild to profound). No malformations of the inner ear can be detected by CT scan. Mutations in the PDS gene are responsible for 7% of cases of childhood deafness. In these cases, the deafness is marked by early-onset, usually bilateral (but sometimes asymmetric) hearing loss with autosomal recessive transmission. This form of deafness is always associated with malformations of the inner ear that can be detected by CT scan. In rare cases, thyroid gland disease may also be present. For the autosomal dominant forms of deafness, mutations in the COCH gene result in progressive postlingual deafness associated with severe attacks of vertigo and subjective tinnitus. This form of deafness should be distinguished from Meniere's disease (see this term). Autosomal dominant mutations in the WFS1 gene cause either a form of hearing loss affecting mainly low frequency sounds or deafness associated with optic atrophy.

Keratoderma hereditarium mutilans
SUMMARY

Keratoderma hereditarium mutilans is a rare, diffuse, mutilating, hereditary palmoplantar keratoderma disorder characterized by severe, honeycomb-pattern palmoplantar keratosis and pseudoainhum of the digits leading to autoamputation, associated with mild to moderate congenital sensorineural hearing loss. Additional features include stellate keratosis on the extensor surfaces of the fingers, feet, elbows and knees. Alopecia, onychogryphosis, nail dystrophy or clubbing, spastic paraplegia and myopathy may also be associated.

CLINICAL DESCRIPTION

KID syndrome
SUMMARY

A rare congenital ectodermal disorder characterized by vascularizing keratitis, hyperkeratotic skin lesions and hearing loss.

CLINICAL DESCRIPTION

Patients usually present at birth with generalized erythema and ichthyosiform scaling. The skin manifestations are progressive with erythrokeratoderma characterized by well-demarcated erythematous and keratotic plaques with a verrucous appearance predominantly located on the face, scalp, ears, elbows and knees. Other skin changes include deep furrows around the mouth, palmoplantar hyperkeratosis (PPHK) with leather grain-like keratoderma, follicular HK on the trunk, and spiky HK (hystrix-like ichthyosis) in some cases. The skin lesions are prone to infection and rare fatal cases of severe recurrent infections with septicemia have been reported. Nail dystrophy, alopecia, and sparse or absent eyebrows and eyelashes are also frequent. KID/HID patients have an increased susceptibility for squamous cell and tongue carcinomas. Hearing loss is congenital, usually sensorineural and is often profound. Ocular findings may be absent in some patients but when present onset usually occurs during childhood or adolescence with photophobia, punctate keratitis and progressive corneal vascularization leading to vision loss. The combined vision and hearing loss may lead to severe developmental delay. Cerebellar and neuromuscular defects have been reported in a few cases.

Knuckle pads-leukonychia-sensorineural deafness-palmoplantar hyperkeratosis syndrome
SUMMARY

Bart-Pumphrey syndrome (BAPS) is an autosomal dominant disorder characterized by sensorineural hearing loss, palmoplantar keratoderma, knuckle pads, and leukonychia, which show considerable phenotypic variability.

CLINICAL DESCRIPTION

A rare, syndromic genetic deafness disease characterized by symmetric or asymmetirc knuckle pads (typically located on the distal and interphalangeal joints), leukonychia, diffuse palmoplantar keratoderma, and congenital, mild to moderate sensorineural deafness.

Palmoplantar keratoderma-deafness syndrome
SUMMARY

Palmoplantar keratoderma-deafness syndrome is a keratinization disorder characterized by focal or diffuse palmoplantar keratoderma. A patchy distribution is observed with accentuation on the thenars, hypothenars and the arches of the feet. The disease becomes apparent in infancy and is associated with sensorineural hearing loss that shows a variable age of onset. Due to genetic and clinical similarities, it has been proposed that palmoplantar keratoderma-deafness syndrome, knuckle pads-leukonychia-sensorineural deafness-palmoplantar hyperkeratosis syndrome and keratoderma hereditarium mutilans may represent variants of one broad disorder of syndromic deafness with heterogeneous phenotype. The disease is transmitted in an autosomal dominant manner with incomplete penetrance.

CLINICAL DESCRIPTION

Porokeratotic eccrine ostial and dermal duct nevus
SUMMARY

CLINICAL DESCRIPTION

VARIANTS

NM_004004.5(GJB2):c.230G>A ; NM_004004.5(GJB2):c.238C>T ; NM_004004.5(GJB2):c.239A>C ; NM_004004.5(GJB2):c.250G>T ; NM_004004.5(GJB2):c.269dupT ; NM_004004.6(GJB2):c.299A>T ; NM_004004.5(GJB2):c.334_335delAA ; NM_004004.5(GJB2):c.365A>T ; NM_004004.5(GJB2):c.416G>A ; NM_004004.6(GJB2):c.439G>A ; NM_004004.5(GJB2):c.551G>C ; NM_004004.5(GJB2):c.132G>A ; NM_004004.5(GJB2):c.139G>T ; NM_004004.5(GJB2):c.169C>T ; NM_004004.5(GJB2):c.176_191del16 ; NM_000151.4:c.229T>C ; NM_004004.5(GJB2):c.231G>A ; NM_004004.5(GJB2):c.235delC ; NM_004004.5(GJB2):c.250G>C ; NM_004004.5(GJB2):c.269T>C ; c.270dup ; NM_004004.5(GJB2):c.299_300delAT ; c.310_323del ; NM_004004.5(GJB2):c.313_326delAAGTTCATCAAGGG ; NM_004004.5(GJB2):c.358_360delGAG ; NM_004004.6:c.35delG ; NM_004004.5:c.402delG ; NM_004004.6(GJB2):c.427C>T ; NM_004004.6(GJB2):c.465T>A ; NM_004004.5:c.516G-A ; NM_004004.5(GJB2):c.550C>T ; NM_004004.5(GJB2):c.617A>G

GENE

GJB6

DISEASES
Autosomal dominant non-syndromic sensorineural deafness type DFNA
SUMMARY

Deafness is the most frequent form of sensorial deficit. In the vast majority of cases, the deafness is termed nonsyndromic or isolated and the hearing loss is the only clinical anomaly reported. In developed counties, 60-80% of cases of early-onset hearing loss are of genetic origin.

CLINICAL DESCRIPTION

The majority of cases presenting at birth concern perceptive deafness (with a neurosensory origin associated with the inner ear) rather than conductive deafness (anomalies in the amplification of sound waves between the middle ear - tympanum and auditory ossicles - and the outer ear). Autosomal dominant forms are characterised by very early onset and bilateral hearing loss with varying degrees of severity (ranging from mild to profound). No malformations of the inner ear can be detected by CT scan. Mutations in the PDS gene are responsible for 7% of cases of childhood deafness. In these cases, the deafness is marked by early-onset, usually bilateral (but sometimes asymmetric) hearing loss with autosomal recessive transmission. This form of deafness is always associated with malformations of the inner ear that can be detected by CT scan. In rare cases, thyroid gland disease may also be present. For the autosomal dominant forms of deafness, mutations in the COCH gene result in progressive postlingual deafness associated with severe attacks of vertigo and subjective tinnitus. This form of deafness should be distinguished from Meniere's disease (see this term). Autosomal dominant mutations in the WFS1 gene cause either a form of hearing loss affecting mainly low frequency sounds or deafness associated with optic atrophy.

Autosomal recessive non-syndromic sensorineural deafness type DFNB
SUMMARY

Deafness is the most frequent form of sensorial deficit. In the vast majority of cases, the deafness is termed nonsyndromic or isolated and the hearing loss is the only clinical anomaly reported. In developed counties, 60-80% of cases of early-onset hearing loss are of genetic origin.

CLINICAL DESCRIPTION

The majority of cases presenting at birth concern perceptive deafness (with a neurosensory origin associated with the inner ear) rather than conductive deafness (anomalies in the amplification of sound waves between the middle ear - tympanum and auditory ossicles - and the outer ear). Autosomal dominant forms are characterised by very early onset and bilateral hearing loss with varying degrees of severity (ranging from mild to profound). No malformations of the inner ear can be detected by CT scan. Mutations in the PDS gene are responsible for 7% of cases of childhood deafness. In these cases, the deafness is marked by early-onset, usually bilateral (but sometimes asymmetric) hearing loss with autosomal recessive transmission. This form of deafness is always associated with malformations of the inner ear that can be detected by CT scan. In rare cases, thyroid gland disease may also be present. For the autosomal dominant forms of deafness, mutations in the COCH gene result in progressive postlingual deafness associated with severe attacks of vertigo and subjective tinnitus. This form of deafness should be distinguished from Meniere's disease (see this term). Autosomal dominant mutations in the WFS1 gene cause either a form of hearing loss affecting mainly low frequency sounds or deafness associated with optic atrophy.

Hidrotic ectodermal dysplasia
SUMMARY

Clouston syndrome (or hidrotic ectodermal dysplasia) is characterised by the clinical triad of nail dystrophy, alopecia, and palmoplantar hyperkeratosis.

CLINICAL DESCRIPTION

Nail abnormalities are the most consistent feature and frequently manifest at birth or in early infancy. The nails are thickened, slow growing, brittle, often hyperconvex and discoloured with striation. Additional reported features include micronychia, onycholysis and recurrent paronychial infections leading to nail loss. Hair involvement manifests at birth or later during infancy or childhood, and ranges from total to partial, often progressive, alopecia. Residual scalp hair is slow growing, sparse, fine and brittle. Eyebrows and eyelashes are also frequently sparse and axillary, pubic and body hair can be affected. Palmoplantar hyperkeratosis is not a constant finding. When present, it usually begins in childhood and tends to worsen with age; some patients also develop hyperkeratosis and hyperpigmentation over the joints and bony prominences. The teeth are usually unaffected and sweating is normal.

KID syndrome
SUMMARY

A rare congenital ectodermal disorder characterized by vascularizing keratitis, hyperkeratotic skin lesions and hearing loss.

CLINICAL DESCRIPTION

Patients usually present at birth with generalized erythema and ichthyosiform scaling. The skin manifestations are progressive with erythrokeratoderma characterized by well-demarcated erythematous and keratotic plaques with a verrucous appearance predominantly located on the face, scalp, ears, elbows and knees. Other skin changes include deep furrows around the mouth, palmoplantar hyperkeratosis (PPHK) with leather grain-like keratoderma, follicular HK on the trunk, and spiky HK (hystrix-like ichthyosis) in some cases. The skin lesions are prone to infection and rare fatal cases of severe recurrent infections with septicemia have been reported. Nail dystrophy, alopecia, and sparse or absent eyebrows and eyelashes are also frequent. KID/HID patients have an increased susceptibility for squamous cell and tongue carcinomas. Hearing loss is congenital, usually sensorineural and is often profound. Ocular findings may be absent in some patients but when present onset usually occurs during childhood or adolescence with photophobia, punctate keratitis and progressive corneal vascularization leading to vision loss. The combined vision and hearing loss may lead to severe developmental delay. Cerebellar and neuromuscular defects have been reported in a few cases.

VARIANTS

NM_001110219.2(GJB6):c.14C>T ; c.169C>T ; NM_006783.4(GJB6):c.261dupA ; c.383_384del ; NM_006783.4:c.443delC ; c.485dup

GENE

GLB1

DISEASES
GM1 gangliosidosis type 1
SUMMARY

GM1 gangliosidosis type 1 is the severe infantile form of GM1 gangliosidosis (see this term) with variable neurological and systemic manifestations.

CLINICAL DESCRIPTION

The onset of this disorder may be in utero (non immune hydrops fetalis) or by the age of six months. Clinical signs are variable and include arrest/regression of neurological development, hypotonia, visceromegaly, macular cherry-red spots, dysostosis and coarse facial features. Cardiomyopathy may occur.

GM1 gangliosidosis type 2
SUMMARY

GM1 gangliosidosis type 2 is a clinically variable, infancy or childhood-onset form of GM1 gangliosidosis (see this term) characterized by normal early development and psychomotor regression between seven months and three years of age.

CLINICAL DESCRIPTION

Patients with the childhood form of this disorder develop signs and symptoms of intermediate severity including locomotor disturbances, strabismus, muscle weakness, seizures, lethargy and lung infections. Compared to type 1, visceromegaly and skeletal anomalies are milder or may be absent. Macular cherry-red spots are infrequent. The course of the disorder is characterized by slower progression. Facial coarsening develops over time.

GM1 gangliosidosis type 3
SUMMARY

GM1 gangliosidosis type 3 is a mild, chronic, adult form of GM1 gangliosidosis (see this term) characterized by onset generally during childhood or adolescence and by cerebellar dysfunction.

CLINICAL DESCRIPTION

Marked variability of clinical signs and age of onset has been reported. Patients generally show slowly progressive dementia, dysarthria, dystonia, short stature, mild vertebral anomalies and ataxia. Eye movements are normal.

Mucopolysaccharidosis type 4B
SUMMARY

A rare lysosomal storage disease characterized by mild to severe spondylo-epiphyso-metaphyseal dysplasia, manifesting with disproportionate short stature (short neck and trunk), joint laxity, pectus carinatum, genum valgum, abnormal gait, tracheal narrowing, spinal abnormalities (kyphosis and scoliosis), respiratory impairment and valvular heart disease.

CLINICAL DESCRIPTION

Clinically, the two forms of MPS, IVA and IVB, have similar skeletal manifestations; however, MPS IVA has a more severe phenotype. MPS IVA is generally diagnosed during the second year of life. Progressive skeletal and joint deformities lead to impairment in walking and daily activities, and include platyspondyly, kyphosis, scoliosis, pectus carinatum, genu valgum, long bone deformities, and joint hyperlaxity (neck, hands, fingers, hips, knees). A rapidly progressive growth failure, with arrest at around 3-5 years of age in severe cases, results in short stature. Potential nervous complications are secondary to skeletal deformations. From the age of 2 to 5 years, hypoplasia of the odontoid vertebra combined with joint hyperlaxity leads to an instability at the level of the first two cervical vertebrae, with a risk of spinal cord compression. Facial dysmorphism includes prominent forehead, large mandible, and short neck. Respiratory impairment, with heavy restriction of lung capacity, susceptibility to pneumonia, and tracheal obstruction/narrowing, is often indicated by life-threatening sleep apnea, cor pulmonale or anesthetic complications. Extra-skeletal manifestations include hepatomegaly, valvulopathies, hearing loss, corneal clouding and dental hypoplasia. Intelligence is normal. Patients typically have low endurance, debilitating fatigue, and pain. Many patients become wheelchair-dependent in their second decade.

VARIANTS

NM_000404.3(GLB1):c.1310A>T ; NM_000404.3(GLB1):c.145C>T ; NM_001317040.1(GLB1):c.745C>T ; NM_000404.3(GLB1):c.1004C>T ; NM_000404.3(GLB1):c.1051C>T ; NM_000404.3(GLB1):c.1174_1175delCT ; NM_000404.3(GLB1):c.1321G>A ; NM_000404.3(GLB1):c.1325G>A ; NM_000404.3(GLB1):c.1456_1466dupGGTGCATATAT ; NM_000404.2(GLB1):c.1646C>T ; NM_000404.3(GLB1):c.171C>G ; NM_000404.3(GLB1):c.1733A>G ; NM_000404.3(GLB1):c.175C>T ; NM_000404.2(GLB1):c.442C>A ; NM_000404.2(GLB1):c.442C>T ; NM_000404.2(GLB1):c.602G>A ; NM_000404.3(GLB1):c.901G>A ; NM_000404.3(GLB1):c.947A>G ; NM_000404.2:c.1068.1G-T ; NM_000404.3(GLB1):c.1313G>A ; NM_000404.2:c.1355dupA ; NM_000404.3(GLB1):c.1369C>T ; NM_000404.3(GLB1):c.1370G>A ; NM_000404.3(GLB1):c.1445G>A ; NM_000404.3(GLB1):c.152T>C ; NM_000404.2:c.1549G-T ; NM_000404.3(GLB1):c.1572dup ; NM_000404.2(GLB1):c.176G>A ; NM_000404.2(GLB1):c.202C>T ; NM_000404.3(GLB1):c.276G>A ; NM_000404.3(GLB1):c.457+2T>C ; c.591dup ; NM_000404.3(GLB1):c.622C>T ; NM_000404.3(GLB1):c.818G>T

GENE

GLDC

DISEASES
Atypical glycine encephalopathy
SUMMARY

A rare form of glycine encephalopathy presenting disease onset or clinical manifestations that differ from neonatal or infantile glycine encephalopathy.

CLINICAL DESCRIPTION

Symptoms are mostly non-specific and are not similar to the severe neurological symptoms observed in neonatal and infantile GE (see these terms). Some patients have milder disease with onset from late infancy to adulthood, while others have rapidly progressive severe disease often of late onset. It also includes patients with transient hyperglycinemia, whose symptoms in neonatal period resemble those of neonatal form. Manifestations include cognitive decline, behavioral disorders, ataxia, peripheral neuropathy and optic atrophy.

Infantile glycine encephalopathy
SUMMARY

Infantile glycine encephalopathy is a mild to severe form of glycine encephalopathy (GE; see this term), characterized by early hypotonia, developmental delay and seizures.

CLINICAL DESCRIPTION

Patients present with infantile-onset seizures and variable psychomotor delay after initially normal development, and often have a relatively long history of hypotonia. Seizures of any type are found in less than half of patients and some develop choreoathetosis. Developmental delay mostly affects language and behavioral problems are sometimes found including temper tantrums, irritability, aggressiveness and rage. Attention deficit-hyperactivity disorder (AD-HD) is also sometimes found. Patients do not have lethargy or coma in the neonatal period, unlike those with neonatal GE. The course may be mild or severe (50% of patients in each case).

Neonatal glycine encephalopathy
SUMMARY

Neonatal glycine encephalopathy is a frequent, usually severe form of glycine encephalopathy (GE; see this term) characterized by coma, apnea, hypotonia, seizure and myoclonic jerks in the neonatal period, and subsequent developmental delay.

CLINICAL DESCRIPTION

Patients develop disease manifestations within the first hours or days of life. Symptoms include progressive lethargy, hypotonia, myoclonic jerks leading to apnea. In the absence of intubation and ventilation, apnea may be fatal. With supportive measures, most patients regain spontaneous respiration and some show improvement in alertness over time. Subsequently, they have profound intellectual deficit and increasingly intractable seizures over the first year of life, which often require multiple anticonvulsants. In the vast majority of cases (85%), the course is severe, but some patients have a milder course and less severe clinical outcome. In severe cases, patients make little developmental progress and have limited interaction with their environment. Early spasticity, scoliosis and club feet have also been reported. In milder cases, developmental progress is considerably greater with patients learning to walk and interact, and seizures are generally easier to treat.

VARIANTS

NM_000170.2(GLDC):c.1705G>A ; NM_000170.2(GLDC):c.1166C>T ; NM_000170.2(GLDC):c.1545G>C ; NM_000170.2(GLDC):c.2216G>A ; NM_000170.2(GLDC):c.2284G>A ; NM_000170.2(GLDC):c.1691G>T ; NM_000170.2(GLDC):c.2405C>T ; c.322G>T

GENE

GLE1

DISEASES
Amyotrophic lateral sclerosis
SUMMARY

A neurodegenerative disease characterized by progressive muscular paralysis reflecting degeneration of motor neurons in the primary motor cortex, corticospinal tracts, brainstem and spinal cord.

CLINICAL DESCRIPTION

Approximately two thirds of patients with typical ALS have a spinal form of the disease (limb onset) and present with symptoms related to focal muscle weakness and wasting, in which onset of symptoms may start either distally or proximally in the upper and lower limbs. Gradually, spasticity may develop in the weakened atrophic limbs, affecting manual dexterity and gait. Patients with bulbar onset ALS usually present with dysarthria and dysphagia for solids or liquids. Limb symptoms can develop almost simultaneously with bulbar symptoms, and in the vast majority of cases will occur within 1-2 years. Paralysis is progressive and leads to death due to respiratory failure within 2-3 years for bulbar onset cases and 3-5 years for limb onset ALS cases.

Arthrogryposis-anterior horn cell disease syndrome
SUMMARY

A rare arthrogryposis syndrome characterized by the association of arthrogryposis multiplex congenita and a severe form of motor neuron disease with loss of anterior horn cells in the spinal cord. Patients present with fetal akinesia deformation sequence with multiple contractures and facial anomalies, such as low-set ears, hypoplastic jaw, and short neck, as well as hypotonia and respiratory insufficiency. Some patients may survive into childhood and show developmental delay, markedly decreased muscle bulk, dystonic and involuntary movements, ataxia, and poor speech.

CLINICAL DESCRIPTION

Congenital arthrogryposis with anterior horn cell disease (CAAHD) is an autosomal recessive neuromuscular disorder with highly variable severity. Affected individuals are usually noted to have contractures in utero on prenatal ultrasound studies, and present at birth with generalized contractures manifest as arthrogryposis multiplex congenita (AMC). Patients have severe hypotonia with respiratory insufficiency, often resulting in death in infancy or early childhood. Some patients may survive into later childhood with supportive care, but may be unable to walk or sit independently due to a combination of muscle weakness and contractures. Cognition may be normal. The disorder also includes multiple congenital anomalies associated with AMC and hypotonia, including high-arched palate, myopathic facies, and bulbar weakness. Neuropathologic studies demonstrate severe loss of anterior horn cells in the spinal cord, as well as diffuse motor neuron axonopathy.

Lethal congenital contracture syndrome type 1
SUMMARY

Autosomal recessive lethal congenital contracture syndrome (LCCS) is the most severe, neonatally lethal, form of arthrogryposis, a disorder characterized by congenital nonprogressive joint contractures. The contractures can involve the upper or lower limbs and/or the vertebral column, leading to various degrees of flexion or extension limitations evident at birth.

CLINICAL DESCRIPTION

Lethal congenital contracture syndrome type 1 is a rare, genetic arthrogryposis syndrome characterized by total fetal akinesia (detectable since the 13th week of gestation) accompanied by hydrops, micrognathia, pulmonary hypoplasia, pterygia and multiple joint contractures (usually flexion contractures in the elbows and extension in the knees), leading invariably to death before the 32nd week of gestation. Lack of anterior horn motoneurons, severe atrophy of the ventral spinal cord and severe skeletal muscle hypoplasia are characteristic neuropathological findings, with no evidence of other organ structural anomalies.

VARIANTS

NM_001003722.1:c.1412_1413delAG ; NM_001003722.1(GLE1):c.2051T>C ; NM_001003722.1:c.2069_2072delTTCT ; c.898-2A>G

GENE

GNE

DISEASES
GNE myopathy
SUMMARY

GNE myopathy is a rare autosomal recessive distal myopathy characterized by early adult-onset, slowly to moderately progressive distal muscle weakness that preferentially affects the tibialis anterior muscle and that usually spares the quadriceps femoris. Muscle biopsy reveals presence of rimmed vacuoles.

CLINICAL DESCRIPTION

The disease usually starts during the third decade of life (but the onset may range from the early teens to the 5th decade). Typically, distal weakness in the legs with foot drop is the first sign, followed by (usually) slow progression to the proximal muscles (thigh) and the upper limbs (hand muscles). Shoulder girdle muscles are subsequently involved, with relative sparing of the triceps. Neck flexor muscles are also commonly affected. A unique clinical pattern of this myopathy is sparing of quadriceps in spite of major involvement of other thigh muscles. Unusual patterns of onset in proximal lower limb musculature and even in the upper limbs have been observed. Ocular, pharyngeal, and cardiac muscles are usually spared. Respiratory muscles are generally not affected until the very late stages in wheelchair-bound patients. Occasionally, affected individuals may present facial weakness.

Sialuria
SUMMARY

Sialuria is a rare inborn error of metabolism in which excessive free sialic acid is synthesized. Clinical features include hepatosplenomegaly, coarse facial features, and varying degrees of developmental delay.

CLINICAL DESCRIPTION

Sialuria is an extremely rare metabolic disorder described in fewer than 10 patients to date and characterized by variable signs and symptoms, mostly in infancy, including transient failure to thrive, slightly prolonged neonatal jaundice, equivocal or mild hepatomegaly, microcytic anemia, frequent upper respiratory infections, gastroenteritis, dehydration and flat and coarse facies. Learning difficulties and seizures may occur in childhood.

VARIANTS

NM_001128227.2(GNE):c.1891G>A ; NM_005476.5(GNE):c.2086G>A ; c.2086G>A ; NM_001128227.2(GNE):c.478C>T ; NM_001128227.2(GNE):c.830G>A ; NM_001128227.2(GNE):c.1002T>A ; NM_001128227.2(GNE):c.1820G>A ; NM_001128227.2(GNE):c.1937C>G ; NM_005476.7:c.2228T>C ; c.880C>T

GENE

GNPTAB

DISEASES
Mucolipidosis type II
SUMMARY

Mucolipidosis II (MLII) is a slowly progressive lysosomal disorder characterized by growth retardation, skeletal abnormalities, facial dysmorphism, stiff skin, developmental delay and cardiomegaly.

CLINICAL DESCRIPTION

Infants present at birth with hypotonia, growth retardation and gradually worsening skeletal deformities, including ulnar deviation of hands with broadening and camptomelic fingers, kyphosis, hip dislocation, clubfeet and deformed long bones. A limited range of motion of shoulder joints is noted at birth. Neonatal transient hyperparathyroidism has been documented in severe cases of MLII. Flat face, shallow orbits with proptotic eyes, depressed nasal bridge, prominent mouth and gingival hypertrophy are apparent soon after birth. Coarsening of facial features is progressive. Skin is stiff and thickened, especially around the earlobes. Early motor milestones are delayed and cognitive functioning is below normal. Postnatal growth usually stops in the 2nd year of life and contractures develop in all joints. Most patients never walk. Cardiac involvement most commonly includes the thickening and insufficiency of the mitral or aortic valves. Voice is hoarse and breathing is noisy due to the progressive narrowing of airways, mucosal thickening and stiffening of all connective tissues which, along with cardiac involvement, leads to cardiorespiratory insufficiency.

Mucolipidosis type III alpha/beta
SUMMARY

Mucolipidosis III alpha/beta (MLIII alpha/beta) is a lysosomal disorder characterized by progressive slowing of the growth rate from early childhood, stiffness and pain in joints, gradual coarsening of facial features, moderate developmental delay and mild intellectual disability in most patients.

CLINICAL DESCRIPTION

Infants appear normal at birth. Onset is gradual and usually observed at around the age of 3 years with slowing of growth rate and apparent shoulder, hip and knee contractures. Dysmorphic facial features (full cheeks, depressed nasal bridge, prominent mouth and inconsistently mild gingival hypertrophy) are mild but coarsen with age. Otitis media is common in the young. Functional changes in hard and soft connective tissues result in a slowly progressive reduction in the range of motion in the shoulders, hips and knees. Gradual hardening of the cardiac valves, from childhood onwards, ultimately leads to cardiac insufficiency. Gait slows in childhood, becoming increasingly painful due to severe hip disease. Bone pain, even at rest, results from osteoporosis and osteolytic bone lesions. Moderate claw-like flexion deformity of the fingers and carpal tunnel syndrome are common complications. Bronchitis/bronchopneumonia is frequent in childhood and gradual restrictive lung disease becomes life-threatening in older patients. Mild intellectual disability has been reported in most patients. Death is often due to treatment-refractory cardiopulmonary failure.

VARIANTS

NM_024312.4(GNPTAB):c.1000C>T ; NM_024312.4(GNPTAB):c.10A>C ; NM_024312.4(GNPTAB):c.1906dupA ; NM_024312.4(GNPTAB):c.3410T>A ; NM_024312.4(GNPTAB):c.648_651delAGAA ; NM_024312.4(GNPTAB):c.749dupA ; NM_024312.4(GNPTAB):c.99delC ; NM_024312.4(GNPTAB):c.1196C>T ; NM_024312.4(GNPTAB):c.1759C>T ; NM_024312.4:c.2383delG ; c.25C>T ; NM_024312.4(GNPTAB):c.2896delA ; NM_024312.4(GNPTAB):c.3173C>G ; NM_024312.4(GNPTAB):c.3326dupA ; NM_024312.4(GNPTAB):c.3503_3504delTC ; NM_024312.4(GNPTAB):c.3560_3561delAG ; NM_024312.4(GNPTAB):c.3565C>T ; c.3663del ; NM_024312.4(GNPTAB):c.616_619delACAG ; NM_024312.4(GNPTAB):c.732_733delAA

GENE

GNS

DISEASES
Sanfilippo syndrome type D
SUMMARY

CLINICAL DESCRIPTION

VARIANTS

NM_002076.3(GNS):c.1063C>T ; NM_002076.3(GNS):c.1168C>T ; NM_002076.3(GNS):c.1169del ; NM_002076.3(GNS):c.1226_1227insG ; NM_002076.3:c.413C-G

GENE

GRHPR

DISEASES
Primary hyperoxaluria type 2
SUMMARY

A disorder of glyoxylate metabolism characterized by an excess of oxalate resulting in kidney stones, nephrocalcinosis and ultimately renal failure and systemic oxalosis. There are 3 types of PH, types 1-3, all caused by liver-specific enzyme defects.

CLINICAL DESCRIPTION

Hyperoxaluria may lead to kidney stones, nephrocalcinosis and ultimately renal failure and systemic oxalosis. Symptoms can appear at any age and may vary from infantile failure to thrive and cortical nephrocalcinosis with renal failure to hematuria, medullary nephrocalcinosis or sporadic stone disease, even within one family. PH1 is the most severe form; overall, more than 70% of PH1 patients develop end-stage kidney disease over time; this may even occur in patients with sporadic stone disease. Storage of oxalate occurs in severe renal failure and may affect bone, eyes, heart, arteries and peripheral nerves (systemic oxalosis). PH2 has a more benign course; no infantile oxalosis has been described and end-stage kidney disease occurs at relatively late age in about 20% of patients. PH3 is most benign with so far only a few reports of renal impairment and no end-stage kidney disease.

VARIANTS

NM_012203.1(GRHPR):c.755dupA ; NM_012203.1(GRHPR):c.103delG ; NM_012203.1(GRHPR):c.295C>T ; NM_012203.1:c.435G-A ; NM_012203.1:c.622C-T

GENE

GUCY2D

DISEASES
Central areolar choroidal dystrophy
SUMMARY

Central areolar choroidal dystrophy (CACD) is a hereditary macular disorder, usually presenting between the ages of 30-60, characterized by a large area of atrophy in the centre of the macula and the loss or absence of photoreceptors, retinal pigment epithelium and choriocapillaris in this area, resulting in a progressive decrease in visual acuity.

CLINICAL DESCRIPTION

Central areolar choroidal dystrophy (CACD) is a hereditary retinal disorder that principally affects the macula, often resulting in a well-defined area of atrophy of the retinal pigment epithelium (RPE) and choriocapillaris in the center of the macula. Dysfunction of macular photoreceptors usually leads to a decrease in visual acuity, generally occurring between the ages of 30 and 60 years.

Cone rod dystrophy
SUMMARY

A rare genetic isolated inherited retinal disorder characterized by primary cone degeneration with significant secondary rod involvement, with a variable fundus appearance. Typical presentation includes decreased visual acuity, central scotoma, photophobia, color vision alteration, followed by night blindness and loss of peripheral visual field.

CLINICAL DESCRIPTION

Cone rod dystrophy (CRD) is characterized by primary cone involvement or, occasionally, by concomitant loss of both cones and rods, explaining the predominant symptoms of CRDs: decreased visual acuity, color vision defects, photoaversion and decreased sensitivity in the central visual field, later followed by progressive loss in peripheral vision and night blindness. The fundus appearance is varaible ranging from normal in the early stages, with only subtle temporal optic nerve pallor, macular pigment migration and atrophy or a bull's-eye maculopathy, to peripheral retinal pigment epithelium atrophy, intra retinal pigmentation migration, arteriolar attenuation, and optic disc pallor as disease progresses. Cone-rod dystrophy (CRD) should be distinguished from rod-cone dystrophy (RCD), also known as retinitis pigmentosa. Unlike RCD, which typically start with night blindness and progressive visual field constriction while central vision is preserved until late stages, CRD is characterized by a primary decrease in central vision leading to earlier legal blindness. At end stage, however, CRDs do not differ from end stage RCDs. CRDs are most frequently nonsyndromic, however they may also be part of several syndromes, such as Alström syndrome, Bardet-Biedl syndrome and Spinocerebellar Ataxia Type 7.

Leber congenital amaurosis
SUMMARY

Leber congenital amaurosis (LCA) is a retinal dystrophy defined by blindness and responses to electrophysiological stimulation (Ganzfeld electroretinogram (ERG)) below threshold, associated with severe visual impairment within the first year of life.

CLINICAL DESCRIPTION

LCA is characterized by severely reduced visual acuity (less or equal 20/400) or blindness within in the first year of life. Sluggish pupillary responses, roving eye movement, photophobia, high hyperopia, nystagmus, convergent strabismus, or keratoconus may occur depending on the genetic cause. The Franceschetti's oculo-digital sign, comprising eye poking, pressing, and rubbing is pathognomonic. LCA may be associated with mutations in genes linked to syndromes presenting with neurodevelopmental delay, intellectual disability, oculomotor apraxia-type behavior (difficulty moving the eye) and renal dysfunction.

VARIANTS

NM_000180.3(GUCY2D):c.1694T>C ; NM_000180.3:c.2735_2736delTT ; c.2945del ; NM_000180.3:c.456C-A ; NM_000180.3(GUCY2D):c.620delC

GENE

GUSB

DISEASES
Mucopolysaccharidosis type 7
SUMMARY

A rare, genetic lysosomal storage disease characterized by accumulation of glycosaminoglycans in connective tissue which results in progressive multisystem involvement with severity ranging from mild to severe. The most consistent features include musculoskeletal involvement (particularly dysostosis multiplex, joint restriction, thorax abnormalities, and short stature), limited vocabulary, intellectual disability, coarse facies with a short neck, pulmonary involvement (predominantly decreased pulmonary function), corneal clouding, and cardiac valve disease.

CLINICAL DESCRIPTION

Signs are extremely variable: there are prenatal forms with non-immune hydrops fetalis, and severe neonatal forms with dysmorphism, hernias, hepatosplenomegaly, club feet, dysostosis, small stature and severe hypotonia and neurological involvement that ultimately lead to profound intellectual deficit in patients who survive. At the other end of the spectrum, there are very mild cases that are discovered during adolescence or adulthood following presentation with thoracic kyphosis.

VARIANTS

NM_000181.3(GUSB):c.1144C>T ; NM_000181.3(GUSB):c.1534G>A ; NM_000181.3(GUSB):c.1050G>C ; NM_000181.3(GUSB):c.1061C>T ; NM_000181.3:c.1065.1G-T ; NM_000181.3(GUSB):c.1084G>A ; NM_000181.3:c.1219_1220insC ; c.1244+1G>A ; NM_000181.3(GUSB):c.1337G>A ; NM_000181.3(GUSB):c.1338G>A ; NM_000181.4(GUSB):c.1429C>T ; NM_000181.3(GUSB):c.1521G>A ; NM_000181.3:c.1618G-T ; NM_000181.3(GUSB):c.1730G>T ; NM_000181.3(GUSB):c.1831C>T ; NM_000181.3(GUSB):c.1856C>T ; NM_000181.3(GUSB):c.1881G>T ; NM_000181.3(GUSB):c.442C>T ; NM_000181.3:c.499C-T ; NM_000181.3(GUSB):c.526C>T ; NM_000181.3(GUSB):c.646C>T ; c.820_821del ; NM_000181.3(GUSB):c.866G>A

GENE

HADHA

DISEASES
Acute fatty liver of pregnancy
SUMMARY

Isolated deficiency of long-chain 3-hydroxyl-CoA dehydrogenase (LCHAD) is an autosomal recessive disorder characterized by early-onset cardiomyopathy, hypoglycemia, neuropathy, and pigmentary retinopathy, and sudden death.

CLINICAL DESCRIPTION

A rare, severe complication occurring in the third trimester of pregnancy or in early postpartum period bearing a risk for perinatal and maternal mortality and characterized by jaundice, rise of hepatic injuries and evolving to acute liver failure and encephalopathy.

Long chain 3-hydroxyacyl-CoA dehydrogenase deficiency
SUMMARY

A mitochondrial disorder of long chain fatty acid oxidation characterized in most patients by onset in infancy/ early childhood of hypoketotic hypoglycemia, metabolic acidosis, liver disease, hypotonia and, frequently, cardiac involvement with arrhythmias and/or cardiomyopathy.

CLINICAL DESCRIPTION

Most patients display a severe phenotype that presents in infancy, usually from the neonatal period up until 12 months of age. The disease manifests as hypoketotic hypoglycemia, metabolic acidosis, hypotonia, liver involvement with hepatic encephalopathy, cardiomyopathy and arrhythmias. Clinical presentation is frequently preceded by fasting and/or intercurrent illness and often presents with hypoketotic hypoglycemia. Chronic peripheral neuropathy and pigmentary retinopathy develop over time in many surviving patients. Rarer presentations of LCHADD are sudden cardiac arrest or sudden infant death. HELLP syndrome (see this term) often occurs in pregnant women carrying a fetus affected with LCHADD.

Mitochondrial trifunctional protein deficiency
SUMMARY

A rare disorder of fatty acid oxidation characterized by a wide clinical spectrum ranging from severe neonatal manifestations including cardiomyopathy, hypoglycemia, metabolic acidosis, skeletal myopathy and neuropathy, liver disease and death to a mild phenotype with peripheral polyneuropathy, episodic rhabdomyolysis and pigmentary retinopathy..

CLINICAL DESCRIPTION

The neonatal onset, severe form manifests as hepatic steatosis, cardiomyopathy, skeletal myopathy and neuropathy and is usually fatal. A moderately severe form, with onset usually from the neonatal period to 18 months of age, presents primarily with hypoketotic hypoglycemia and metabolic acidosis which is often precipitated by prolonged fasting and/or intercurrent illness. Both forms can manifest with neuropathy with or without cardiomyopathy and can be fatal. The mild form merges with the moderately severe infantile form and can present from a few months of age until adolescence as a peripheral polyneuropathy with episodic rhabdomyolysis triggered by prolonged fasting, illness, exercise or exposure to heat or cold. There is respiratory failure associated with the episodes of rhabdomyolysis. A pigmentary retinopathy may also develop over time. Very occasionally, adults presenting for the first time with a previously unrecognized disease are described.

VARIANTS

NM_000182.4(HADHA):c.1132C>T ; NM_000182.4(HADHA):c.1620+2_1620+6del5 ; NM_000182.4(HADHA):c.1793_1794delAT ; NM_000182.4(HADHA):c.2146+1G>A ; NM_000182.4(HADHA):c.274_278delTCATC ; NM_000182.4(HADHA):c.919-2A>G ; c.1422dup ; NM_000182.4(HADHA):c.1528G>C ; NM_000182.4(HADHA):c.1678C>T ; NM_000182.4(HADHA):c.1918C>T ; NM_000182.4:c.499delA ; NM_000182.4(HADHA):c.845T>A ; NC_000002.12:g.26191499dup ; NC_000002.12:g.26194616del

GENE

HADHB

DISEASES
Mitochondrial trifunctional protein deficiency
SUMMARY

A rare disorder of fatty acid oxidation characterized by a wide clinical spectrum ranging from severe neonatal manifestations including cardiomyopathy, hypoglycemia, metabolic acidosis, skeletal myopathy and neuropathy, liver disease and death to a mild phenotype with peripheral polyneuropathy, episodic rhabdomyolysis and pigmentary retinopathy..

CLINICAL DESCRIPTION

The neonatal onset, severe form manifests as hepatic steatosis, cardiomyopathy, skeletal myopathy and neuropathy and is usually fatal. A moderately severe form, with onset usually from the neonatal period to 18 months of age, presents primarily with hypoketotic hypoglycemia and metabolic acidosis which is often precipitated by prolonged fasting and/or intercurrent illness. Both forms can manifest with neuropathy with or without cardiomyopathy and can be fatal. The mild form merges with the moderately severe infantile form and can present from a few months of age until adolescence as a peripheral polyneuropathy with episodic rhabdomyolysis triggered by prolonged fasting, illness, exercise or exposure to heat or cold. There is respiratory failure associated with the episodes of rhabdomyolysis. A pigmentary retinopathy may also develop over time. Very occasionally, adults presenting for the first time with a previously unrecognized disease are described.

VARIANTS

NM_000183.2(HADHB):c.1331G>A ; NM_000183.2(HADHB):c.1364T>G ; NM_000183.2(HADHB):c.788A>G

GENE

HBA1

DISEASES
Alpha-thalassemia-intellectual disability syndrome linked to chromosome 16
SUMMARY

A rare developmental defect during embryogenesis, a contiguous gene deletion syndrome, is a form of alpha-thalassemia characterized by microcytosis, hypochromia, normal hemoglobin (Hb) level or mild anemia, associated with developmental abnormalities.

CLINICAL DESCRIPTION

ATR-16 is a congenital disease. Patients present with either alpha-thalassemia trait or mild hemoglobin H disease (HbH disease) associated with a mild to profound (in most cases) intellectual disability and, in some cases, with mild, nonspecific dysmorphic features (mild hypertelorism, down slanted palpebral fissures, broad or prominent nasal bridge, small ears, short neck), microcephaly and short stature. Genital abnormalities (hypospadias and cryptorchidism) have been reported in males. Club foot is common.

Hb Bart's hydrops fetalis
Hemoglobin H disease
SUMMARY

An intermediate form of alpha-thalassemia characterized by increased hemolysis and mild to severe anemia with marked microcytosis and hypochromia. Hemoglobin H disease (HbH) disease belongs to the group of nontransfusion-dependent thalassemia.

CLINICAL DESCRIPTION

Clinical features are highly variable and generally develop in the first years of life. Initial signs may be noticed only during routine hematologic analyses. Patients have variable microcytic hypochromic hemolytic anemia, requiring no or occasional blood transfusions during infectious episodes, exposure to oxidizing agents or pregnancy. Splenomegaly is frequently found. Non-deletional forms of alpha-thalassemia typically have more severe anemia, splenomegaly, hepatomegaly, cholelithiasis, growth retardation, decreased bone density; and have earlier and more frequent transfusion requirements. Skeletal changes mainly affecting the face can rarely occur in non-deletional forms. Iron overload develops secondary to increased intestinal iron absorption even in the absence of transfusion.

Hemoglobin M disease
SUMMARY

A rare hemoglobinopathy characterized by the presence of hemoglobin variants with structural abnormalities in the globin portion of the molecule which lead to auto-oxidation of heme iron, resulting in methemoglobinemia. Patients present with cyanosis for which no treatment is necessary. Mode of inheritance is autosomal dominant.

CLINICAL DESCRIPTION

Methemoglobinemia is a clinical condition in which more than 1% of hemoglobin is oxidized to methemoglobin, a type of hemoglobin that contains the ferric (Fe3+) form of iron. Patients with hemoglobin M are cyanotic but otherwise asymptomatic. If the mutation occurs in the hemoglobin alpha subunit, cyanosis is apparent at birth, whereas if the beta chain is affected, cyanosis appears later or intensifies when beta subunit production increases. If a newborn carries a fetal M hemoglobin (gamma subunit), cyanosis disappears when the complete gamma-beta-switch occurs.

VARIANTS

NM_000558.4(HBA1):c.207C>G ; NM_000558.3(HBA1):c.287C>T ; NM_000558.3(HBA1):c.389T>C ; HbG-Philadelphia ; HbQ-Thailand ; NM_000558.3(HBA1):c.134C>T ; NM_000558.3(HBA1):c.179G>A ; NM_000558.3(HBA1):c.187_189delGTG ; NM_000558.4:c.187delG ; NM_000558.4:c.1A-G ; NM_000558.3(HBA1):c.20A>G ; NM_000558.5(HBA1):c.237del ; NM_000558.5(HBA1):c.265G>T ; NM_000558.3(HBA1):c.278G>A ; NM_000558.3(HBA1):c.278G>T ; NM_000558.4:c.2T-C ; NM_000558.5(HBA1):c.379G>C ; c.396dup ; NM_000558.5(HBA1):c.410T>G ; NM_000558.5(HBA1):c.421T>C ; NM_000558.3(HBA1):c.424C>T ; NM_000558.3(HBA1):c.425G>A ; NM_000558.3(HBA1):c.425G>T ; c.427T>C ; NM_000558.4(HBA1):c.43T>C ; c.44G>A

GENE

HBA2

DISEASES
Alpha-thalassemia-intellectual disability syndrome linked to chromosome 16
SUMMARY

A rare developmental defect during embryogenesis, a contiguous gene deletion syndrome, is a form of alpha-thalassemia characterized by microcytosis, hypochromia, normal hemoglobin (Hb) level or mild anemia, associated with developmental abnormalities.

CLINICAL DESCRIPTION

ATR-16 is a congenital disease. Patients present with either alpha-thalassemia trait or mild hemoglobin H disease (HbH disease) associated with a mild to profound (in most cases) intellectual disability and, in some cases, with mild, nonspecific dysmorphic features (mild hypertelorism, down slanted palpebral fissures, broad or prominent nasal bridge, small ears, short neck), microcephaly and short stature. Genital abnormalities (hypospadias and cryptorchidism) have been reported in males. Club foot is common.

Hb Bart's hydrops fetalis
Hemoglobin H disease
SUMMARY

An intermediate form of alpha-thalassemia characterized by increased hemolysis and mild to severe anemia with marked microcytosis and hypochromia. Hemoglobin H disease (HbH) disease belongs to the group of nontransfusion-dependent thalassemia.

CLINICAL DESCRIPTION

Clinical features are highly variable and generally develop in the first years of life. Initial signs may be noticed only during routine hematologic analyses. Patients have variable microcytic hypochromic hemolytic anemia, requiring no or occasional blood transfusions during infectious episodes, exposure to oxidizing agents or pregnancy. Splenomegaly is frequently found. Non-deletional forms of alpha-thalassemia typically have more severe anemia, splenomegaly, hepatomegaly, cholelithiasis, growth retardation, decreased bone density; and have earlier and more frequent transfusion requirements. Skeletal changes mainly affecting the face can rarely occur in non-deletional forms. Iron overload develops secondary to increased intestinal iron absorption even in the absence of transfusion.

Hemoglobin M disease
SUMMARY

A rare hemoglobinopathy characterized by the presence of hemoglobin variants with structural abnormalities in the globin portion of the molecule which lead to auto-oxidation of heme iron, resulting in methemoglobinemia. Patients present with cyanosis for which no treatment is necessary. Mode of inheritance is autosomal dominant.

CLINICAL DESCRIPTION

Methemoglobinemia is a clinical condition in which more than 1% of hemoglobin is oxidized to methemoglobin, a type of hemoglobin that contains the ferric (Fe3+) form of iron. Patients with hemoglobin M are cyanotic but otherwise asymptomatic. If the mutation occurs in the hemoglobin alpha subunit, cyanosis is apparent at birth, whereas if the beta chain is affected, cyanosis appears later or intensifies when beta subunit production increases. If a newborn carries a fetal M hemoglobin (gamma subunit), cyanosis disappears when the complete gamma-beta-switch occurs.

VARIANTS

NM_000517.6(HBA2):c.*92A>G ; NM_000517.6(HBA2):c.114_115insGAA ; NM_000517.4(HBA2):c.142G>C ; NM_000517.4(HBA2):c.326C>A ; NM_000517.6(HBA2):c.391G>C ; NM_000517.6(HBA2):c.69C>T ; NM_000517.4(HBA2):c.91_93delGAG ; NM_000517.6(HBA2):c.98T>G ; HbConstant ; HbG-Philadelphia ; HbQuong ; HbT-Saudi ; NM_000517.4(HBA2):c.*93_*94delAA ; NM_000517.6(HBA2):c.118_124delACCAAGAinsTACTTC ; NM_000517.4(HBA2):c.122A>T ; NM_000517.6(HBA2):c.178G>C ; NM_000517.4(HBA2):c.179G>A ; NM_000517.6(HBA2):c.186G>C ; NM_000517.4:c.207C-A ; NM_000517.6(HBA2):c.266C>T ; NM_000517.6(HBA2):c.301-1G>A ; NM_000517.6(HBA2):c.314G>A ; NM_000517.4(HBA2):c.345delC ; NM_000517.6(HBA2):c.349G>T ; NM_000517.4(HBA2):c.379G>T ; NM_000517.6(HBA2):c.410T>C ; NM_000517.6(HBA2):c.418A>G ; NM_000517.4(HBA2):c.420del ; NM_000517.4(HBA2):c.427T>A ; NM_000517.4(HBA2):c.427T>G ; NM_000517.6(HBA2):c.428A>C ; NM_000517.4(HBA2):c.429A>T ; NM_000517.4:c.56delG ; NM_000517.4(HBA2):c.60delG ; NM_000517.4(HBA2):c.69delC ; NM_000517.6(HBA2):c.70G>T ; NM_000517.6(HBA2):c.75T>G ; NM_000517.6(HBA2):c.89T>C ; NM_000517.4(HBA2):c.94_95delAG ; NM_000517.4(HBA2):c.95+1G>A ; NM_000517.4(HBA2):c.95+2_95+6delTGAGG ; NM_000517.6(HBA2):c.96-2A>G; -α3.7 ; -α4.2 ; -α20.5 ; --MEA ; --SEA

GENE

HBB

DISEASES
Beta-thalassemia intermedia
SUMMARY

Beta-thalassemia (BT) intermedia is a form of BT (see this term) characterized by mild to moderate anemia which does not or only occasionally requires transfusion.

CLINICAL DESCRIPTION

BT intermedia encompasses a wide clinical spectrum with more severe cases presenting between 2 and 6 years of age with anemia, spleen and sometimes liver enlargement, as well as delayed growth and development. In other cases, patients are completely asymptomatic until adult life with only mild anemia. Hypertrophy of erythroid marrow, with the possibility of extramedullary erythropoiesis, is common and leads to characteristic deformities of the bone and face, osteoporosis with pathologic fractures of long bones and formation of erythropoietic masses primarily affecting the spleen, liver, lymph nodes, chest and spine. Less commonly, erythroid marrow hypertrophy may cause neurological problems (spinal cord compression with paraplegia). Patients may also develop leg ulcers and gallstones. An increased predisposition to thrombosis versus BT major has been reported, especially after splenectomy. Although patients are at risk of iron overload, hypogonadism, hypothyroidism and diabetes are not common. Cardiac involvement may also occur as a result of a high-output state and pulmonary hypertension, while systolic left ventricle function is usually preserved.

Beta-thalassemia major
SUMMARY

Beta-thalassemia (BT) major is a severe early-onset form of BT (see this term) characterized by severe anemia requiring regular red blood cell transfusions.

CLINICAL DESCRIPTION

Onset is during infancy with severe anemia, failure to thrive and progressive pallor. Feeding problems, diarrhea, irritability, recurrent bouts of fever, and progressive enlargement of the abdomen caused by splenomegaly and hepatomegaly may occur. Untreated or poorly transfused patients show growth retardation, pallor, jaundice, poor musculature, genu valgum, leg ulcers, formation of masses due to extramedullary hematopoiesis, and skeletal changes including deformities in the long bones of the legs and typical craniofacial changes such as bossing of the skull, prominent malar eminence, depression of the bridge of the nose, tendency to a mongoloid slant of the eye, and maxillae hypertrophy, which tends to expose upper teeth. In regularly transfused patients, growth and development tend to be normal but complications related to iron overload may develop, including growth retardation and failure or delay of sexual maturation. Later-onset iron overload complications include dilated myocardiopathy, arrhythmias, liver fibrosis and cirrhosis, diabetes mellitus, and insufficiency of the parathyroid, thyroid, pituitary, and, less commonly, adrenal glands. Other complications are hypersplenism, venous thrombosis and osteoporosis.

Delta-beta-thalassemia
SUMMARY

Delta-beta-thalassemia is a form of beta-thalassemia (see this term) characterized by decreased or absent synthesis of the delta- and beta-globin chains with a compensatory increase in expression of fetal gamma-chain synthesis.

CLINICAL DESCRIPTION

The heterozygous form of the condition is clinically asymptomatic with mild microcytosis and no elevation of HbA2 whereas the few homozygous patients have a mild clinical presentation. When inherited with heterozygous classical beta-thalassemia, patients usually have the thalassemia intermedia phenotype, but the thalassemia major phenotype has been described in some cases.

Dominant beta-thalassemia
SUMMARY

Dominant beta-thalassemia is a form of beta-thalassemia (see this term) resulting in moderate to severe anemia.

CLINICAL DESCRIPTION

Patients present with moderate to severe anemia, jaundice and splenomegaly.

Hemoglobin C disease
SUMMARY

Hemoglobin C disease (HbC) is a hemoglobinopathy characterized by production of abnormal variant hemoglobin known as hemoglobin C, with no or mild clinical manifestations (hemolytic anemia).

CLINICAL DESCRIPTION

0

Hemoglobin C-beta-thalassemia syndrome
SUMMARY

Hemoglobin C - beta-thalassemia (HbC - BT) is a form of beta-thalassemia (see this term) resulting in moderate hemolytic anemia.

CLINICAL DESCRIPTION

Patients are usually asymptomatic and diagnosed during routine tests. When present, clinical manifestations are moderate anemia and splenomegaly.

Hemoglobin D disease
SUMMARY

Hemoglobin D disease(HbD) is a hemoglobinopathy characterized by production of abnormal variant hemoglobin known as hemoglobin D, with no or mild clinical manifestations (splenomegaly, very mild anemia).

CLINICAL DESCRIPTION

0

Hemoglobin E disease
SUMMARY

Hemoglobin E disease (HbE) is a hemoglobinopathy characterized by production of abnormal variant hemoglobin known as hemoglobin E, with a generally benign, asymptomatic presentation.

CLINICAL DESCRIPTION

0

Hemoglobin E-beta-thalassemia syndrome
SUMMARY

Hemoglobin E - beta-thalassemia (HbE - BT) is a form of beta-thalassemia (see this term) that results in a mild to severe clinical presentation ranging from a condition indistinguishable from beta-thalassemia major to a mild form of beta-thalassemia intermedia (see these terms).

CLINICAL DESCRIPTION

Mild HbE - BT (about 15% of cases) is characterized by normal Hb levels (9-12 g/dl) and patients usually do not develop clinically significant symptoms. No treatment is required. Moderately severe forms (most cases) are characterized by decreased Hb levels (6-8 g/dl) and the clinical manifestations are similar to those of beta-thalassemia intermedia. Transfusions are not required unless infections precipitate further anemia. Iron overload may occur. Severe forms are characterized by very low Hb levels (4-5 g/dl) and patients present with manifestations similar to beta-thalassemia major and are treated as thalassemia major patients.

Hemoglobin Lepore-beta-thalassemia syndrome
SUMMARY

A rare beta-thalassemia associated with another hemoglobin anomaly characterized by the presence of the hemoglobin Lepore variant in association with beta-thalassemia. Clinical presentation is highly variable, depending on the type of beta-thalassemia, and ranges from severe hypochromic microcytic anemia and complete transfusion dependency to moderate, compensated anemia without a need for regular blood transfusions.

CLINICAL DESCRIPTION

Delta-beta thalassemia is a hemoglobin disorder characterized by decreased or absent synthesis of the delta- and beta-globin chains with a compensatory increase in expression of fetal gamma-chain synthesis from the affected chromosome. Individuals with delta-beta thalassemia have hypochromic, microcytic anemia and increased HbF, which may mitigate the anemia depending on the level of HbF. Delta-beta thalassemia and some forms of HPFH result from deletions within the beta-globin gene cluster on chromosome 11p15; this has been referred to as 'deletional' HPFH. HPFH can also result from point mutations in the promoter regions of the gamma globulin genes HBG1 and HBG2; this has been referred to as 'non-deletional' HPFH.

Hemoglobin M disease
SUMMARY

A rare hemoglobinopathy characterized by the presence of hemoglobin variants with structural abnormalities in the globin portion of the molecule which lead to auto-oxidation of heme iron, resulting in methemoglobinemia. Patients present with cyanosis for which no treatment is necessary. Mode of inheritance is autosomal dominant.

CLINICAL DESCRIPTION

Methemoglobinemia is a clinical condition in which more than 1% of hemoglobin is oxidized to methemoglobin, a type of hemoglobin that contains the ferric (Fe3+) form of iron. Patients with hemoglobin M are cyanotic but otherwise asymptomatic. If the mutation occurs in the hemoglobin alpha subunit, cyanosis is apparent at birth, whereas if the beta chain is affected, cyanosis appears later or intensifies when beta subunit production increases. If a newborn carries a fetal M hemoglobin (gamma subunit), cyanosis disappears when the complete gamma-beta-switch occurs.

Hereditary persistence of fetal hemoglobin-beta-thalassemia syndrome
SUMMARY

Hereditary persistence of fetal hemoglobin (HPFH) associated with beta-thalassemia (see this term) is characterized by high hemoglobin (Hb) F levels and an increased number of fetal-Hb-containing-cells.

CLINICAL DESCRIPTION

The association of HPFH with beta-thalassemia mitigates the clinical manifestations which vary from a normal state to beta-thalassemia intermedia (see this term).

Hereditary persistence of fetal hemoglobin-sickle cell disease syndrome
SUMMARY

Sickle cell anemia is a multisystem disease associated with episodes of acute illness and progressive organ damage. Hemoglobin polymerization, leading to erythrocyte rigidity and vasoocclusion, is central to the pathophysiology of the disease, but the importance of chronic anemia, hemolysis, and vasculopathy has been established.

CLINICAL DESCRIPTION

A rare, genetic, hemoglobinopathy characterized by generally mild clinical phenotype, high fetal hemoglobin levels and mild microcytosis and hypochromia. In some cases, acute sickle cell disease manifestations were reported, namely acute chest syndrome and acute pain crisis. The genotype is characterized by the combination of an HbS and HbF allele; symptoms depend on the degree of HbF:HbS expressivity with patients with more than 35% pancellular HbF expression being asymptomatic. Symptomatic patients have heterocellular expression of HbF.

Sickle cell anemia
SUMMARY

A severe form of sickle cell disease (SCD) characterized by homozygosity for the sickle hemoglobin (HbS) gene and which acutely manifests with severe anemia, susceptibility to severe bacterial infections, and ischemic vasoocclusive accidents (VOA). It is a red cell disease of genetic origin which manifests with hemolytic disease and loss of red cell deformability leading to other occlusive events.

CLINICAL DESCRIPTION

The disease does not manifest during fetal life or up to the first three months of life due to the presence of high levels of fetal hemoglobin. Clinical manifestations evolve with age and are extremely variable between individuals and at different times. In addition to anemia and bacterial infections, VOAs cause hyperalgic focal ischemia (and sometimes infarction) when they occur in the abdomen, chest or skeleton. Over the course of time, VOAs may compromise the integrity of tissues or organs.

Sickle cell-beta-thalassemia disease syndrome
SUMMARY

Beta-thalassemia is characterized by a reduced production of hemoglobin A (HbA, alpha-2/beta-2), which results from the reduced synthesis of beta-globin chains relative to alpha-globin chains, thus causing an imbalance in globin chain production and hence abnormal erythropoiesis. The disorder is clinically heterogeneous

CLINICAL DESCRIPTION

A rare, genetic hemoglobinopathy that affects red blood cells both in the production of abnormal hemoglobin, as well as the decreased synthesis of beta globin chains. Clinical manifestations depend on the amount of residual beta globin chains production, and are similar to sickle cell disease, including anemia, vascular occlusion and its complications, acute episodes of pain, acute chest syndrome, pulmonary hypertension, sepsis, ischemic brain injury, splenic sequestration crisis and splenomegaly.

Sickle cell-hemoglobin C disease syndrome
SUMMARY

A rare, genetic hemoglobinopathy characterized by anemia, reticulocytosis and erythrocyte abnormalities including target cells, irreversibly sickled cells and crystal-containing cells. Clinical course is similar to sickle cell disease, but less severe and with less complications. Signs and symptoms may include acute episodes of pain, splenic infarction and splenic sequestration crisis, acute chest syndrome, focal segmental glomerulosclerosis, ischemic brain injury, peripheral retinopathy, and osteonecrosis.

CLINICAL DESCRIPTION

VARIANTS

NM_000518.5(HBB):c.-75G>C ; NM_000518.4(HBB):c.-82C>T ; NM_000518.4(HBB):c.208G>A ; NM_000518.4(HBB):c.316-125A>G ; NM_000518.5(HBB):c.316-7C>G ; NM_000518.4(HBB):c.68A>C ; NM_000518.5(HBB):c.*110T>C ; NM_000518.4(HBB):c.*110_*111delTA ; NM_000518.5(HBB):c.*113A>G ; NM_000518.5(HBB):c.-136C>T ; NM_000518.5(HBB):c.-137C>A ; NM_000518.5(HBB):c.-137C>G ; NM_000518.5(HBB):c.-138C>A ; NM_000518.5(HBB):c.-138C>T ; NM_000518.5(HBB):c.-140C>T ; NM_000518.5(HBB):c.-50A>C ; NM_000518.4(HBB):c.-77_-76delAA ; NM_000518.5(HBB):c.-78A>G ; NM_000518.5(HBB):c.-80T>A ; NM_000518.5(HBB):c.114G>A ; NM_000518.4(HBB):c.137T>C ; NM_000518.5(HBB):c.147del ; NM_000518.4:c.176delC ; NM_000518.4(HBB):c.201delA ; NM_000518.4(HBB):c.203_204delTG ; NM_000518.5(HBB):c.217dup ; NM_000518.5(HBB):c.220_223dup ; NM_000518.4(HBB):c.226delC ; NM_000518.4(HBB):c.230delC ; NM_000518.5(HBB):c.249G>C ; NM_000518.4(HBB):c.251delG ; NM_000518.4(HBB):c.253delA ; NM_000518.4(HBB):c.2T>A ; NM_000518.5(HBB):c.2T>C ; NM_000518.4(HBB):c.315+2T>G ; NM_000518.5(HBB):c.315+2del ; NM_000518.5(HBB):c.316-3C>G ; NM_000518.5(HBB):c.316-7C>A ; NM_000518.5(HBB):c.328G>A ; NM_000518.4(HBB):c.33dup ; NM_000518.4(HBB):c.374C>G ; NM_000518.5(HBB):c.64dup ; NM_000518.5(HBB):c.75T>A ; NM_000518.5(HBB):c.82G>T ; NM_000518.5(HBB):c.85dup ; NM_000518.5(HBB):c.91A>C ; NM_000518.5(HBB):c.92+5G>A ; NM_000518.5(HBB):c.92G>A ; NM_000518.5(HBB):c.93-15T>G ; NC_000011.10:g.5226765_5226768del ; NM_000518.4(HBB):c.*110_*114del ; NM_000518.5(HBB):c.*111A>G ; NM_000518.5(HBB):c.*112A>G ; NM_000518.5(HBB):c.*6C>G ; NM_000518.5(HBB):c.-136C>G ; NM_000518.5(HBB):c.-137C>T ; NM_000518.5(HBB):c.-151C>T ; NM_000518.5(HBB):c.-18C>G ; NM_000518.5(HBB):c.-29G>A ; NM_000518.4(HBB):c.-41delT ; NM_000518.5(HBB):c.-78A>C ; NM_000518.5(HBB):c.-79A>G ; NM_000518.5(HBB):c.-81A>G ; NM_000518.5(HBB):c.-82C>A ; NM_000518.5(HBB):c.103G>T ; NM_000518.5(HBB):c.108C>A ; NM_000518.4(HBB):c.108del ; NM_000518.4(HBB):c.112delT ; NM_000518.4(HBB):c.114_120delGACCCAG ; NM_000518.4:c.115delA ; NM_000518.4(HBB):c.116_117del ; NM_000518.5(HBB):c.118C>T ; c.126delC ; NM_000518.5(HBB):c.127T>C ; NM_000518.4(HBB):c.127T>G ; NM_000518.5(HBB):c.128T>C ; NM_000518.5(HBB):c.134C>G ; NM_000518.4(HBB):c.135delC ; NM_000518.4(HBB):c.143_144insA ; NM_000518.5(HBB):c.143_146dup ; c.153del ; NM_000518.4(HBB):c.154delC ; NM_000518.4(HBB):c.162delT ; NM_000518.5(HBB):c.164_168delTTATGinsGGCATCA ; NM_000518.4:c.165_166insA ; NM_000518.5(HBB):c.176C>G ; NM_000518.4(HBB):c.182T>A ; NM_000518.5(HBB):c.184A>T ; c.189_195del ; NM_000518.5(HBB):c.190C>T ; NM_000518.4(HBB):c.193del ; NM_000518.5(HBB):c.199A>G ; NM_000518.4(HBB):c.19G>A ; NM_000518.4(HBB):c.1A>G ; NM_000518.4(HBB):c.203T>A ; NM_000518.4(HBB):c.206T>A ; NM_000518.5(HBB):c.20A>T ; NM_000518.4(HBB):c.20delA ; NM_000518.4:c.216delT ; NM_000518.5(HBB):c.216dup ; NM_000518.5(HBB):c.217_221delAGTGAinsT ; NM_000518.4:c.219_220delTG ; NM_000518.5(HBB):c.22G>A ; NM_000518.4:c.235delC ; NM_000518.4:c.243_264delCCTCAAGGGCACCTTTGCCACA ; NM_000518.4(HBB):c.247A>G ; NM_000518.4(HBB):c.248A>C ; NM_000518.4(HBB):c.248A>T ; NM_000518.5(HBB):c.257T>C ; c.258dup ; NM_000518.4(HBB):c.25_26delAA ; NM_000518.4(HBB):c.266T>C ; NM_000518.5(HBB):c.268A>C ; NM_000518.4(HBB):c.269G>A ; NM_000518.5(HBB):c.271G>T ; NM_000518.4(HBB):c.275T>C ; NM_000518.4(HBB):c.277C>A ; NM_000518.4(HBB):c.277C>T ; NM_000518.4(HBB):c.27dupG ; NM_000518.4(HBB):c.283G>C ; NM_000518.5(HBB):c.283_284insTG ; NM_000518.4(HBB):c.287dupA ; NM_000518.5(HBB):c.291_294dup ; NM_000518.4(HBB):c.293A>T ; NM_000518.5(HBB):c.295G>A ; NM_000518.4(HBB):c.298G>A ; NM_000518.4(HBB):c.298G>C ; NM_000518.4(HBB):c.298G>T ; NM_000518.4(HBB):c.299A>C ; NM_000518.4(HBB):c.299A>G ; NM_000518.4(HBB):c.299A>T ; NM_000518.5(HBB):c.2T>G ; c.301_302delinsTCTGAGAACT ; NM_000518.4(HBB):c.302C>T ; NM_000518.4(HBB):c.304G>A ; NM_000518.5(HBB):c.305A>G ; NM_000518.5(HBB):c.306G>C ; NM_000518.5(HBB):c.312C>G ; NM_000518.5(HBB):c.315+1G>A ; NM_000518.4(HBB):c.315+4_315+5del ; NM_000518.4:c.315.1delG ; NM_000518.4:c.315.2T-A ; NM_000518.4:c.315.2T-G ; NM_000518.5(HBB):c.316-106C>G ; NM_000518.5(HBB):c.316-146T>G ; NM_000518.5(HBB):c.316-14T>G ; NM_000518.5(HBB):c.316-197C>T ; NM_000518.5(HBB):c.316-1G>A ; NM_000518.5(HBB):c.316-1G>T ; NM_000518.5(HBB):c.316-2A>C ; NM_000518.5(HBB):c.316-2A>G ; NM_000518.5(HBB):c.316-3C>A ; NM_000518.4(HBB):c.320T>G ; c.323dupG ; NM_000518.4(HBB):c.328del ; NM_000518.4(HBB):c.332T>C ; NM_000518.5(HBB):c.337T>C ; NM_000518.5(HBB):c.341T>A ; NM_000518.5(HBB):c.343_344delCTinsG ; NM_000518.5(HBB):c.344T>C ; NM_000518.5(HBB):c.347C>A ; NM_000518.4(HBB):c.364G>A ; NM_000518.4(HBB):c.36delT ; NM_000518.4(HBB):c.371_378delCCCCACCA ; c.380_396del ; NM_000518.5(HBB):c.383A>C ; NM_000518.4(HBB):c.383_385del ; NM_000518.5(HBB):c.385_388delGCTGinsCCACA ; NM_000518.5(HBB):c.3G>A ; NM_000518.5(HBB):c.404T>A ; NM_000518.5(HBB):c.421G>A ; NM_000518.4(HBB):c.428C>A ; NM_000518.5(HBB):c.431A>C ; NM_000518.5(HBB):c.435G>C ; NM_000518.5(HBB):c.436T>A ; NM_000518.5(HBB):c.436T>C ; NM_000518.5(HBB):c.437A>G ; NM_000518.5(HBB):c.438T>A ; NM_000518.4(HBB):c.439C>G ; NM_000518.4(HBB):c.440A>C ; NM_000518.4(HBB):c.440A>T ; NM_000518.4(HBB):c.440_441dup ; NM_000518.5(HBB):c.45dup ; NM_000518.4(HBB):c.46delT ; NM_000518.5(HBB):c.47G>A ; NM_000518.5(HBB):c.48G>A ; NM_000518.5(HBB):c.4G>T ; NM_000518.4(HBB):c.4del ; NM_000518.5(HBB):c.52A>T ; NM_000518.5(HBB):c.59A>G ; NM_000518.5(HBB):c.61G>A ; NM_000518.4:c.62_65delTGGA ; NM_000518.4:c.67G-T ; c.68_74delAAGTTGG ; NM_000518.5(HBB):c.70G>A ; NM_000518.4(HBB):c.70G>T ; NM_000518.4(HBB):c.70_72delGTT ; NM_000518.5(HBB):c.79G>A ; NM_000518.5(HBB):c.79_80insT ; NM_000518.4(HBB):c.80A>G ; NM_000518.5(HBB):c.81G>C ; NM_000518.5(HBB):c.8A>C ; NM_000518.5(HBB):c.90C>T ; NM_000518.5(HBB):c.92+1G>A ; NM_000518.5(HBB):c.92+2T>A ; NM_000518.5(HBB):c.92+2T>C ; NM_000518.5(HBB):c.92+2T>G ; NM_000518.5(HBB):c.92+5G>C ; NM_000518.5(HBB):c.92+6T>C ; NM_000518.4(HBB):c.92G>C ; NM_000518.4(HBB):c.93-17_93-1del17 ; NM_000518.4:c.93-1G-T ; NM_000518.5(HBB):c.93-1G>A ; NM_000518.4(HBB):c.93-1G>C ; NM_000518.5(HBB):c.93-21G>A ; NM_000518.5(HBB):c.93-21_96del ; NM_000518.4(HBB):c.93-22_95del25 ; NM_000518.4(HBB):c.93-2A>C ; NM_000518.5(HBB):c.93-3T>G ; NM_000518.5(HBB):c.93G>T ; NM_000518.5(HBB):c.93_94insCGG ; NC_000011.10:g.5225727C>G ; NC_000011.10:g.5226801T>C

GENE

HEXA

DISEASES
Tay-Sachs disease, B variant, adult form
SUMMARY

A rare disorder characterized by accumulation of G2 gangliosides due to hexosaminidase A deficiency.

CLINICAL DESCRIPTION

Three variants have been described according to age of onset. The infantile form (type 1) begins between 3 and 6 months of age. The earliest sign is an incessant startle response to noise. Psychomotor retardation appears after the age of 8 months with hypotonia, amaurosis, and megalencephaly. A cherry-red macular spot may be found but is not specific. Muscular weakness progresses and leads to paralysis. The disorder degenerates into a state of decerebration and is fatal during childhood. Enzymatic activity of the hexosaminidase A is either extremely low or totally absent in leucocytes and cultured in fibroblasts obtained by skin biopsy. In the juvenile form (type 2), onset is between ages 2 and 6 with locomotor ataxia, behavioural disorders, and progressive loss of intellectual capacities, leading to a state of decerebration and death at around the age of 15. The decrease in hexosaminidase A activity is less pronounced than in the infantile form. The adult or chronic form (type 3) may begin around the age of 10, but often the disorder is not diagnosed until adulthood. Two different clinical forms exist. The first is similar to atypical Friedreich disease, with spinocerebellar ataxia but no cardiac or osseous signs, such as scoliosis or flat feet. The second is that of juvenile spinal amyotrophy resembling Kugelberg-Welander's syndrome. Mental capacities and behaviour may or may not be affected. Hexosaminidase A deficiency is found.

Tay-Sachs disease, B variant, infantile form
SUMMARY

A rare disorder characterized by accumulation of G2 gangliosides due to hexosaminidase A deficiency.

CLINICAL DESCRIPTION

Three variants have been described according to age of onset. The infantile form (type 1) begins between 3 and 6 months of age. The earliest sign is an incessant startle response to noise. Psychomotor retardation appears after the age of 8 months with hypotonia, amaurosis, and megalencephaly. A cherry-red macular spot may be found but is not specific. Muscular weakness progresses and leads to paralysis. The disorder degenerates into a state of decerebration and is fatal during childhood. Enzymatic activity of the hexosaminidase A is either extremely low or totally absent in leucocytes and cultured in fibroblasts obtained by skin biopsy. In the juvenile form (type 2), onset is between ages 2 and 6 with locomotor ataxia, behavioural disorders, and progressive loss of intellectual capacities, leading to a state of decerebration and death at around the age of 15. The decrease in hexosaminidase A activity is less pronounced than in the infantile form. The adult or chronic form (type 3) may begin around the age of 10, but often the disorder is not diagnosed until adulthood. Two different clinical forms exist. The first is similar to atypical Friedreich disease, with spinocerebellar ataxia but no cardiac or osseous signs, such as scoliosis or flat feet. The second is that of juvenile spinal amyotrophy resembling Kugelberg-Welander's syndrome. Mental capacities and behaviour may or may not be affected. Hexosaminidase A deficiency is found.

Tay-Sachs disease, B variant, juvenile form
SUMMARY

A rare disorder characterized by accumulation of G2 gangliosides due to hexosaminidase A deficiency.

CLINICAL DESCRIPTION

Three variants have been described according to age of onset. The infantile form (type 1) begins between 3 and 6 months of age. The earliest sign is an incessant startle response to noise. Psychomotor retardation appears after the age of 8 months with hypotonia, amaurosis, and megalencephaly. A cherry-red macular spot may be found but is not specific. Muscular weakness progresses and leads to paralysis. The disorder degenerates into a state of decerebration and is fatal during childhood. Enzymatic activity of the hexosaminidase A is either extremely low or totally absent in leucocytes and cultured in fibroblasts obtained by skin biopsy. In the juvenile form (type 2), onset is between ages 2 and 6 with locomotor ataxia, behavioural disorders, and progressive loss of intellectual capacities, leading to a state of decerebration and death at around the age of 15. The decrease in hexosaminidase A activity is less pronounced than in the infantile form. The adult or chronic form (type 3) may begin around the age of 10, but often the disorder is not diagnosed until adulthood. Two different clinical forms exist. The first is similar to atypical Friedreich disease, with spinocerebellar ataxia but no cardiac or osseous signs, such as scoliosis or flat feet. The second is that of juvenile spinal amyotrophy resembling Kugelberg-Welander's syndrome. Mental capacities and behaviour may or may not be affected. Hexosaminidase A deficiency is found.

Tay-Sachs disease, B1 variant
SUMMARY

A rare disorder characterized by accumulation of G2 gangliosides due to hexosaminidase A deficiency.

CLINICAL DESCRIPTION

Three variants have been described according to age of onset. The infantile form (type 1) begins between 3 and 6 months of age. The earliest sign is an incessant startle response to noise. Psychomotor retardation appears after the age of 8 months with hypotonia, amaurosis, and megalencephaly. A cherry-red macular spot may be found but is not specific. Muscular weakness progresses and leads to paralysis. The disorder degenerates into a state of decerebration and is fatal during childhood. Enzymatic activity of the hexosaminidase A is either extremely low or totally absent in leucocytes and cultured in fibroblasts obtained by skin biopsy. In the juvenile form (type 2), onset is between ages 2 and 6 with locomotor ataxia, behavioural disorders, and progressive loss of intellectual capacities, leading to a state of decerebration and death at around the age of 15. The decrease in hexosaminidase A activity is less pronounced than in the infantile form. The adult or chronic form (type 3) may begin around the age of 10, but often the disorder is not diagnosed until adulthood. Two different clinical forms exist. The first is similar to atypical Friedreich disease, with spinocerebellar ataxia but no cardiac or osseous signs, such as scoliosis or flat feet. The second is that of juvenile spinal amyotrophy resembling Kugelberg-Welander's syndrome. Mental capacities and behaviour may or may not be affected. Hexosaminidase A deficiency is found.

VARIANTS

NM_000520.5(HEXA):c.1496G>A ; NM_000520.5(HEXA):c.1214_1215delAAinsG ; NM_000520.5(HEXA):c.1495C>T ; NM_000520.4:c.1499delT ; NM_000520.5(HEXA):c.1510C>T ; NM_000520.5(HEXA):c.1528C>T ; NM_001318825.1(HEXA):c.1544G>A ; NM_000520.5(HEXA):c.2T>C ; NM_000520.5(HEXA):c.459+5G>A ; NM_000520.5(HEXA):c.508C>T ; NM_000520.5(HEXA):c.672+1G>A ; NM_000520.5(HEXA):c.805+1G>A ; NM_000520.5(HEXA):c.986+3A>G ; NM_000520.5(HEXA):c.116T>G ; NM_000520.5(HEXA):c.1176G>A ; NM_000520.5(HEXA):c.1177C>T ; NM_000520.5(HEXA):c.1260G>C ; NM_000520.6:c.1274_1277dupTATC ; c.1278_1281dup ; NM_000520.5(HEXA):c.1422G>C ; NM_000083.3:c.1444G>A ; NM_000520.5(HEXA):c.1510del ; NM_000520.4:c.1537C-T ; NM_000520.5(HEXA):c.173G>A ; NM_000520.5(HEXA):c.1A>G ; NM_000520.5(HEXA):c.1A>T ; NM_000520.4:c.254-1G-C ; NM_000520.5(HEXA):c.380T>G ; NM_183050.4:c.509G>A ; NM_000520.5(HEXA):c.532C>T ; NM_000520.5(HEXA):c.533G>A ; NM_000520.5(HEXA):c.533G>T ; NM_000520.5(HEXA):c.538T>C ; NM_000520.6:c.540C>G ; NM_000520.5(HEXA):c.629C>T ; NM_000520.5(HEXA):c.632T>C ; NM_000520.5(HEXA):c.749G>A ; c.759_774dup ; NM_000520.5(HEXA):c.772G>C ; c.77G>A ; NM_000520.5(HEXA):c.78G>A ; NM_000520.5(HEXA):c.805+1G>C ; NM_000520.6:c.805G>A ; NM_000520.6:c.915_917delCTT ; NM_000520.5(HEXA):c.987G>A

GENE

HEXB

DISEASES
Sandhoff disease, adult form
SUMMARY

Sandhoff disease is a lysosomal storage disorder from the GM2 gangliosidosis family and is characterised by central nervous system degeneration.

CLINICAL DESCRIPTION

The clinical picture is identical to that of Tay-Sachs disease, with startle reactions, early blindness, progressive motor and mental deterioration, macrocephaly and cherry-red spots on the macula. Patients may have a doll-like face, hepatosplenomegaly and recurring respiratory tract infections. High levels of urinary oligosaccharides are found. Children develop normally during the first 3-6 months of life, after which the disease appears and evolves quickly. In cases with later onset, or in adult cases, signs may be those of spinocerebellous ataxia or dystonia. Intellectual capacities may or may not be affected.

Sandhoff disease, infantile form
SUMMARY

Sandhoff disease is a lysosomal storage disorder from the GM2 gangliosidosis family and is characterised by central nervous system degeneration.

CLINICAL DESCRIPTION

The clinical picture is identical to that of Tay-Sachs disease, with startle reactions, early blindness, progressive motor and mental deterioration, macrocephaly and cherry-red spots on the macula. Patients may have a doll-like face, hepatosplenomegaly and recurring respiratory tract infections. High levels of urinary oligosaccharides are found. Children develop normally during the first 3-6 months of life, after which the disease appears and evolves quickly. In cases with later onset, or in adult cases, signs may be those of spinocerebellous ataxia or dystonia. Intellectual capacities may or may not be affected.

Sandhoff disease, juvenile form
SUMMARY

Sandhoff disease is a lysosomal storage disorder from the GM2 gangliosidosis family and is characterised by central nervous system degeneration.

CLINICAL DESCRIPTION

The clinical picture is identical to that of Tay-Sachs disease, with startle reactions, early blindness, progressive motor and mental deterioration, macrocephaly and cherry-red spots on the macula. Patients may have a doll-like face, hepatosplenomegaly and recurring respiratory tract infections. High levels of urinary oligosaccharides are found. Children develop normally during the first 3-6 months of life, after which the disease appears and evolves quickly. In cases with later onset, or in adult cases, signs may be those of spinocerebellous ataxia or dystonia. Intellectual capacities may or may not be affected.

VARIANTS

NM_000521.3(HEXB):c.1250C>T ; NM_000521.3(HEXB):c.1375G>T ; NM_000521.3(HEXB):c.298delC ; NM_000521.3(HEXB):c.508C>T ; NM_000521.3(HEXB):c.797A>G ; NM_000521.3(HEXB):c.115delG ; NM_000521.3(HEXB):c.1238_1242delCAAAG ; NM_000521.3:c.1310_1311delCA ; NM_000521.3:c.1345delT ; c.1380G>A ; NM_000521.3(HEXB):c.1517_1529dupCAAGTGCTGTTGG ; NM_000521.3:c.1539_1540delCT ; NM_000521.3:c.1619_1620insTTCATGTTATCTACAGACGTG ; NM_000521.3(HEXB):c.171delG ; NM_000521.3:c.202_203insGG ; NM_000521.4(HEXB):c.841C>T ; NM_000521.3(HEXB):c.850C>T

GENE

HFE

DISEASES
Familial porphyria cutanea tarda
SUMMARY

Porphyria cutanea tarda (PCT) is the most common form of chronic hepatic porphyria (see this term). It is characterized by bullous photodermatitis.

CLINICAL DESCRIPTION

The disease manifests in adulthood. PCT is acquired (75% of cases) or familial (25% of cases). Generally manifestations of the disease appear earlier in familial cases. Some risk factors can precipitate symptoms: excessive consumption of alcohol, hepatitis C, estrogen, and mutations of the genes that control iron metabolism, leading to iron overload (hemochromatosis). The main clinical symptoms include firstly, extremely fragile skin and, subsequently, bullous cutaneous lesions on the surface of skin exposed to the sun (hands, face). Scarring is slow and often followed by hyper and hypopigmentation. The presence of cutaneous lesions of varying ages is very characteristic of the disease. With age, the disease manifestations can be accompanied by hypertrichosis (mainly facial) and sclerodermic signs. Hepatic lesions can also develop (siderosis, steatosis, necrosis and chronic inflammatory disorders).

NON RARE IN EUROPE: Hemochromatosis type 1
SUMMARY

0

CLINICAL DESCRIPTION

Hereditary hemochromatosis is an autosomal recessive disorder of iron metabolism wherein the body accumulates excess iron. Excess iron is deposited in a variety of organs leading to their failure, and resulting in serious illnesses including cirrhosis, hepatomas, diabetes, cardiomyopathy, arthritis, and hypogonadotropic hypogonadism. Severe effects of the disease usually do not appear until after decades of progressive iron loading. Removal of excess iron by therapeutic phlebotomy decreases morbidity and mortality if instituted early in the course of the disease. Classic hemochromatosis (HFE) is most often caused by mutation in a gene designated HFE on chromosome 6p21.3.

Sporadic porphyria cutanea tarda
SUMMARY

Porphyria cutanea tarda (PCT) is the most common form of chronic hepatic porphyria (see this term). It is characterized by bullous photodermatitis.

CLINICAL DESCRIPTION

The disease manifests in adulthood. PCT is acquired (75% of cases) or familial (25% of cases). Generally manifestations of the disease appear earlier in familial cases. Some risk factors can precipitate symptoms: excessive consumption of alcohol, hepatitis C, estrogen, and mutations of the genes that control iron metabolism, leading to iron overload (hemochromatosis). The main clinical symptoms include firstly, extremely fragile skin and, subsequently, bullous cutaneous lesions on the surface of skin exposed to the sun (hands, face). Scarring is slow and often followed by hyper and hypopigmentation. The presence of cutaneous lesions of varying ages is very characteristic of the disease. With age, the disease manifestations can be accompanied by hypertrichosis (mainly facial) and sclerodermic signs. Hepatic lesions can also develop (siderosis, steatosis, necrosis and chronic inflammatory disorders).

Symptomatic form of hemochromatosis type 1
SUMMARY

Symptomatic form of hemochromatosis type 1 is a rare, hereditary hemochromatosis characterized by inappropriately regulated intestinal iron absorption which leads to excessive iron storage in various organs and manifests with a wide range of signs and symptoms, including abdominal pain, weakness, lethargy, weight loss, elevated serum aminotransferase levels, increase in skin pigmentation, and/or arthropathy in the metacarpophalangeal joints. Other commonly associated manifestations include hepatomegaly, cirrhosis, liver fibrosis, hepatocellular carcinoma, restrictive cardiomyopathy and/or diabetes mellitus.

CLINICAL DESCRIPTION

Hereditary hemochromatosis is an autosomal recessive disorder of iron metabolism wherein the body accumulates excess iron. Excess iron is deposited in a variety of organs leading to their failure, and resulting in serious illnesses including cirrhosis, hepatomas, diabetes, cardiomyopathy, arthritis, and hypogonadotropic hypogonadism. Severe effects of the disease usually do not appear until after decades of progressive iron loading. Removal of excess iron by therapeutic phlebotomy decreases morbidity and mortality if instituted early in the course of the disease. Classic hemochromatosis (HFE) is most often caused by mutation in a gene designated HFE on chromosome 6p21.3.

VARIANTS

NM_000410.3:c.252G-A ; NM_000410.3(HFE):c.277G>C ; NM_000410.3(HFE):c.314T>C ; NM_000410.3(HFE):c.989G>T

GENE

HGD

DISEASES
Alkaptonuria
SUMMARY

A rare disorder of phenylalanine and tyrosine metabolism characterized by the accumulation of homogentisic acid (HGA) and its oxidized product, benzoquinone acetic acid (BQA), in various tissues (e.g. cartilage, connective tissue) and body fluids (urine, sweat), causing urine to darken when exposed to air as well as grey-blue coloration of the sclera and ear helix (ochronosis), and a disabling joint disease involving both the axial and peripheral joints (ochronotic arthropathy).

CLINICAL DESCRIPTION

Many affected individuals are asymptomatic and unaware of their condition until adulthood, however, homogentisic aciduria may be recognized early in infancy by dark-stained diapers. After the third decade, unusual pigmentation of the sclera and the skin overlying cartilage begins to be observed, as well as muscular-skeletal symptoms such as back pain and stiffness. Involvement of the large peripheral joints usually occurs several years after spinal changes, often leading to end-stage joint disease. Ochronotic peripheral arthropathy is generally degenerative in nature. From the fourth decade, joint mobility diminishes. Ankylosis may be present. Fractures of the vertebrae and long bones are also possible. Other features may include genitourinary (e.g. renal, bladder, prostatic stones) and cardiac (mitral valvulitis, arrhythmias) complications as well as respiratory insufficiency due to musculoskeletal involvement.

VARIANTS

NM_000187.3(HGD):c.342+1G>A ; NM_000187.3(HGD):c.674G>A ; NM_000187.3(HGD):c.899T>G ; NM_000187.3(HGD):c.1102A>G ; NM_000187.3(HGD):c.1111dupC ; c.1189-2A>G ; NM_000187.3(HGD):c.140C>T ; NM_000187.3(HGD):c.16-1G>A ; NM_000187.3:c.172A-T ; NM_000187.3(HGD):c.175delA ; NM_000187.3:c.469.2T-C ; NM_000187.3(HGD):c.481G>A ; NM_000187.3(HGD):c.688C>T ; NM_000187.3(HGD):c.808G>A

GENE

HGSNAT

DISEASES
Retinitis pigmentosa
SUMMARY

Retinitis pigmentosa (RP) is an inherited retinal dystrophy leading to progressive loss of the photoreceptors and retinal pigment epithelium and resulting in blindness usually after several decades.

CLINICAL DESCRIPTION

Retinitis pigmentosa is slowly progressive but relentless. There is however broad variability in age of onset, rate of progression and secondary clinical manifestations. Affected individuals generally first develop night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and over time loss of central vision, usually at late stages, often around midlife. Central visual acuity loss may occur at any age as a result of cystoid macular edema or photoreceptor loss. Posterior subcapsular cataracts are common and severity is age dependent. Reduced color vision may also be found. Fundus examination reveals bone spicule pigment deposits, attenuated retinal vessels, retinal atrophy and waxy optic nerve pallor. Severity is partly correlated with the pattern of inheritance with X-linked cases having the most severe course, autosomal recessive and single occurrence cases having intermediate severity, and autosomal dominant the most favorable course.

Sanfilippo syndrome type C
SUMMARY

Sanfilippo syndrome comprises several forms of lysosomal storage diseases due to impaired degradation of heparan sulfate. The deficient enzyme in Sanfilippo syndrome C, or MPS IIIC, is an acetyltransferase that catalyzes the conversion of alpha-glucosaminide residues to N-acetylglucosaminide in the presence of acetyl-CoA.

CLINICAL DESCRIPTION

The Sanfilippo syndrome, or mucopolysaccharidosis III, is an autosomal recessive lysosomal storage disease due to impaired degradation of heparan sulfate. The disorder is characterized by severe central nervous system degeneration, but only mild somatic disease. Onset of clinical features usually occurs between 2 and 6 years; severe neurologic degeneration occurs in most patients between 6 and 10 years of age, and death occurs typically during the second or third decade of life. Type A has been reported to be the most severe, with earlier onset and rapid progression of symptoms and shorter survival.

VARIANTS

NM_152419.2(HGSNAT):c.1030C>T ; NM_152419.2(HGSNAT):c.1250+1G>A ; NM_152419.2(HGSNAT):c.1464+1G>A ; NM_152419.2(HGSNAT):c.848C>T ; c.1378-1G>A ; NM_152419.2:c.1503delA ; NM_152419.2(HGSNAT):c.1553C>T ; NM_152419.2(HGSNAT):c.1622C>T ; NM_152419.2(HGSNAT):c.493+1G>A ; NM_152419.2(HGSNAT):c.607C>T

GENE

HMGCL

DISEASES
3-hydroxy-3-methylglutaric aciduria
SUMMARY

A rare organic aciduria, due to deficiency of 3-hydroxy-3-methylglutaryl-CoA lyase characterized by episodes of metabolic decompensation with hypoketotic hypoglycemia triggered by periods of fasting or infections.

CLINICAL DESCRIPTION

The clinical presentation is heterogeneous, ranging from severe neonatal onset with potentially fatal outcome to presentation in adulthood. Most patients became symptomatic within the first year of life (50% in neonatal period) with episodes of metabolic decompensation triggered by periods of fasting or infections, which when left untreated may lead to neurological sequelae. Newborns or infants present with acidosis and hypoglycemia, accompanied by vomiting, dehydration, hypotonia and lethargy. Acute decompensation is triggered by infections, vaccinations, and dietary changes. The typical laboratory findings include hypoglycemia, acidosis, an increased anion gap, hyperammonemia and elevated transaminases. Long-term neurological complications are common. Half of the patients have a normal cognitive development while the remainder shows psychomotor deficits. Speech and motor developmental delay are frequent. Cerebral MRI frequently reveals diffuse abnormality in signal intensity of the cerebral white matter, thalami and basal ganglia. Other manifestations may include macrocephaly, dilated cardiomyopathy, arrhythmias, hepatomegaly and acute pancreatitis. Children are usually healthy between episodes; subsequent acute crises may be preceded by anorexia, lethargy, behavioral changes, irritability and muscle weakness. Hypoketotic hypoglycemia is characteristic.

VARIANTS

NM_000191.2(HMGCL):c.206_207delCT ; NM_000191.2(HMGCL):c.698A>G ; NM_000191.3:c.122G>A ; c.230del ; NM_000191.2(HMGCL):c.505_506delTC ; NM_000191.2(HMGCL):c.835G>A

GENE

HPD

DISEASES
Hawkinsinuria
SUMMARY

Hawkinsinuria is an inborn error of tyrosine metabolism characterized by failure to thrive, persistent metabolic acidosis, fine and sparse hair, and excretion of the unusual cyclic amino acid metabolite, hawkinsin ((2-l-cystein-S-yl, 4-dihydroxycyclohex-5-en-1-yl)acetic acid), in the urine.

CLINICAL DESCRIPTION

Symptoms manifest in infants fed on formula or cow's milk or after weaning from breast milk.

Tyrosinemia type 3
SUMMARY

Tyrosinemia type 3 is an inborn error of tyrosine metabolism characterised by mild hypertyrosinemia and increased urinary excretion of 4-hydroxyphenylpyruvate, 4-hydroxyphenyllactate and 4-hydroxyphenylacetate.

CLINICAL DESCRIPTION

The clinical picture is highly variable ranging from asymptomatic in patients identified through neonatal screening program studies to patients with neurologic manifestations including intellectual deficit and ataxia.

VARIANTS

NM_001171993.1(HPD):c.483C>G ; NM_001171993.1(HPD):c.657T>G ; c.987del

GENE

HPS1

DISEASES
Hermansky-Pudlak syndrome with pulmonary fibrosis
SUMMARY

Hermansky-Pudlak syndrome with pulmonary fibrosis as a complication includes two types (HPS-1 and HPS-4) of Hermansky-Pudlak syndrome (HPS; see this term), a multi-system disorder characterized by oculocutaneous albinism, bleeding diathesis and, in some cases, pulmonary fibrosis or granulomatous colitis.

CLINICAL DESCRIPTION

HPS-1 and HPS-4 present with features of HPS including oculocutaneous albinisim, reduced visual acuity, horizontal nystagmus, easy bruising of soft tissues, epistaxis, and prolonged bleeding after dental extraction, surgery or childbirth. Women may present with medically significant menstrual bleeding. Complications of HPS may include granulomatous colitis and pulmonary fibrosis. Pulmonary fibrosis is the most serious complication of HPS-1 and HPS-4 and usually presents in the fourth or fifth decade.

VARIANTS

NM_000195.3(HPS1):c.1996G>T ; NM_000195.4(HPS1):c.972dupC ; NM_000195.4(HPS1):c.1472_1487dup16 ; NM_000195.4(HPS1):c.397G>T ; NM_000195.4(HPS1):c.398+5G>A ; NM_000195.4(HPS1):c.972delC

GENE

HSD17B4

DISEASES
Bifunctional enzyme deficiency
SUMMARY

A rare peroxisomal beta-oxidation disorder characterized by deficiency of peroxisomal D-bifunctional protein, type 1 being caused by deficiency of both dehydrogenase and hydratase activities of the enzyme, and types 2 and 3 by hydratase or dehydrogenase deficiency alone, while type 4 is due to compound heterozygous mutations affecting both units and represents a clinically milder phenotype. Types 1-3 are typically fatal in infancy. Patients present with early onset of generalized hypotonia, seizures, severe global developmental delay, craniofacial dysmorphism (large fontanel, high forehead, hypertelorism, epicanthal folds) and elevated plasma very long chain fatty acids. Variable features include hepatomegaly, polymicrogyria, and cerebral white matter abnormalities, among others.

CLINICAL DESCRIPTION

D-bifunctional protein deficiency is a disorder of peroxisomal fatty acid beta-oxidation. The clinical manifestations of this deficiency is similar to those of disorders of peroxisomal assembly, including X-linked adrenoleukodystrophy, Zellweger cerebrohepatorenal syndrome and neonatal adrenoleukodystrophy.

Perrault syndrome
SUMMARY

Perrault syndrome (PS) is characterized by the association of ovarian dysgenesis in females with sensorineural hearing impairment. In more recent PS reports, some authors have described neurologic abnormalities, notably progressive cerebellar ataxia and intellectual deficit.

CLINICAL DESCRIPTION

Mean age at diagnosis is 22 years following presentation with delayed puberty in females with sensorineural deafness. Hearing defects were noted in all but one of the reported cases (mean age at diagnosis of 8 years). The hearing loss is always sensorineural and bilateral but the severity is variable (mild to profound), even in affected patients from the same family. Ovarian dysgenesis has been reported in all female cases but no gonad defects are detected in males. Amenorrhea is generally primary but secondary amenorrhea has also been reported. Delayed growth (height below the third percentile) was reported in half the documented cases. The exact frequency of the neurological abnormalities is unknown, but nine females and two males (16-37 years old) lacking neurological abnormalities have been reported. Neurological signs are progressive and generally appear later in life, however, walking delay or early frequent falls have been noted in young PS patients. Common neurological signs are ataxia, dyspraxia, limited extraocular movements, and polyneuropathy. Some cases with scoliosis have also been reported.

VARIANTS

NM_000414.3(HSD17B4):c.1369A>T ; NM_000414.3(HSD17B4):c.46G>A ; NM_000414.3(HSD17B4):c.317G>C ; NM_000414.3(HSD17B4):c.650A>G ; NM_000414.3:c.972.1G-T

GENE

HYLS1

DISEASES
Hydrolethalus
SUMMARY

Hydrolethalus (HLS) is a severe fetal malformation syndrome characterized by craniofacial dysmorphic features, central nervous system, cardiac, respiratory tract and limb abnormalities.

CLINICAL DESCRIPTION

Micrognathia and retrognathia, cleft lip/palate, a poorly formed nose, posteriorly rotated ears and deep-set eyes are the main craniofacial dysmorphic features observed in HLS. A midline defect in the occipital bone dorsal to the foramen magnum is present, resulting in a keyhole-shaped defect. Brain abnormalities include hydrocephaly and agenesis of midline structures such as corpus callosum, cerebellar vermis and septum pellucidum, leading to a wide opened fluid-filled space between lateral ventricles. HLS is also characterized by postaxial and preaxial polydactyly, respectively in the hands and feet, the latter being clubbed. About half of the patients have large septal cardiac defect. Abnormal lobulation of the lungs, stenosis of the airways (larynx, trachea or bronchus), and abnormal genitalia (including uterus duplex in females and ectopic testis in males) are also found.

Joubert syndrome
SUMMARY

A rare, autosomal recessive congenital cerebellar ataxia characterized by congenital malformation of the brainstem and agenesis or hypoplasia of the cerebellar vermis leading to an abnormal respiratory pattern, nystagmus, hypotonia, ataxia, and delay in achieving motor milestones.

CLINICAL DESCRIPTION

Disease onset is antenatal, although clinical presentation is typically in the neonatal period with irregular breathing pattern (episodic tachypnea and/or apnea), and nystagmus. During infancy, hypotonia may appear. Cerebellar ataxia (staggering gait and imbalance) may develop later. Delayed acquisition of motor milestones is common. Cognitive abilities are variable, ranging from severe intellectual deficit to normal intelligence. Neuro-ophthalmologic examination may show oculomotor apraxia. In some cases, seizures occur. Careful examination of the face often shows a characteristic appearance: large head, prominent forehead, high rounded eyebrows, epicanthal folds, ptosis (occasionally), an upturned nose with prominent nostrils, an open mouth (which tends to have an oval shape early on, a 'rhomboid' appearance later, and finally can appear triangular with downturned angles), tongue protrusion and rhythmic tongue motions, and occasionally low-set and tilted ears. Other features sometimes present in Joubert syndrome include retinal dystrophy, hepatopathy, nephronophthisis, and polydactyly.

VARIANTS

NM_145014.2(HYLS1):c.632A>G ; c.669G>A ; NM_145014.2:c.724C-T

GENE

IDS

DISEASES
Mucopolysaccharidosis type 2, attenuated form
SUMMARY

Mucopolysaccharidosis type 2, attenuated form (MPS2att), the less severe form of MPS2 (see this term), leads to a massive accumulation of glycosaminoglycans and a wide variety of symptoms including distinctive facies, short stature, cardiorespiratory and skeletal findings. It is differentiated from mucopolysaccharidosis type 2, severe form (see this term) by the absence of cognitive decline.

CLINICAL DESCRIPTION

MPS2att is clinically heterogeneous and its rate of progression is highly variable. Patients appear healthy at birth, with subtle initial symptoms appearing between 18 months and 4 years of age or even later, in particular umbilical or inguinal hernia. A distinctive facies (thickening of lips and nostrils, enlarged and protruding tongue), forms slowly and may first be observed at 2-4 years of age (often not evident until late). Swelling of the upper respiratory tract may be responsible for frequent infections, in particular otitis media; excessive snoring and sleep apnea; a distinctive hoarse voice and progressive loss of hearing. During early childhood growth is stunted and patients have a short stature with dysostosis multiplex and stiff joints that may make movement painful, hip dysplasia may also occur. Phalangeal joints are universally contracted resulting in claw-like hands; carpal tunnel syndrome is common. Spastic paresis due to spinal cord compression at the cranio-cervical region may also occur. Pressure exerted on the optic nerve may lead to loss of vision and retinal degeneration has also been reported in some cases. MPS2att patients, in general, have no cognitive impairments.

Mucopolysaccharidosis type 2, severe form
SUMMARY

Mucopolysaccharidosis type 2 (MPS2, see this term), severe form (MPS2S), is associated with a massive accumulation of glycosaminoglycans and a wide variety of symptoms including a rapidly progressive cognitive decline; it is most often fatal in the second or third decade.

CLINICAL DESCRIPTION

MPS2S presents with the spectrum of symptoms observed in all MSP2 (see this term) cases, often with an earlier presentation. MPS2S patients have a decrease in growth rate in early to mid-childhood, along with respiratory difficulties and a thickening of lips and nostrils as well as an enlarged and protruding tongue (distinctive facies), which may become evident between 2-4 years of age. Psychomotor milestones are delayed, and regression often occurs. Between the ages of 2-6 years patients begin to exhibit aggressive behavior and hyperactivity, often lacking any sense of danger as they follow a course of progressive cognitive decline. Vision may be affected, and progressive hearing loss occurs in most cases. Myocardial thickening and cardiac valve dysfunction are common. Approximately 60-80 % of patients with MPS2 have the severe form of the disease with neurological implications.

VARIANTS

NM_000202.5(IDS):c.641C>T ; NM_000202.7(IDS):c.1003C>T ; NM_000202.7(IDS):c.1006G>T ; NM_000202.7(IDS):c.1025A>C ; NM_000202.4(IDS):c.1027G>A ; NM_000202.7(IDS):c.1046G>A ; NM_000202.7(IDS):c.1265G>A ; NM_000202.7(IDS):c.133G>C ; NM_000202.4(IDS):c.1393C>A ; NM_000202.8(IDS):c.143G>C ; NM_000202.7(IDS):c.1508T>A ; NM_000202.7(IDS):c.479C>A ; NM_000202.7(IDS):c.592G>A ; NM_000202.4(IDS):c.688A>T ; NM_000202.4(IDS):c.806A>T ; NC_000023.11:g.149482836T>A ; NC_000023.11:g.149482921C>G ; NC_000023.11:g.149503371G>C ; NM_000202.7(IDS):c.1006+1G>T ; NM_000202.7(IDS):c.1007-8T>G ; NM_000202.7(IDS):c.1016T>C ; NM_000202.7(IDS):c.103+1G>C ; NM_000202.7(IDS):c.1033T>A ; NM_000202.8(IDS):c.1044C>G ; NM_000202.7(IDS):c.1099A>T ; NM_000202.7(IDS):c.1106C>A ; NM_000202.7(IDS):c.1122C>T ; NM_000202.7(IDS):c.1132_1133del ; NM_000202.7(IDS):c.1148delC ; NM_000202.7(IDS):c.1181-1G>A ; NM_000202.7(IDS):c.1264T>G ; NM_000202.7(IDS):c.1265G>T ; NM_000202.7(IDS):c.1327C>T ; NM_000202.7(IDS):c.1393C>T ; NM_000202.7(IDS):c.1402C>T ; NM_000202.7(IDS):c.1403G>A ; NM_000202.7(IDS):c.1403G>C ; NM_000202.7(IDS):c.1403G>T ; NM_000202.7(IDS):c.1425G>A ; NM_000202.7(IDS):c.1433A>G ; NM_000202.7(IDS):c.1505G>C ; NM_000202.7(IDS):c.1591C>T ; NM_000202.7(IDS):c.181T>C ; NM_000202.7(IDS):c.191T>A ; NM_000202.7(IDS):c.196C>T ; NM_000202.7(IDS):c.208dupC ; NM_000202.7(IDS):c.22_37del16 ; NM_000202.8(IDS):c.238C>T ; NM_000202.5:c.240.1G-A ; NM_000202.7(IDS):c.241-5A>T ; NM_000202.7(IDS):c.252C>A ; NM_000202.5(IDS):c.253G>A ; NM_000202.7(IDS):c.257C>T ; NM_000202.7(IDS):c.262C>T ; NM_000202.6:c.278delC ; NM_000202.7(IDS):c.309C>G ; NM_000202.7(IDS):c.317_318insTCAA ; NM_000202.7(IDS):c.349_351del ; NM_000202.7(IDS):c.359C>A ; NM_000202.6:c.388_389insG ; NM_000202.7(IDS):c.401G>A ; NM_000202.7(IDS):c.404A>G ; NM_000202.7(IDS):c.404_405delAA ; NM_000202.7(IDS):c.411delT ; NM_000202.7(IDS):c.419-1G>A ; NM_000202.7(IDS):c.425C>A ; NM_000202.7(IDS):c.463_464delTTinsCCGTATAGCTGG ; NM_000202.7(IDS):c.469C>T ; NM_000202.7(IDS):c.476_478delATC ; NM_000202.7(IDS):c.479C>G ; NM_000202.7(IDS):c.508-1G>A ; NM_000202.7(IDS):c.508-1G>C ; NM_000202.7(IDS):c.509_510del ; NM_000202.7(IDS):c.514C>T ; NM_000202.7(IDS):c.587T>C ; NM_000202.5:c.596_599delAACA ; NM_000202.7(IDS):c.597del ; NM_000202.7(IDS):c.613G>C ; NM_000202.7(IDS):c.690_691insT ; NM_000202.7(IDS):c.702C>A ; NM_000202.7(IDS):c.708+1G>A ; NM_000202.7(IDS):c.754_767del ; NM_000202.7(IDS):c.820G>T ; NM_000202.7(IDS):c.832_833insATGTTTAAGGGAAG ; NM_000202.7(IDS):c.884A>T ; NM_000202.7(IDS):c.908_909delCT ; NM_000202.7(IDS):c.935G>A ; NM_000202.7(IDS):c.998C>T ; NM_000202.5:c.99delC ; NC_000023.11:g.149503311C>G ; NC_000023.11:g.149505049_149505050insAT

GENE

ELP1

DISEASES
Familial dysautonomia
SUMMARY

A rare hereditary sensory and autonomic neuropathy characterized by decreased pain and temperature perception, absent deep tendon reflexes, proprioceptive ataxia, afferent baroreflex failure and progressive optic neuropathy.

CLINICAL DESCRIPTION

The disease is present at birth and is progressive. Initial symptoms (from birth to 3 years) include swallowing problems, aspiration pneumonia, hypotonia, temperature and blood pressure instability, and delayed development. Lack of fungiform papilla on the tongue and absence of tears with emotional crying are classic features, but not easily recognized (the tongue appears inconspicuous and lack of overflow tears is normal until about seven months of age). No obvious dysmorphism is present at birth, but a characteristic facial expression develops over time. Pain and temperature perception are decreased, but not absent. Proprioception and vibration sense are markedly decreased. Deep tendon reflexes are absent. Feeding difficulties due to gastrointestinal dysmotility (oropharyngeal incoordination, abnormal esophageal peristalsis, erratic gastric emptying, gastroesophageal reflux) occur early and may persist throughout life. Episodes of protracted vomiting attacks and hypertension termed 'autonomic crises'' can be recurrent. Forty percent of the patients manifest a cyclical crisis pattern that can occur daily, weekly, or monthly with personality changes ranging from irritability and withdrawal to general excitation. Chronic lung disease (secondary to repeated aspirations), restrictive lung disease (imposed by scoliosis), and chemoreceptor dysfunction (resulting in blunted responses to hypoxemia) are frequent. Orthostatic hypotension without compensatory tachycardia is always present, as well as episodic hypertension in response to emotional stress or visceral pain. Chronic renal failure is common. Progressive optic neuropathy and neurotrophic keratopathy result in severe visual loss. There is ample phenotypic variation particularly in cognitive abilities. Severe kyphoscoliosis and short stature are common.

VARIANTS

NM_003640.4(ELP1):c.2741C>T ; NM_003640.3:c.1460.2T-C ; NM_003640.5:c.2087G>C ; NM_003640.5:c.2204+6T>C ; NM_003640.3:c.2328delT ; NM_003640.3:c.3332delC

GENE

IL2RG

DISEASES
Omenn syndrome
SUMMARY

Omenn syndrome (OS) is an inflammatory condition characterized by erythroderma, desquamation, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency (SCID; see this term).

CLINICAL DESCRIPTION

OS presents during the first year of life with features of SCID including chronic diarrhea, pneumonitis and failure to thrive. In addition, patients present with inflammatory symptoms including lymphadenopathy, hepatosplenomegaly and generalized erythroderma, which may often cause alopecia and loss of eyebrows and eyelashes; protein loss may lead to generalized edema and metabolic disturbances. The signs and symptoms of OS can evolve over time and may not appear simultaneously. Some patients present with some but not all of these symptoms and may be described as having atypical Omenn syndrome. OS may also be associated with syndromic disorders including cartilage-hair hypoplasia (CHH), adenosine deaminase (ADA) deficiency, monosomy 22q11, coloboma of the eye, CHARGE syndrome and ligase 4 deficiency (see these terms).

T-B+ severe combined immunodeficiency due to gamma chain deficiency
SUMMARY

Severe combined immunodeficiency (SCID) due to gamma chain deficiency, also called SCID-X1, is a form of SCID (see this term) characterized by severe and recurrent infections, associated with diarrhea and failure to thrive.

CLINICAL DESCRIPTION

SCID-X1 manifests during the first months of life with severe and often life threatening viral, bacterial or fungal infections (e.g. Pneumocystis jiroveci pneumonitis, disseminated BCG infection if previously vaccinated), and failure to thrive. Chronic diarrhea is a frequent finding. Some patients may have skin rashes and abnormalities of liver function. Materno-fetal transfusion-associated graft versus host disease is also associated with the disease. Immunological findings are lymphopenia with the absence of T and NK cells, hypogammaglobulinemia, and normal or increased B cell count.

VARIANTS

NM_000206.2(IL2RG):c.181C>T ; NM_000206.2(IL2RG):c.202G>A ; NM_000206.2(IL2RG):c.270-1G>T ; NM_000206.2(IL2RG):c.314A>G ; NM_000206.2(IL2RG):c.344G>A ; NM_000206.2(IL2RG):c.455T>C ; NM_000206.2(IL2RG):c.460C>T ; NM_000206.2(IL2RG):c.465G>A ; NM_000206.2(IL2RG):c.467C>T ; NM_000206.2(IL2RG):c.47T>C ; NM_000206.2(IL2RG):c.662T>C ; NM_000206.2(IL2RG):c.710G>A ; NM_000206.2(IL2RG):c.718T>C ; NM_000206.2(IL2RG):c.855-1G>A ; NM_000206.2(IL2RG):c.980A>G ; NM_000206.2(IL2RG):c.982C>T ; NC_000023.11:g.71110982A>T ; NM_000206.2(IL2RG):c.100G>T ; NM_000206.2(IL2RG):c.186T>A ; NM_000206.2(IL2RG):c.207_211dup ; NM_000206.2(IL2RG):c.261_262insTCTG ; NM_000206.2(IL2RG):c.270-15A>G ; NM_000206.2(IL2RG):c.270G>A ; NM_000206.2(IL2RG):c.281C>A ; c.292A>T ; NM_000206.2(IL2RG):c.2T>C ; NM_000206.2(IL2RG):c.328delG ; NM_000206.2(IL2RG):c.341G>A ; NM_000206.2(IL2RG):c.343T>C ; NM_000206.2(IL2RG):c.355A>T ; NM_000206.2:c.359_360insT ; c.359dup ; NM_000206.2(IL2RG):c.391C>T ; c.3G>A ; NM_000206.2(IL2RG):c.421C>T ; NM_000206.2(IL2RG):c.427delA ; NM_000206.2(IL2RG):c.43C>T ; NM_000206.2(IL2RG):c.452T>C ; NM_000206.2(IL2RG):c.454+1G>A ; NM_000206.2(IL2RG):c.455T>G ; NM_000206.2(IL2RG):c.458T>A ; NM_000206.2(IL2RG):c.522G>A ; NM_000206.2(IL2RG):c.548delT ; NM_000206.2(IL2RG):c.562C>T ; NM_000206.2:c.579G-A ; NM_000206.2(IL2RG):c.602C>G ; NM_000206.2(IL2RG):c.664C>T ; NM_000206.2(IL2RG):c.670C>T ; NM_000206.2(IL2RG):c.676C>T ; NM_000206.2(IL2RG):c.677G>A ; NM_000206.2(IL2RG):c.703C>T ; NM_000206.2(IL2RG):c.703_711dup ; NM_000206.2(IL2RG):c.720G>A ; NM_000206.2(IL2RG):c.758-1G>A ; NM_000206.2(IL2RG):c.846G>A ; NM_000206.2(IL2RG):c.854G>A ; NM_000206.2(IL2RG):c.865C>T ; NM_000206.2(IL2RG):c.878T>A ; NM_000206.2(IL2RG):c.903_910delTGAATACC ; NM_000206.2(IL2RG):c.923C>A ; NM_000206.2(IL2RG):c.924+1G>A ; NC_000023.11:g.71107888_71107889TC[1] ; NC_000023.11:g.71110153_71110154CA[1] ; NC_000023.11:g.71110528G>A ; NC_000023.11:g.71111453del

GENE

IVD

DISEASES
Isovaleric acidemia
SUMMARY

A rare, autosomal recessive, organic aciduria that is characterized by variable clinical presentation ranging from acute neonatal onset of metabolic decompensation to later onset of chronic, non-specific manifestations including failure to thrive and/or developmental delay. All patients are prone to intermittent, acute metabolic decompensation. During metabolic episodes, urine analysis demonstrates elevated isovaleric acid derivatives.

CLINICAL DESCRIPTION

Patients present along a spectrum. Acute, neonatal presentation is characterized by onset in the first two weeks of life with vomiting, seizures, and lethargy, progressing to coma. Metabolic acidosis with an increased anion gap is apparent on laboratory evaluation. Hyperammonemia may occur. Later onset is relatively non-specific with failure to thrive and/or developmental delay. Patients who survived an early acute presentation are subsequently indistinguishable from those with the chronic phenotype. All patients are prone to intermittent acute episodes of decompensation with minor illnesses. Childhood onset metabolic acidosis is typically brought on by prolonged fasting, increased intake of protein-rich food or infections, and can be fatal if not treated immediately. The characteristic smell of isovaleric acid may be present, and is likened to sweaty feet/body sweat. Though severe developmental delay and neurologic sequelae are present in some patients, they are likely related to severe biochemical presentations.

VARIANTS

NM_002225.3(IVD):c.627delT ; NM_002225.3(IVD):c.1141T>C ; NM_002225.4(IVD):c.1183C>T ; NM_002225.3(IVD):c.1188delT ; NM_002225.4(IVD):c.1199A>G ; NM_002225.4(IVD):c.149G>A ; NM_002225.4(IVD):c.149G>C ; NM_002225.3(IVD):c.157C>T ; NM_002225.3(IVD):c.367G>A ; NM_002225.3(IVD):c.406_407delTG ; c.1055_1057+4del ; NM_002225.3:c.1147.1_1147.4delGTGA ; NM_002225.4(IVD):c.1174C>T ; NM_002225.3(IVD):c.134T>C ; NM_002225.3:c.243.1G-A ; NM_002225.3(IVD):c.390delT ; NM_002225.3:c.434_437dupATGA ; NM_002225.3(IVD):c.465+2T>C ; NM_002225.3:c.478_479insGT ; NM_002225.3(IVD):c.507delG ; NM_002225.3(IVD):c.559+1G>A ; NM_002225.3:c.593G-A ; NM_002225.3(IVD):c.605G>T ; NM_002225.4(IVD):c.784+1G>A ; NM_002225.3(IVD):c.941C>T ; NM_002225.3:c.994_995delAT

GENE

LAMA2

DISEASES
Laminin subunit alpha 2-related congenital muscular dystrophy
SUMMARY

Congenital muscular dystrophy type 1A (MCD1A) belongs to a group of neuromuscular disorders with onset at birth or infancy characterized by hypotonia, muscle weakness and muscle wasting.

CLINICAL DESCRIPTION

The disease presents at birth or in the first few months of life with hypotonia and muscle weakness in the limbs and trunk. Respiratory and feeding disorders can also occur. Motor development is delayed and limited (sitting or standing is only possible with help). Infants present with early rigidity of the vertebral column, scoliosis, and respiratory insufficiency. There is facial involvement with a typical elongated myopathic face and ocular ophthalmoplegia disorders can appear later. Epileptic attacks are possible, although they occur in less than a third of patients. Intellectual development is normal.

VARIANTS

NM_000426.3(LAMA2):c.2049_2050delAG ; NM_000426.3(LAMA2):c.7888C>T ; NM_000426.3(LAMA2):c.112+1G>A ; NM_000426.3(LAMA2):c.2451-2A>G ; NM_000426.3(LAMA2):c.2962C>T ; NM_000426.3(LAMA2):c.3623_3645del23 ; NM_000426.3(LAMA2):c.3718C>T ; NM_000426.3(LAMA2):c.5050G>T ; NM_000426.3(LAMA2):c.6955C>T ; c.1050del ; c.1612C>T ; NM_000426.3(LAMA2):c.184G>T ; NM_000426.3:c.2098_2099delTT ; NM_000426.3:c.2323-2A-T ; NM_000426.3(LAMA2):c.2750-1G>C ; NM_000426.3(LAMA2):c.2901C>A ; NM_000426.3(LAMA2):c.3215delG ; NM_000426.3(LAMA2):c.3237C>A ; NM_000426.3(LAMA2):c.3630delT ; NM_000426.3(LAMA2):c.3976C>T ; NM_000426.3(LAMA2):c.4645C>T ; c.5227G>T ; NM_000426.3(LAMA2):c.6011delA ; NM_000426.3(LAMA2):c.6038delT ; NM_000426.3:c.6334A-T ; NM_000426.3:c.6429.1G-A ; c.6617del ; NM_000426.3(LAMA2):c.7147C>T ; NM_000426.3(LAMA2):c.7279_7280delCT ; NM_000426.3(LAMA2):c.7536delC ; NM_000426.3(LAMA2):c.7732C>T ; NM_000426.3(LAMA2):c.7810C>T ; NM_000426.3(LAMA2):c.825delC ; c.8314del ; c.8705del ; NM_000426.3:c.8748delA ; NM_000426.3(LAMA2):c.9101_9104dupAACA ; c.9221del

GENE

LAMA3

DISEASES
Intermediate generalized junctional epidermolysis bullosa
SUMMARY

Generalized non-Herlitz-type junctional epidermolysis bullosa is a form of non-Herlitz-type junctional epidermolysis bullosa (JEB-nH, see this term) characterized by generalized skin blistering, atrophic scarring, nail dystrophy or nail absence, and enamel hypoplasia, with extracutaneous involvement.

CLINICAL DESCRIPTION

The condition is clinically apparent at birth. Skin blistering is generalized and healing can occur either with atrophic scars, sometimes accompanied by hypopigmentation or hyperpigmentation or, less commonly, with the formation of exuberant granulation tissue. Nail dystrophy or loss is a constant feature, focal keratoderma can develop over time. Progressive and permanent hair loss is frequently present, affecting the scalp, eyelashes and eyebrows; pubic and axillary hair are scant or do not fully develop. Mucosal lesions mainly affect the oral and nasal cavity, although there is considerable individual variability. Ocular involvement has been reported in some patients and comprises corneal erosions and scars, and, rarely, ectropion. The teeth regularly show enamel hypoplasia, leading to severe caries. Chronic anemia of multifactorial etiology, although of varying severity, is frequent and may be associated with a growth delay.

SUMMARY

Generalized non-Herlitz-type junctional epidermolysis bullosa is a form of non-Herlitz-type junctional epidermolysis bullosa (JEB-nH, see this term) characterized by generalized skin blistering, atrophic scarring, nail dystrophy or nail absence, and enamel hypoplasia, with extracutaneous involvement.

CLINICAL DESCRIPTION

The condition is clinically apparent at birth. Skin blistering is generalized and healing can occur either with atrophic scars, sometimes accompanied by hypopigmentation or hyperpigmentation or, less commonly, with the formation of exuberant granulation tissue. Nail dystrophy or loss is a constant feature, focal keratoderma can develop over time. Progressive and permanent hair loss is frequently present, affecting the scalp, eyelashes and eyebrows; pubic and axillary hair are scant or do not fully develop. Mucosal lesions mainly affect the oral and nasal cavity, although there is considerable individual variability. Ocular involvement has been reported in some patients and comprises corneal erosions and scars, and, rarely, ectropion. The teeth regularly show enamel hypoplasia, leading to severe caries. Chronic anemia of multifactorial etiology, although of varying severity, is frequent and may be associated with a growth delay.

Laryngo-onycho-cutaneous syndrome
SUMMARY

LOC syndrome is a subtype of junctional epidermolysis bullosa (JEB, see this term) characterized by an altered cry in the neonatal period and by aberrant production of granulation tissue in particular affecting the upper airway tract, conjunctiva and periungual/subungual sites.

CLINICAL DESCRIPTION

The condition is present at birth. Characteristic cutaneous findings are transient blisters leaving slowly healing erosions with exuberant granulation tissue formation, mainly localized to the head and neck, hands, feet, elbows and knees. Extracutaneous manifestations are always observed: the progressive laryngeal involvement frequently leads to fatal respiratory obstruction in infancy, and the chronic conjunctival lesions cause symblepharon formation, and also total palpebral occlusion and blindness. Enamel hypoplasia is also always present and nail dystrophies are common.

Severe generalized junctional epidermolysis bullosa
SUMMARY

Junctional epidermolysis bullosa, Herlitz-type is a severe subtype of junctional epidermolysis bullosa (JEB, see this term) characterized by blisters and extensive erosions, localized to the skin and mucous membranes.

CLINICAL DESCRIPTION

The condition is present at birth. Exuberant granulation tissue is a characteristic manifestation, which usually arises within the first several months to one to two years of life, and may involve the skin (around nail folds, in a mask-like distribution on the face, and at sites of friction, such as shoulders and buttocks), and the upper airways. Involvement of mucous membranes may affect the entire gastrointestinal (GI) tract, genitourinary tract, and respiratory tract to the bronchioles. However, the most significant and frequent mucosal lesions are those in the upper part of the GI and respiratory tracts. The numerous erosions and ulcerations of the oral mucosa severely hamper feeding, and involvement of the laryngotracheal mucosa, manifesting as hoarseness, dyspnea and stridor, may lead to acute respiratory failure requiring tracheostomy. Other constant features include nail anomalies with paronychia, various degrees of onychodystrophy and nail shedding. Dental abnormalities, when survival enables their observation, include regularly marked hypoplasia or complete absence of enamel. Frequent ocular lesions comprise corneal blisters, erosions and scarring and ectropion formation. Failure to thrive is an almost constant finding in JEB-H, and multifactorial anemia is also common.

SUMMARY

Junctional epidermolysis bullosa, Herlitz-type is a severe subtype of junctional epidermolysis bullosa (JEB, see this term) characterized by blisters and extensive erosions, localized to the skin and mucous membranes.

CLINICAL DESCRIPTION

The condition is present at birth. Exuberant granulation tissue is a characteristic manifestation, which usually arises within the first several months to one to two years of life, and may involve the skin (around nail folds, in a mask-like distribution on the face, and at sites of friction, such as shoulders and buttocks), and the upper airways. Involvement of mucous membranes may affect the entire gastrointestinal (GI) tract, genitourinary tract, and respiratory tract to the bronchioles. However, the most significant and frequent mucosal lesions are those in the upper part of the GI and respiratory tracts. The numerous erosions and ulcerations of the oral mucosa severely hamper feeding, and involvement of the laryngotracheal mucosa, manifesting as hoarseness, dyspnea and stridor, may lead to acute respiratory failure requiring tracheostomy. Other constant features include nail anomalies with paronychia, various degrees of onychodystrophy and nail shedding. Dental abnormalities, when survival enables their observation, include regularly marked hypoplasia or complete absence of enamel. Frequent ocular lesions comprise corneal blisters, erosions and scarring and ectropion formation. Failure to thrive is an almost constant finding in JEB-H, and multifactorial anemia is also common.

Hypoplastic amelogenesis imperfecta
SUMMARY

A rare genetic odontal or periodontal disorder that represents a group of developmental conditions affecting the structure and clinical appearance of the enamel of all or nearly all the teeth in a more or less equal manner, and which may be associated with morphologic or biochemical changes elsewhere in the body.

CLINICAL DESCRIPTION

The enamel may be hypoplastic, hypomineralised or both, and affected teeth may be discoloured, sensitive or prone to disintegration. Amelogenesis imperfecta (AI) exists in isolation or associated with other abnormalities as part of a syndrome.

VARIANTS

NM_000227.4(LAMA3):c.2662C>T ; NM_000227.4(LAMA3):c.3350+2T>G ; c.1182del ; NM_000227.4(LAMA3):c.1981C>T ; c.335del ; NM_000227.3:c.4335_4336insA ; NM_000227.3:c.4878dupT ; NM_198129.2(LAMA3):c.6943A>T ; NM_198129.2(LAMA3):c.8962C>T

GENE

LAMC2

DISEASES
Intermediate generalized junctional epidermolysis bullosa
SUMMARY

Generalized non-Herlitz-type junctional epidermolysis bullosa is a form of non-Herlitz-type junctional epidermolysis bullosa (JEB-nH, see this term) characterized by generalized skin blistering, atrophic scarring, nail dystrophy or nail absence, and enamel hypoplasia, with extracutaneous involvement.

CLINICAL DESCRIPTION

The condition is clinically apparent at birth. Skin blistering is generalized and healing can occur either with atrophic scars, sometimes accompanied by hypopigmentation or hyperpigmentation or, less commonly, with the formation of exuberant granulation tissue. Nail dystrophy or loss is a constant feature, focal keratoderma can develop over time. Progressive and permanent hair loss is frequently present, affecting the scalp, eyelashes and eyebrows; pubic and axillary hair are scant or do not fully develop. Mucosal lesions mainly affect the oral and nasal cavity, although there is considerable individual variability. Ocular involvement has been reported in some patients and comprises corneal erosions and scars, and, rarely, ectropion. The teeth regularly show enamel hypoplasia, leading to severe caries. Chronic anemia of multifactorial etiology, although of varying severity, is frequent and may be associated with a growth delay.

Junctional epidermolysis bullosa inversa
SUMMARY

Junctional epidermolysis bullosa inversa is a rare severe subtype of junctional epidermolysis bullosa (JEB, see this term) characterized by blistering and erosions confined to intertriginous skin sites, the esophagus, and vagina.

CLINICAL DESCRIPTION

Severe generalized junctional epidermolysis bullosa
SUMMARY

Junctional epidermolysis bullosa, Herlitz-type is a severe subtype of junctional epidermolysis bullosa (JEB, see this term) characterized by blisters and extensive erosions, localized to the skin and mucous membranes.

CLINICAL DESCRIPTION

The condition is present at birth. Exuberant granulation tissue is a characteristic manifestation, which usually arises within the first several months to one to two years of life, and may involve the skin (around nail folds, in a mask-like distribution on the face, and at sites of friction, such as shoulders and buttocks), and the upper airways. Involvement of mucous membranes may affect the entire gastrointestinal (GI) tract, genitourinary tract, and respiratory tract to the bronchioles. However, the most significant and frequent mucosal lesions are those in the upper part of the GI and respiratory tracts. The numerous erosions and ulcerations of the oral mucosa severely hamper feeding, and involvement of the laryngotracheal mucosa, manifesting as hoarseness, dyspnea and stridor, may lead to acute respiratory failure requiring tracheostomy. Other constant features include nail anomalies with paronychia, various degrees of onychodystrophy and nail shedding. Dental abnormalities, when survival enables their observation, include regularly marked hypoplasia or complete absence of enamel. Frequent ocular lesions comprise corneal blisters, erosions and scarring and ectropion formation. Failure to thrive is an almost constant finding in JEB-H, and multifactorial anemia is also common.

VARIANTS

NM_005562.2(LAMC2):c.1782_1783delGC ; NM_005562.2(LAMC2):c.1659C>A ; NM_005562.2(LAMC2):c.2137_2143delCAGAACC ; NM_005562.2(LAMC2):c.283C>T ; NM_005562.2:c.3069.1G-A ; NM_005562.2:c.3120_3121insA ; NM_005562.2:c.343C-T ; c.3512dup ; NM_005562.2(LAMC2):c.405-1G>A

GENE

LIFR

DISEASES
St�ve-Wiedemann syndrome
SUMMARY

St�ve-Wiedemann syndrome (SWS) is a rare autosomal recessive congenital primary skeletal dysplasia, characterized by small stature, bowing of the long bones, camptodactyly, hyperthermic episodes, respiratory distress/apneic episodes and feeding difficulties that usually lead to early mortality.

CLINICAL DESCRIPTION

SWS is characterized by short stature, bowing of extremities that affect the lower limbs more than the upper limbs, camptodactyly, respiratory distress/apneic spells and hyperthermic episodes frequently associated with feeding/swallowing difficulties. Other clinical findings are mask-like face, pursed mouth, hypoplastic midface, osteopenia, congenital contractures and muscular hypotonia. The condition is fatal in most cases as a result of respiratory distress or hyperthermia. However, survival beyond one year have been reported in few cases, and patients develop severe spinal deformities, along with streaky osteoporosis and spontaneous fractures, bowing of the lower limbs (with prominent joints) and dysautonomia (including temperature instability, absent corneal and patellar reflexes, and smooth tongue). Motor development is generally delayed but no intellectual deficit has been reported.

VARIANTS

NM_002310.5:c.1018_1022delAATTG ; NM_002310.5(LIFR):c.171_174delTAAC ; NM_002310.5(LIFR):c.1789C>T ; NM_002310.5(LIFR):c.2013dup ; c.2503G>T ; NM_002310.5(LIFR):c.653dup

GENE

LOXHD1

DISEASES
Autosomal recessive non-syndromic sensorineural deafness type DFNB
SUMMARY

Deafness is the most frequent form of sensorial deficit. In the vast majority of cases, the deafness is termed nonsyndromic or isolated and the hearing loss is the only clinical anomaly reported. In developed counties, 60-80% of cases of early-onset hearing loss are of genetic origin.

CLINICAL DESCRIPTION

The majority of cases presenting at birth concern perceptive deafness (with a neurosensory origin associated with the inner ear) rather than conductive deafness (anomalies in the amplification of sound waves between the middle ear - tympanum and auditory ossicles - and the outer ear). Autosomal dominant forms are characterised by very early onset and bilateral hearing loss with varying degrees of severity (ranging from mild to profound). No malformations of the inner ear can be detected by CT scan. Mutations in the PDS gene are responsible for 7% of cases of childhood deafness. In these cases, the deafness is marked by early-onset, usually bilateral (but sometimes asymmetric) hearing loss with autosomal recessive transmission. This form of deafness is always associated with malformations of the inner ear that can be detected by CT scan. In rare cases, thyroid gland disease may also be present. For the autosomal dominant forms of deafness, mutations in the COCH gene result in progressive postlingual deafness associated with severe attacks of vertigo and subjective tinnitus. This form of deafness should be distinguished from Meniere's disease (see this term). Autosomal dominant mutations in the WFS1 gene cause either a form of hearing loss affecting mainly low frequency sounds or deafness associated with optic atrophy.

VARIANTS

c.1191_1192del ; NM_144612.6(LOXHD1):c.2008C>T ; NM_144612.6:c.3924C-A ; c.457_461dup ; NM_144612.6:c.4714C>T ; NM_144612.6:c.512-1G-A

GENE

LRPPRC

DISEASES
Congenital lactic acidosis, Saguenay-Lac-Saint-Jean type
SUMMARY

Saguenay-Lac-St. Jean (SLSJ) type congenital lactic acidosis, a French Canadian form of Leigh syndrome (see this term), is a mitochondrial disease characterized by chronic metabolic acidosis, hypotonia, facial dysmorphism and delayed development.

CLINICAL DESCRIPTION

Facial dysmorphism is characterized by a prominent forehead, wide nasal bridge, hypertelorism, broad anterior fontanelle, midfacial hypoplasia, broad midline, synophrys, and a characteristic arched form of the eyebrows, along with mild hirsutism. There are 3 forms of the disease corresponding to varying degrees of severity: a neonatal form, a classic form and a so-called "survivor" form. The neonatal form is characterized by fulminant acidotic states. The classic form can occur from birth with severe lactic acidosis, or manifest between 14 and 24 months by ataxic gait. This form is associated with episodes of lactic acidosis that can be triggered by physical exertion, emotional stress, infection or a heavy meal, and/or metabolic crises. Patients known as "survivors", i.e. those who have survived several episodes, cross a critical threshold and show less severe symptoms including hypotonia, asthenia, developmental delay (language acquisition and walking) and, in older patients, truncal ataxia, and a characteristic wide-based gait.

VARIANTS

NM_133259.3(LRPPRC):c.1061C>T ; c.3830_3839delinsAG

GENE

MAN2B1

DISEASES
Alpha-mannosidosis, adult form
SUMMARY

An inherited lysosomal storage disorder characterized by immune deficiency, facial and skeletal abnormalities, hearing impairment, and intellectual deficit.

CLINICAL DESCRIPTION

Affected infants often appear normal at birth but their condition worsens progressively. However, some children are born with ankle equinus or develop hydrocephalus in the first year of life. Main features are immune deficiency (manifested by recurrent infections, especially in the first decade of life), skeletal abnormalities (mild-to-moderate dysostosis multiplex, scoliosis and deformation of the sternum), hearing impairment (moderate-to-severe sensorineural hearing loss), gradual impairment of mental functions and speech, and often, periods of psychosis. Associated motor function disturbances include muscular weakness, joint abnormalities and ataxia. The facial dysmorphism is marked by a large head with a prominent forehead, rounded eyebrows, a flattened nasal bridge, macroglossia, widely spaced teeth, and prognathism. Slight strabismus is common. The clinical variability is significant, representing a continuum in severity.

Alpha-mannosidosis, infantile form
SUMMARY

An inherited lysosomal storage disorder characterized by immune deficiency, facial and skeletal abnormalities, hearing impairment, and intellectual deficit.

CLINICAL DESCRIPTION

Affected infants often appear normal at birth but their condition worsens progressively. However, some children are born with ankle equinus or develop hydrocephalus in the first year of life. Main features are immune deficiency (manifested by recurrent infections, especially in the first decade of life), skeletal abnormalities (mild-to-moderate dysostosis multiplex, scoliosis and deformation of the sternum), hearing impairment (moderate-to-severe sensorineural hearing loss), gradual impairment of mental functions and speech, and often, periods of psychosis. Associated motor function disturbances include muscular weakness, joint abnormalities and ataxia. The facial dysmorphism is marked by a large head with a prominent forehead, rounded eyebrows, a flattened nasal bridge, macroglossia, widely spaced teeth, and prognathism. Slight strabismus is common. The clinical variability is significant, representing a continuum in severity.

VARIANTS

NM_000528.3(MAN2B1):c.1067C>G ; NM_000528.3(MAN2B1):c.215A>T ; NM_000528.3(MAN2B1):c.2278C>T ; NM_000528.3(MAN2B1):c.2426T>C ; NM_000528.3(MAN2B1):c.2436+2T>C ; NM_000528.3:c.1780C-T ; NM_000528.3(MAN2B1):c.1830+1G>C ; NM_000528.3(MAN2B1):c.1915C>T ; NM_000528.3(MAN2B1):c.1929G>A ; NM_000528.3:c.2013delT ; NM_000528.3:c.2119C-T ; c.2365C>T ; NM_000528.3(MAN2B1):c.2398G>A ; NM_000528.3:c.2686_2687delCTinsG ; NM_000528.3(MAN2B1):c.384G>A

GENE

MAT1A

DISEASES
Brain demyelination due to methionine adenosyltransferase deficiency
SUMMARY

Hypermethioninemia due to methionine adenosyltransferase deficiency is a very rare metabolic disorder resulting in isolated hepatic hypermethioninemia that is usually benign due to partial inactivation of enzyme activity. Rarely patients have been found to have an odd odor or neurological disorders such as brain demyelination.

CLINICAL DESCRIPTION

VARIANTS

NM_000429.2(MAT1A):c.1070C>T ; NM_000429.2(MAT1A):c.1006G>A ; c.1043_1044del ; NM_000429.2:c.538_539insTG ; NM_000429.2(MAT1A):c.790C>T ; NM_000429.2(MAT1A):c.791G>A ; NM_000429.2:c.827_828insG ; NM_000429.2(MAT1A):c.914T>C ; NM_000429.2(MAT1A):c.966T>G

GENE

MCCC1

DISEASES
3-methylcrotonyl-CoA carboxylase deficiency
SUMMARY

A rare inherited disorder of leucine metabolism characterized by a highly variable clinical picture ranging from metabolic crisis in infancy to asymptomatic adults.

CLINICAL DESCRIPTION

Patients with 3-methylcrotonyl-CoA carboxylase deficiency (3-MCCD) have a variable clinical phenotype with the vast majority of patients being asymptomatic and a small subgroup displaying symptoms of an organic aciduria, usually in association with environmental triggering factors. Many newborns now diagnosed through expanded newborn screening tests remain asymptomatic, indicating that the disease has a very low clinical penetrance. Most symptomatic patients have normal growth and development until presenting with an acute metabolic crisis, usually following a minor infection, fasting or introduction of a protein-rich diet, between the ages of 2-33 months. Symptoms include vomiting, coma and apnea. Rarely, neurological abnormalities (i.e. metabolic stroke, hemiparesis, and encephalopathy), weakness, muscular hypotonia and developmental delay have been reported. Between episodes of metabolic crisis patients are usually asymptomatic. Some patients with 3-MCCD may not develop symptoms until adulthood, manifesting with weakness and fatigue, while others may never show symptoms.

VARIANTS

NM_020166.4(MCCC1):c.1277T>C ; NM_020166.4(MCCC1):c.640-2A>G ; NM_020166.4(MCCC1):c.1074del ; NM_020166.4(MCCC1):c.1114C>T ; NM_020166.4(MCCC1):c.1155A>C ; NM_020166.4(MCCC1):c.1310T>C ; NM_020166.4(MCCC1):c.1380T>G ; NM_020166.4(MCCC1):c.1526delG ; NM_020166.4(MCCC1):c.1905delA ; NM_020166.4(MCCC1):c.1930G>T ; NM_020166.4(MCCC1):c.2079del ; NM_020166.3:c.310C-T ; NM_020166.4(MCCC1):c.343C>T ; NM_020166.4(MCCC1):c.640-1G>A ; NC_000003.12:g.183071292del

GENE

MCCC2

DISEASES
3-methylcrotonyl-CoA carboxylase deficiency
SUMMARY

A rare inherited disorder of leucine metabolism characterized by a highly variable clinical picture ranging from metabolic crisis in infancy to asymptomatic adults.

CLINICAL DESCRIPTION

Patients with 3-methylcrotonyl-CoA carboxylase deficiency (3-MCCD) have a variable clinical phenotype with the vast majority of patients being asymptomatic and a small subgroup displaying symptoms of an organic aciduria, usually in association with environmental triggering factors. Many newborns now diagnosed through expanded newborn screening tests remain asymptomatic, indicating that the disease has a very low clinical penetrance. Most symptomatic patients have normal growth and development until presenting with an acute metabolic crisis, usually following a minor infection, fasting or introduction of a protein-rich diet, between the ages of 2-33 months. Symptoms include vomiting, coma and apnea. Rarely, neurological abnormalities (i.e. metabolic stroke, hemiparesis, and encephalopathy), weakness, muscular hypotonia and developmental delay have been reported. Between episodes of metabolic crisis patients are usually asymptomatic. Some patients with 3-MCCD may not develop symptoms until adulthood, manifesting with weakness and fatigue, while others may never show symptoms.

VARIANTS

NM_022132.4(MCCC2):c.1015G>A ; NM_022132.4(MCCC2):c.1065A>T ; NM_022132.4(MCCC2):c.838G>T ; NM_022132.4:c.1072.1G-A ; c.1577dup ; NM_022132.4:c.1580G-A ; NM_022132.4(MCCC2):c.295G>C ; NM_022132.4(MCCC2):c.380C>G ; NM_022132.4(MCCC2):c.464G>A ; NM_022132.4(MCCC2):c.517dupT ; NM_022132.4:c.641delG ; NM_022132.4(MCCC2):c.735dup ; NM_022132.4(MCCC2):c.929C>G ; NM_022132.4(MCCC2):c.994C>T

GENE

MCOLN1

DISEASES
Mucolipidosis type IV
SUMMARY

Mucolipidosis type IV (ML IV) is a lysosomal storage disease characterised clinically by psychomotor retardation and visual abnormalities including corneal clouding, retinal degeneration, or strabismus.

CLINICAL DESCRIPTION

In ML IV patients, phospholipids, gangliosides and mucopolysaccharides accumulate in lysosomal inclusions, some of which resemble membranous cytoplasmic bodies found in gangliosidoses. The condition seems to be caused by anomalies in the endocytosis of membrane components towards the lysosomes. The causative gene, MCOLN1, is located in the 19p13.3-p13.2 region and encodes mucolipin-1 (MLN1), a membrane protein from the transient receptor potential (TRP) channel family. Around 20 mutations have been described in the literature, two of which represent 95% of the alleles identified in the Ashkenazi population.

VARIANTS

NM_020533.2(MCOLN1):c.1084G>T ; NM_000159.4:c.1207C>T ; NM_020533.2(MCOLN1):c.304C>T ; NM_020533.3:c.964C>T

GENE

MECP2

DISEASES
Atypical Rett syndrome
SUMMARY

A rare genetic neurological disorder characterized by the presence of two or more of the main criteria for classic Rett syndrome (loss of acquired purposeful hand skills, loss of acquired spoken language, gait abnormalities, stereotypic hand movements), a period of regression followed by recovery or stabilization, and five out of eleven supportive criteria (breathing difficulties, bruxism, impaired sleep pattern, abnormal muscle tone, peripheral vasomotor disturbances, scoliosis/kyphosis, delayed growth, small cold hands and feet, inappropriate laughter or screaming spells, decreased pain sensation, and intense eye communication). Like classic Rett syndrome, it almost exclusively affects girls, while the disease course may be either milder or more severe.

CLINICAL DESCRIPTION

Atypical forms may present with either a milder or more severe clinical picture than that seen in typical RTT. Several subvariants of atypical RTT have been defined. i) The early-onset seizure type (Hanefeld variant) is characterized by seizures in the first months of life with subsequent development of RTT features. ii) The congenital variant (Rolando variant) is the most severe form of atypical RTT, with onset of classic RTT features during the first three months of life. iii) The 'forme fruste' is a milder variant with onset in early childhood and an incomplete and protracted course. iv) The late childhood regression form is characterized by a normal head circumference and by a more gradual and later onset (late childhood) regression of language and motor skills. v) The preserved speech variant (PSD or Zappella variant) is marked by recovery of some verbal and manual skills.

Autism
SUMMARY

CLINICAL DESCRIPTION

Autism, the prototypic pervasive developmental disorder (PDD), is usually apparent by 3 years of age. It is characterized by a triad of limited or absent verbal communication, a lack of reciprocal social interaction or responsiveness, and restricted, stereotypic, and ritualized patterns of interests and behavior. 'Autism spectrum disorder,' sometimes referred to as ASD, is a broader phenotype encompassing the less severe disorders Asperger syndrome and pervasive developmental disorder, not otherwise specified (PDD-NOS). 'Broad autism phenotype' includes individuals with some symptoms of autism, but who do not meet the full criteria for autism or other disorders. Mental retardation coexists in approximately two-thirds of individuals with ASD, except for Asperger syndrome, in which mental retardation is conspicuously absent. Genetic studies in autism often include family members with these less stringent diagnoses.

Rett syndrome
SUMMARY

A rare severe, X-linked, neurodevelopmental disorder characterized by rapid developmental regression in infancy, partial or complete loss of purposeful hand movements, loss of speech, gait abnormalities, and stereotypic hand movements, commonly associated with deceleration of head growth, severe intellectual disability, seizures, and breathing abnormalities. The disorder has a progressive clinical course and may associate various comorbidities including gastrointestinal diseases, scoliosis, and behavioral disorders.

CLINICAL DESCRIPTION

Classic or typical Rett syndrome (RTT) primarily affects girls and is characterized by apparently normal psychomotor development during the first 6-18 months of life followed by developmental stagnation with rapid regression in language and motor abilities, and subsequent long-term plateauing of skills. Repetitive, stereotypic hand movements replace purposeful hand use. Additional findings include autistic features, panic-like attacks, bruxism, episodic apnea and/or hyperpnea, gait ataxia and apraxia, tremors, seizures (60-80%), and acquired microcephaly. There is a wide variability in the rate of disease progression and severity. A number of males with a phenotype comparable to females with classical RTT have been described.

Severe neonatal-onset encephalopathy with microcephaly
SUMMARY

Severe neonatal-onset encephalopathy with microcephaly is a rare monogenic disease with epilepsy characterized by neonatal-onset encephalopathy, microcephaly, severe developmental delay or absent development, breathing abnormalities (including central hypoventilation and/or respiratory insufficiency), intractable seizures, abnormal muscle tone and involuntary movements. Early death is usual.

CLINICAL DESCRIPTION

The MECP2 gene is mutated in Rett syndrome (RTT), a severe neurodevelopmental disorder that almost always occurs in females. Although it was first thought that MECP2 mutations causing Rett syndrome were lethal in males, later reports identified a severe neonatal encephalopathy in surviving male sibs of patients with Rett syndrome.

Systemic lupus erythematosus
SUMMARY

Systemic lupus erythematosus (SLE) is a complex autoimmune disease characterized by production of autoantibodies against nuclear, cytoplasmic, and cell surface molecules that transcend organ-specific boundaries. Tissue deposition of antibodies or immune complexes induces inflammation and subsequent injury of multiple organs and finally results in clinical manifestations of SLE, including glomerulonephritis, dermatitis, thrombosis, vasculitis, seizures, and arthritis.

CLINICAL DESCRIPTION

Trisomy Xq28
SUMMARY

Distal Xq duplications refer to chromosomal disorders resulting from involvement of the long arm of the X chromosome (Xq). Clinical manifestations vary widely depending on the gender of the patient and on the gene content of the duplicated segment. The prevalence of Xq duplications remains unknown.

CLINICAL DESCRIPTION

The most frequently reported distal duplications involve the Xq28 segment and yield a recognizable phenotype including distinctive facial features (premature closure of the fontanels or a ridged metopic suture, a broad face with full cheeks, epicanthal folds, large ears, a small and open mouth, ear anomalies, a pointed nose, an abnormal palate and facial hypotonia), major axial hypotonia, severe developmental delay, severe feeding difficulties, abnormal genitalia and susceptibility to infections.

X-linked intellectual disability-psychosis-macroorchidism syndrome
SUMMARY

An X-linked syndromic intellectual disability characterized by developmental delay, variable degree of intellectual disability, speech delay or absent speech, pyramidal signs, tremor, macroorchidism and variable mood and behavior problems, including psychosis and autistic-like behavior. Males are predominantly affected, some females show lower cognitive abilities.

CLINICAL DESCRIPTION

The MECP2 gene is mutated in Rett syndrome (RTT), a severe neurodevelopmental disorder that almost always occurs in females. Males with non-RTT mutations in the MECP2 gene can demonstrate a wide variety of phenotypes, including X-linked mental retardation with spasticity and other variable features, described here, and Lubs X-linked mental retardation syndrome (MRXSL). Males with RTT-associated MECP2 mutations have neonatal severe encephalopathy that is usually lethal (300673).

X-linked non-syndromic intellectual disability
SUMMARY

MECP2 duplication syndrome is an X-linked neurodevelopmental disorder characterized by severe to profound mental retardation, infantile hypotonia, mild dysmorphic features, poor speech development, autistic features, seizures, progressive spasticity, and recurrent infections. Only males are affected, although female carriers may have some mild neuropsychiatric features, such as anxiety. Submicroscopic Xq28 duplications encompassing MECP2 are considered nonrecurrent events, because the breakpoint locations and rearrangement sizes vary among affected individuals.

CLINICAL DESCRIPTION

0

VARIANTS

NM_001110792.1(MECP2):c.1200A>C ; NM_004992.3(MECP2):c.343C>T ; NM_004992.3(MECP2):c.378-3C>G ; NM_004992.3(MECP2):c.397C>T ; NM_004992.3(MECP2):c.452A>G ; NM_004992.3(MECP2):c.455C>G ; NM_004992.3(MECP2):c.568C>T ; NM_004992.3(MECP2):c.1087_1088insC ; NM_004992.3(MECP2):c.1152_1171del20 ; NM_004992.3(MECP2):c.1159_1174del16 ; NM_004992.3(MECP2):c.1163_1197del35 ; NM_004992.3(MECP2):c.1163dup ; NM_001110792.1(MECP2):c.1200_1235del36insT ; NM_001110792.1(MECP2):c.1250_1263delCCCAGGACTTGAGC ; NM_001110792.1(MECP2):c.1282G>T ; NM_004992.3(MECP2):c.1350C>G ; NM_004992.3(MECP2):c.1450_*24del36 ; NM_001110792.1(MECP2):c.1A>G ; NM_004992.3(MECP2):c.20G>A ; NM_004992.3(MECP2):c.253C>T ; NM_004992.3(MECP2):c.312G>T ; NM_004992.3(MECP2):c.316C>T ; NM_004992.3(MECP2):c.332G>A ; NM_004992.3(MECP2):c.353G>C ; NM_004992.3(MECP2):c.376A>G ; NM_004992.3(MECP2):c.401C>G ; NM_001110792.1(MECP2):c.414-3C>T ; NM_004992.3(MECP2):c.419C>T ; NM_001110792.1(MECP2):c.433C>A ; NM_004992.3(MECP2):c.451G>T ; NM_004992.3(MECP2):c.468C>A ; NM_004992.3(MECP2):c.473C>T ; NM_004992.3(MECP2):c.487G>T ; NM_004992.3(MECP2):c.499C>T ; NM_004992.3(MECP2):c.569G>A ; NM_004992.3(MECP2):c.574A>T ; NM_001110792.1(MECP2):c.5C>T ; NM_004992.3(MECP2):c.650C>T ; NM_004992.3:c.728_731delCCCA ; NM_004992.3(MECP2):c.763C>T ; NM_004992.3(MECP2):c.815delC ; NM_004992.3(MECP2):c.840delC ; NM_004992.3(MECP2):c.854delA ; NM_004992.3(MECP2):c.905C>T ; NM_004992.3(MECP2):c.907A>G ; NM_004992.3(MECP2):c.915G>T ; NM_001110792.1(MECP2):c.916C>T ; NM_004992.3(MECP2):c.917G>A ; NM_004992.3(MECP2):c.917G>C ; NM_004992.3(MECP2):c.919A>G ; NM_004992.3(MECP2):c.925C>T ; NM_004992.3(MECP2):c.-99+2T>G ; NM_004992.3(MECP2):c.1009_1027del19 ; NM_004992.3(MECP2):c.100_103delGATA ; NM_004992.3(MECP2):c.1024_1025insAG ; NM_001110792.1(MECP2):c.1025_10320delAGAAGAinsGCATCTTCTCCTCTTT ; NM_004992.3(MECP2):c.1029delG ; NM_004992.3(MECP2):c.102delT ; NM_004992.3(MECP2):c.1038C>G ; NM_001110792.1(MECP2):c.1055dup ; NM_004992.3(MECP2):c.1069_1071delAGC ; NM_004992.3(MECP2):c.1079C>A ; NM_004992.3(MECP2):c.107_108delAA ; NM_004992.3(MECP2):c.107_113del7 ; NM_004992.3(MECP2):c.1086delC ; NM_004992.3(MECP2):c.1086dupC ; NM_004992.3(MECP2):c.1087A>T ; NM_004992.3(MECP2):c.108_111delAGAA ; NM_004992.3(MECP2):c.1099_1118del20 ; NM_004992.3(MECP2):c.1105delC ; NM_004992.3(MECP2):c.1111dup ; NM_004992.3(MECP2):c.1118C>G ; NM_004992.3(MECP2):c.1119dup ; NM_004992.3(MECP2):c.1127_1137del11 ; NM_004992.3(MECP2):c.1135_1142delCCCGTGCC ; NM_004992.3(MECP2):c.1137delC ; NM_004992.3(MECP2):c.1137dup ; NM_004992.3(MECP2):c.1151_1188del38 ; NM_004992.3(MECP2):c.1152_1155del4 ; NM_004992.3(MECP2):c.1153_1190del38 ; NM_004992.3(MECP2):c.1154_1185del32 ; NM_004992.3(MECP2):c.1154_1186del ; NM_004992.3(MECP2):c.1155_1183del29 ; NM_004992.3(MECP2):c.1156_1157dupCT ; NM_004992.3(MECP2):c.1156_1172del17 ; NM_004992.3(MECP2):c.1157_1187del31 ; NM_004992.3(MECP2):c.1157_1188del32 ; NM_004992.3(MECP2):c.1157_1191del35 ; NM_004992.3(MECP2):c.1158_1167del10 ; NM_004992.3(MECP2):c.1158_1186del29 ; NM_004992.3(MECP2):c.1158_1186del29insCCA ; NM_004992.3(MECP2):c.1159_1160delCCinsT ; NM_004992.3(MECP2):c.1160_1166delCCCCACC ; NM_004992.3(MECP2):c.1160_1185del26 ; NM_004992.3(MECP2):c.1160_1188del29 ; NM_004992.3(MECP2):c.1162_1163delCC ; NM_004992.3(MECP2):c.1162_1163delCCinsTA ; NM_004992.3(MECP2):c.1163_1179del17 ; NM_004992.3(MECP2):c.1163_1188del26 ; NM_004992.3(MECP2):c.1164_1194del31 ; NM_004992.3(MECP2):c.1164delA ; NM_004992.3(MECP2):c.1165_1190del26 ; NM_004992.3(MECP2):c.1167_1200del34 ; NM_004992.3(MECP2):c.1170_1207del38 ; NM_004992.3(MECP2):c.117dupA ; NM_004992.3(MECP2):c.1180G>T ; NM_004992.3(MECP2):c.1180_1181insT ; NM_004992.3(MECP2):c.1180_1205del26 ; NM_004992.3(MECP2):c.1189G>T ; NM_004992.3(MECP2):c.1190dupA ; NM_004992.3(MECP2):c.1194_1195insT ; NM_004992.3(MECP2):c.1197dupC ; NM_004992.3(MECP2):c.119_120delAG ; NM_001110792.1(MECP2):c.1200_1220del21insCTGAGCCCCAGGACTTGAGCA ; NM_004992.3(MECP2):c.1200dupC ; NM_001110792.1(MECP2):c.1202_1203insC ; NM_004992.3(MECP2):c.1202dupG ; NM_004992.3(MECP2):c.1209delT ; NM_004992.3(MECP2):c.1214_1230del17 ; NM_004992.3(MECP2):c.1216C>T ; NM_004992.3(MECP2):c.1235_1260del26 ; NM_001110792.1(MECP2):c.1244dup ; NM_004992.3(MECP2):c.1265_1289del25insAGCGGCCG ; NM_004992.3(MECP2):c.126dupG ; NM_004992.3(MECP2):c.1290_1291insC ; NM_004992.3(MECP2):c.1308_1309delTC ; NM_004992.3(MECP2):c.1316_1317delCG ; NM_004992.3(MECP2):c.1320dupT ; NM_004992.3(MECP2):c.1330_1342del13 ; NM_004992.3(MECP2):c.1338_1343del ; NM_004992.3(MECP2):c.1357C>T ; NM_004992.3(MECP2):c.1363G>T ; NM_004992.3(MECP2):c.1364_1365insC ; NM_001110792.1(MECP2):c.1384dup ; NM_004992.3(MECP2):c.140dupA ; NM_004992.3(MECP2):c.1415_1416delAG ; NM_001110792.1(MECP2):c.1444_1447delAACAinsTG ; NM_004992.3(MECP2):c.1450_*12del24 ; NM_004992.3(MECP2):c.1450_1453delAGAG ; NM_004992.3(MECP2):c.1452_1453dup ; NM_004992.3(MECP2):c.1455_1456dupTA ; NM_004992.3(MECP2):c.146C>A ; NM_004992.3(MECP2):c.146C>G ; NM_004992.3(MECP2):c.167_168delCC ; NM_004992.3(MECP2):c.189_190delGA ; NM_004992.3(MECP2):c.194C>G ; NM_001110792.1(MECP2):c.1A>T ; NM_004992.3(MECP2):c.1A>T ; NM_004992.3(MECP2):c.201delG ; NM_004992.3(MECP2):c.203C>G ; NM_004992.3(MECP2):c.215dupC ; NM_004992.3(MECP2):c.229_238del10 ; NM_004992.3(MECP2):c.233delC ; NM_001110792.1(MECP2):c.23_27dupCGCCG ; NM_004992.3(MECP2):c.243dupC ; NM_004992.3(MECP2):c.258_259delCA ; NM_004992.3(MECP2):c.26+2T>A ; NM_004992.3(MECP2):c.27-2A>G ; NM_004992.3(MECP2):c.27-6C>G ; NM_004992.3(MECP2):c.274G>T ; NM_004992.3(MECP2):c.275delG ; NM_004992.3(MECP2):c.275dupG ; NM_004992.3(MECP2):c.283_286del ; NM_004992.3(MECP2):c.28G>T ; NM_004992.3(MECP2):c.295_297delACC ; NM_004992.3(MECP2):c.298C>G ; NM_004992.3(MECP2):c.301C>T ; NM_004992.3(MECP2):c.302C>A ; NM_004992.3(MECP2):c.302C>G ; NM_004992.3(MECP2):c.302C>T ; NM_001110792.1(MECP2):c.30_31del ; NM_001110792.1(MECP2):c.30delCinsGA ; NM_004992.3(MECP2):c.311G>A ; NM_004992.3(MECP2):c.311_323del13 ; NM_004992.3(MECP2):c.315dupA ; NM_004992.3(MECP2):c.317G>A ; NM_004992.3(MECP2):c.318_321dup ; NM_004992.3(MECP2):c.325A>G ; NM_004992.3(MECP2):c.326dupA ; NM_004992.3(MECP2):c.341_349delGCCGCTCTG ; NM_004992.3(MECP2):c.345delC ; NM_004992.3(MECP2):c.35_42dup ; NM_004992.3(MECP2):c.364G>A ; NM_004992.3(MECP2):c.375delC ; NM_004992.3(MECP2):c.377+1G>A ; NM_004992.3(MECP2):c.377+1G>T ; NM_004992.3(MECP2):c.378-2A>C ; NM_004992.3(MECP2):c.378-2A>G ; NM_004992.3(MECP2):c.378-2A>T ; NM_004992.3(MECP2):c.380C>T ; NM_004992.3(MECP2):c.382C>T ; NM_004992.3(MECP2):c.390delA ; NM_004992.3(MECP2):c.398G>A ; NM_004992.3(MECP2):c.401C>T ; NM_004992.3(MECP2):c.403A>G ; NM_004992.3(MECP2):c.410A>G ; NM_004992.3(MECP2):c.411delG ; NM_004992.3(MECP2):c.413T>A ; NM_001110792.1(MECP2):c.414-3_419del ; NM_001110792.1(MECP2):c.41_57dup ; NM_004992.3(MECP2):c.420delG ; NM_004992.3(MECP2):c.422dupA ; NM_004992.3(MECP2):c.423C>G ; NM_004992.3(MECP2):c.428_429insT ; NM_004992.3(MECP2):c.430A>T ; NM_004992.3(MECP2):c.431delA ; NM_004992.3(MECP2):c.439delG ; NM_004992.3(MECP2):c.451delG ; NM_004992.3(MECP2):c.454C>G ; NM_004992.3(MECP2):c.464T>C ; NM_004992.3(MECP2):c.468C>G ; NM_004992.3(MECP2):c.46C>T ; NM_004992.3(MECP2):c.470_471delTC ; NM_004992.3(MECP2):c.470dupT ; NM_004992.3(MECP2):c.472A>G ; NM_004992.3(MECP2):c.475delG ; NM_004992.3(MECP2):c.47_57del ; NM_001110792.1(MECP2):c.47_57del11 ; NM_001110792.1(MECP2):c.47_57dup ; NM_004992.3(MECP2):c.480_481delTG ; NM_004992.3(MECP2):c.480delT ; NM_004992.3(MECP2):c.483delG ; NM_004992.3(MECP2):c.484dupA ; NM_004992.3(MECP2):c.488_489delGG ; NM_001110792.1(MECP2):c.48C>T ; NM_001110792.1(MECP2):c.48_55del8 ; NM_001110792.1(MECP2):c.48_55dup ; NM_004992.3(MECP2):c.495delC ; NM_004992.3(MECP2):c.502C>T ; NM_004992.3(MECP2):c.508C>T ; NM_004992.3(MECP2):c.50dupA ; NM_001110792.1(MECP2):c.520A>G ; NM_004992.3(MECP2):c.523A>T ; NM_004992.3(MECP2):c.529A>T ; NM_004992.3(MECP2):c.531delA ; NM_004992.3(MECP2):c.538A>T ; NM_004992.3(MECP2):c.543_544delTC ; NM_004992.3(MECP2):c.554delG ; NM_004992.3(MECP2):c.556A>T ; NM_004992.3(MECP2):c.55C>T ; NM_004992.3(MECP2):c.566delG ; NM_004992.3(MECP2):c.566dupG ; NM_004992.3(MECP2):c.567dupA ; NM_004992.3(MECP2):c.56dupA ; NM_004992.3:c.586_589delACCA ; NM_004992.3(MECP2):c.592A>T ; NM_004992.3(MECP2):c.598A>T ; NM_001110792.1(MECP2):c.59_60delGA ; NM_004992.3(MECP2):c.601dupG ; NM_004992.3(MECP2):c.608_609insA ; NM_004992.3(MECP2):c.611C>G ; NM_004992.3(MECP2):c.613G>T ; NM_004992.3(MECP2):c.617delG ; NM_001110792.1(MECP2):c.62+1G>A ; NM_001110792.1(MECP2):c.62+2_62+3delTG ; NM_004992.3(MECP2):c.620dupT ; NM_004992.3(MECP2):c.622C>T ; NM_001110792.1(MECP2):c.647_648delCAinsAG ; NM_001110792.1(MECP2):c.648dup ; NM_004992.3(MECP2):c.64A>T ; NM_004992.3(MECP2):c.651_652delTG ; NM_004992.3(MECP2):c.654_657delGAAG ; NM_004992.3(MECP2):c.665_671dup ; NM_004992.3(MECP2):c.673C>A ; NM_004992.3(MECP2):c.674C>T ; NM_004992.3(MECP2):c.676_677insA ; NM_004992.3(MECP2):c.677_678insA ; NM_004992.3(MECP2):c.678delT ; NM_004992.3(MECP2):c.686C>A ; NM_004992.3(MECP2):c.690delA ; NM_004992.3(MECP2):c.695delG ; NM_004992.3(MECP2):c.695dupG ; NM_004992.3(MECP2):c.696delC ; NM_004992.3(MECP2):c.710delG ; NM_004992.3(MECP2):c.710dupG ; NM_004992.3(MECP2):c.715delG ; NM_004992.3(MECP2):c.720dupC ; NM_004992.3(MECP2):c.730C>T ; NM_004992.3(MECP2):c.734_759del26 ; NM_004992.3(MECP2):c.736_737insAT ; NM_004992.3(MECP2):c.739delG ; NM_004992.3(MECP2):c.747_751dup ; NM_004992.3(MECP2):c.748_749insT ; NM_004992.3(MECP2):c.748dupC ; NM_004992.3(MECP2):c.750_774dup ; NM_004992.3(MECP2):c.753delC ; NM_004992.3(MECP2):c.755delG ; NM_004992.3(MECP2):c.755dupG ; NM_004992.3(MECP2):c.756_759delCAGG ; NM_004992.3(MECP2):c.756_763dup ; NM_004992.3(MECP2):c.760A>T ; NM_004992.3(MECP2):c.766A>T ; NM_004992.3(MECP2):c.76delC ; NM_001110792.1(MECP2):c.772_779delATGGTGATinsGTG ; NM_004992.3(MECP2):c.784C>T ; NM_004992.3(MECP2):c.785_818del34 ; NM_001110792.1(MECP2):c.786delCinsTCAGGAAGCTT ; NM_004992.3(MECP2):c.792_793delTC ; NM_004992.3(MECP2):c.799A>T ; NM_001110792.1(MECP2):c.802_815dup ; NM_004992.3(MECP2):c.806delG ; NM_004992.3(MECP2):c.808C>T ; NM_004992.3(MECP2):c.808delC ; NM_004992.3(MECP2):c.810_813delAAAG ; NM_004992.3(MECP2):c.812_818del7 ; NM_004992.3(MECP2):c.816_832del17 ; NM_004992.3(MECP2):c.819_820insCCGAAAGCCGGGG ; NM_004992.3(MECP2):c.819delG ; NM_004992.3(MECP2):c.821_822delGT ; NM_004992.3(MECP2):c.830delC ; NM_004992.3(MECP2):c.854dupA ; NM_004992.3(MECP2):c.855_859delGAAAGinsAAAAAAAAGACT ; NM_004992.3(MECP2):c.856_859delAAAG ; NM_004992.3(MECP2):c.864dupG ; NM_004992.3(MECP2):c.865A>T ; NM_004992.3(MECP2):c.865_866delAA ; NM_004992.3(MECP2):c.869dupA ; NM_004992.3(MECP2):c.874_875insA ; NM_004992.3(MECP2):c.880_884del5 ; NM_004992.3(MECP2):c.881_902del22 ; NM_004992.3(MECP2):c.883delT ; NM_004992.3(MECP2):c.889C>T ; NM_004992.3(MECP2):c.898_901del ; NM_004992.3(MECP2):c.898_904del7 ; NM_004992.3(MECP2):c.898delG ; NM_004992.3(MECP2):c.905C>G ; NM_001110792.1(MECP2):c.905_916delAGTCTTCTATCCinsCACA ; NM_004992.3(MECP2):c.906delC ; NM_004992.3(MECP2):c.910A>C ; NM_004992.3(MECP2):c.916C>T ; NM_004992.3(MECP2):c.91delG ; NM_004992.3(MECP2):c.964C>T ; NM_004992.3(MECP2):c.965C>T ; NM_004992.3(MECP2):c.994_998delAGCGG ; NM_004992.3(MECP2):c.997_1001delGGGAA ; NC_000023.11:g.154030877dup ; NC_000023.11:g.154031078_154031079insA ; NC_000023.11:g.154031213_154031214CT[1] ; NC_000023.11:g.154032340T>A ; NC_000023.11:g.154032527del ; NC_000023.11:g.154097643del

GENE

MEFV

DISEASES
Behçet disease
SUMMARY

A rare, chronic, relapsing, multisystemic vasculitis characterized by mucocutaneous lesions, as well as articular, vascular, ocular and central nervous system manifestations.

CLINICAL DESCRIPTION

Onset most commonly occurs in adults (mean 30 years of age), but pediatric cases have been reported. Relapsing episodes of round oral aphthae with sharp erythematous and elevated borders (1-3 cm diameter) may be accompanied by genital aphthae (>50% of cases); cutaneous features may include pseudo-folliculitis and erythema nodosum. Ocular disorders (posterior uveitis, retinal vasculitis) occur in over 50% of BD patients. Arthralgia and/or non-erosive, asymmetric, arthritis affecting mainly large articulation (knees, ankles ect.) are frequent (45%) and can occur as an initial symptom. Vasculitis in BD is more frequent in the venous system where thromboses in femoro-iliac, superior and inferior vena cava and cerebral territories may occur. Rarer arterial thromboses and aneurysms primarily affect the pulmonary and aorta vessels. Neurological manifestations (neuro-BD) are frequent (>20%), and may include headache, fever, pyramidal signs with hemiparesis, cranial nerve damage, meningitis, behavioral changes and sphincter dysfunction. Aphthoid and/or ulcerative lesions may affect the whole digestive tract but mainly the ileo-caecum and ascending colon, potentially leading to hemorrhages and perforations.

Familial Mediterranean fever
SUMMARY

Familial Mediterranean fever (FMF) is an autoinflammatory disorder characterized by recurrent short episodes of fever and serositis resulting in pain in the abdomen, chest, joints and muscles.

CLINICAL DESCRIPTION

Disease onset usually occurs before the age of 30 with an earlier onset corresponding to a more severe phenotype. FMF can be divided into 2 types: FMF type 1 and 2. Type 1 is characterized by attacks (as often as once a week or every few years) of fever and serositis lasting 1-4 days and resolving spontaneously. Stress, exposure to cold, fat-rich meals, infections, certain drugs and menstrual cycles are possible attack triggers. Mild symptoms (myalgia, headache, nausea, dyspnea, arthralgia, low back pain, asthenia and anxiety) precede attacks and last about 17 hours. Attacks manifest as fever (38°C-40°C lasting 12-72 hours and not responding to antibiotics), diffuse or localized abdominal pain (often mimicking acute abdomen), constipation (diarrhea in children), arthralgias (in large joints), arthritis (in upper/lower limb/knee joints) and chest pain caused by pleuritis and/or pericarditis (see this term). In 7-40% of patients cutaneous involvement is also present. Amyloidosis type AA (see this term) can be a serious long term complication. FMF type 2 describes a phenotype where amyloidosis occurs as the first and only manifestation of the disease.

Intermittent hydrarthrosis
SUMMARY

A rare rheumatologic disease characterized by recurrent self-remitting episodes of acute monoarticular arthritis, often with a fixed periodicity, typically affecting the knee or another large joint, which develops an effusion over 12 to 24 hours with only mild to moderate pain and minimal signs of inflammation. Attacks last three to five days and may parallel menses in females. Systemic symptoms are absent, and no joint damage occurs.

CLINICAL DESCRIPTION

Sweet syndrome
SUMMARY

A rare inflammatory disease characterized by abrupt appearance of painful, edematous and erythematous papules, plaques and nodules on the skin, and frequently accompanied by fever and neutrophilia with a dense infiltration of mature neutrophils that are typically located in the upper dermis. The disease is classically associated with inflammatory disease, pregnancy, infection (mostly of the upper respiratory tract), or vaccination but may be idiopathic, associated with a hematological or visceral malignancy, or drug-induced.

CLINICAL DESCRIPTION

Classical Sweet syndrome (CSS) usually presents in women between the age of 30 and 50 years, it is often preceded by an upper respiratory tract infection and may be associated with inflammatory bowel disease. It is characterized by the abrupt onset of painful erythematous plaques or nodules, but pustules and bullae are also described. Fever is observed in 30 to 80% of cases. Approximately one-third of patients with CSS experience recurrence of the dermatosis. Malignancy-associated Sweet syndrome (MASS) can occur as a paraneoplastic syndrome in patients with an established cancer or individuals whose Sweet syndrome-related hematologic dyscrasia or solid tumor was previously undiscovered; MASS is most commonly related to acute myelogenous leukemia. The dermatosis can precede, follow, or appear concurrently with the diagnosis of the patient's cancer. Hence, MASS can be the cutaneous harbinger of either an undiagnosed visceral malignancy in a previously cancer-free individual or an unsuspected cancer recurrence in an oncology patient. Drug-induced Sweet syndrome (DISS) most commonly occurs in patients who have been treated with granulocyte-colony stimulating factor, however, numerous medications have also be associated with DISS.

VARIANTS

NM_000243.2(MEFV):c.1223G>A ; NM_000243.2(MEFV):c.2084A>G ; NM_000243.2(MEFV):c.2230G>T ; NM_000243.2(MEFV):c.501G>C ; NM_000243.2(MEFV):c.800C>T ; NM_000243.2(MEFV):c.2080A>G ; NM_000243.2(MEFV):c.2177T>C ; NM_000243.2(MEFV):c.2282G>A ; NM_000243.2:c.1141C-T ; NM_000243.2(MEFV):c.1437C>G ; c.163dup ; NM_000243.2(MEFV):c.1958G>A ; NM_000243.2(MEFV):c.2040G>A ; NM_000243.2(MEFV):c.2040G>C ; NM_000243.2(MEFV):c.2076_2078delAAT ; NM_000243.2(MEFV):c.2082G>A ; c.656dup

GENE

MFSD8

DISEASES
CLN7 disease
SUMMARY

Late infantile neuronal ceroid lipofuscinoses (LINCLs) are a genetically heterogeneous group of neuronal ceroid lipofuscinoses (NCLs; see this term) typically characterized by onset during infancy or early childhood with decline of mental and motor capacities, epilepsy, and vision loss through retinal degeneration.

CLINICAL DESCRIPTION

The initial clinical symptoms are motor or/and cognitive decline or epilepsy but the mean age of onset and speed of progression may vary depending on the underlying genetic defect. Patients with classic LINCL generally present with a standstill of mental development or the onset of severe epilepsy around the third year of life. The disorder progresses to complete loss of almost all motor and mental capacities before school age. As visual loss is not a prominent finding in the early stages of the disease course, it is frequently not recognized. Several variant forms have also been described in the literature (vLINCL) in which the mean ages of onset generally vary from 2-7 years and which commonly manifest with severe epilepsy followed by cognitive and motor decline and vision loss.

VARIANTS

NM_152778.2(MFSD8):c.362A>G ; NM_152778.2(MFSD8):c.1235C>T ; NM_152778.2(MFSD8):c.881C>A ; c.1090del ; NM_152778.2(MFSD8):c.1286G>A ; c.1525_1526del ; NM_152778.2(MFSD8):c.894T>G ; NM_152778.2(MFSD8):c.929G>A ; NM_152778.2:c.999-2A-G

GENE

MKKS

DISEASES
Bardet-Biedl syndrome
SUMMARY

Bardet-Biedl syndrome (BBS) is a ciliopathy with multisystem involvement.

CLINICAL DESCRIPTION

This disorder is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course. Pigmentary retinopathy is the only constant clinical sign after childhood. BBS may also be associated with several other manifestations including diabetes, hypertension, congenital cardiopathy and Hirschsprung disease (see this term).

McKusick-Kaufman syndrome
SUMMARY

McKusick-Kaufman syndrome is an autosomal recessive disorder characterized by genitourinary malformations, especially hydrometrocolpos, polydactyly, and, more rarely, heart or gastrointestinal malformations

CLINICAL DESCRIPTION

A rare, genetic multiple congenital anomalies syndrome characterized by genitourinary malformations (hydrometrocolpos in females and in males, glanular hypospadias and prominent scrotal raphe) , postaxial polydactyly that may affect only one or several limbs, and to a lesser extent cardiac defects. Hydrometrocolpos is due to either a congenital obstruction, imperforate hymen or vaginal atressia, and causes a palpable mass and possibly hydronephrosis. Other anomalies occasionally reported include choanal atresia, pituitary dysplasia, esophageal atresia and distal tracheoesophageal fistula, Hirschsprung disease, vertebral anomalies, and hydrops fetalis. The disorder is allelic with Bardet-Biedl, and as some phenotypic overlap has been observed, patients should be reevaluated in later childhood for retinistis pigmentosas and other signs of Bardet-Biedl syndrome.

VARIANTS

NM_018848.3(MKKS):c.830T>C ; NM_018848.3:c.1436C-G ; NM_018848.3:c.353delG ; NC_000020.11:g.10407663_10407664del

GENE

MKS1

DISEASES
Bardet-Biedl syndrome
SUMMARY

Bardet-Biedl syndrome (BBS) is a ciliopathy with multisystem involvement.

CLINICAL DESCRIPTION

This disorder is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course. Pigmentary retinopathy is the only constant clinical sign after childhood. BBS may also be associated with several other manifestations including diabetes, hypertension, congenital cardiopathy and Hirschsprung disease (see this term).

Joubert syndrome
SUMMARY

A rare, autosomal recessive congenital cerebellar ataxia characterized by congenital malformation of the brainstem and agenesis or hypoplasia of the cerebellar vermis leading to an abnormal respiratory pattern, nystagmus, hypotonia, ataxia, and delay in achieving motor milestones.

CLINICAL DESCRIPTION

Disease onset is antenatal, although clinical presentation is typically in the neonatal period with irregular breathing pattern (episodic tachypnea and/or apnea), and nystagmus. During infancy, hypotonia may appear. Cerebellar ataxia (staggering gait and imbalance) may develop later. Delayed acquisition of motor milestones is common. Cognitive abilities are variable, ranging from severe intellectual deficit to normal intelligence. Neuro-ophthalmologic examination may show oculomotor apraxia. In some cases, seizures occur. Careful examination of the face often shows a characteristic appearance: large head, prominent forehead, high rounded eyebrows, epicanthal folds, ptosis (occasionally), an upturned nose with prominent nostrils, an open mouth (which tends to have an oval shape early on, a 'rhomboid' appearance later, and finally can appear triangular with downturned angles), tongue protrusion and rhythmic tongue motions, and occasionally low-set and tilted ears. Other features sometimes present in Joubert syndrome include retinal dystrophy, hepatopathy, nephronophthisis, and polydactyly.

Joubert syndrome with ocular defect
SUMMARY

Joubert syndrome with ocular defect is, along with pure JS, the most frequent subtype of Joubert syndrome and related disorders (JSRD, see these terms) characterized by the neurological features of JS associated with retinal dystrophy.

CLINICAL DESCRIPTION

Age of onset and severity of retinal involvement are variable, ranging from congenital blindness in patients with Leber congenital amaurosis (LCA, see this term) to progressive retinopathy with partial conservation of vision.

Meckel syndrome
SUMMARY

A rare, lethal, genetic, multiple congenital anomaly disorder characterized by the triad of brain malformation (mainly occipital encephalocele), large polycystic kidneys, and polydactyly, as well as associated abnormalities that may include cleft lip/palate, cardiac and genital anomalies, central nervous system (CNS) malformations, liver fibrosis, and bone dysplasia.

CLINICAL DESCRIPTION

Fetuses affected by Meckel syndrome (MKS) survive only a few days to a few weeks at the most, or die in utero. The main CNS features include occipital encephalocele, hydrocephalus, anencephaly, holoprosencephaly, as well as Dandy-Walker. Large polycystic kidneys with cystic dysplasia are a constant feature of Meckel syndrome. Hepatic dysgenesis and liver fibrosis are frequent. Polydactyly may affect all four extremities and is typically postaxial (80%) or very rarely preaxial. Affected individuals have pulmonary hypoplasia secondary to oligohydramnios. Cleft lip and palate, microphthalmia and micrognathia may be observed. Cardiac malformations may include atrial septal defect, aorta coarctation, patent arterial duct, and valvular pulmonary stenosis. Incomplete development of internal and external genitalia, and cryptorchidism in males are common.

VARIANTS

NM_017777.3(MKS1):c.1024+1G>A ; NM_017777.3(MKS1):c.508C>T

GENE

MLC1

DISEASES
Megalencephalic leukoencephalopathy with subcortical cysts
SUMMARY

Megalencephalic leukoencephalopathy with subcortical cysts is a leukodystrophy characterized by early-onset macrocephaly and delayed-onset neurologic deterioration, including cerebellar ataxia, spasticity, epilepsy, and mild cognitive decline.

CLINICAL DESCRIPTION

Megalencephalic leukoencephalopathy with subcortical cysts (MLC) is a form of leukodystrophy that is characterized by infantile-onset macrocephaly, often with mild neurologic signs at presentation (such as mild motor delay), which worsen with time, leading to poor ambulation, falls, ataxia, spasticity, increasing seizures and cognitive decline. Brain magnetic resonance imaging reveals diffusely abnormal and mildly swollen white matter as well as subcortical cysts in the anterior temporal and frontoparietal regions.

VARIANTS

NM_015166.3(MLC1):c.278C>T ; NM_015166.3(MLC1):c.135dupC ; NM_015166.3(MLC1):c.206C>T ; NM_015166.3:c.274C>T ; c.33dup ; NM_015166.3(MLC1):c.422A>G ; NM_015166.3(MLC1):c.423C>A ; NM_015166.3:c.424-2A-C

GENE

MLYCD

DISEASES
Malonic aciduria
SUMMARY

Malonic aciduria is a metabolic disorder caused by deficiency of malonyl-CoA decarboxylase (MCD).

CLINICAL DESCRIPTION

This condition usually presents in early childhood and the manifestations are variable. The majority of patients are developmentally delayed with other features that include hypotonia, seizures, hypoglycaemia, metabolic acidosis, cardiomyopathy and diarrhoea.

VARIANTS

NM_012213.2(MLYCD):c.560C>G ; NM_012213.2(MLYCD):c.679_680insTGAAGC ; c.758del

GENE

MMAA

DISEASES
Vitamin B12-responsive methylmalonic acidemia type cblA
SUMMARY

Methylmalonic aciduria is a genetically heterogeneous disorder of methylmalonate and cobalamin (cbl; vitamin B12) metabolism. Different forms of isolated methylmalonic aciduria have been classified according to complementation groups of cells in vitro. Patients with defects in the synthesis of AdoCbl are usually responsive to vitamin B12 therapy and are classified as 'cbl' type: these include cblA and cblB, which is caused by mutation in the MMAB gene on 12q24. See also cblH, which may be a subset of cblA. The 'mut' form of MMA is caused by mutation in the MUT gene on chromosome 6p. In general, the mut form of MMA is unresponsive to vitamin B12 therapy.

CLINICAL DESCRIPTION

VARIANTS

NM_172250.2(MMAA):c.1034delT ; NM_172250.3(MMAA):c.283C>T ; NM_172250.2(MMAA):c.387C>A ; NM_172250.3(MMAA):c.450dup ; NM_172250.2(MMAA):c.455delC ; NM_172250.2(MMAA):c.503delC ; NM_172250.2(MMAA):c.586C>T ; NM_172250.2(MMAA):c.620A>G ; c.811G>T

GENE

MMAB

DISEASES
Vitamin B12-responsive methylmalonic acidemia type cblB
SUMMARY

Methylmalonic aciduria is a genetically heterogeneous disorder of methylmalonate and cobalamin (cbl; vitamin B12) metabolism. Different forms of isolated methylmalonic aciduria have been classified according to complementation groups of cells in vitro. Patients with defects in the synthesis of AdoCbl are usually responsive to vitamin B12 therapy and are classified as 'cbl' type: these include cblB and cblA (251100). The cblA type is caused by mutation in the MMAA gene (607481). The 'mut' type (251000) is caused by mutation in the MUT gene; in general, the mut form of MMA is unresponsive to vitamin B12 therapy.

CLINICAL DESCRIPTION

VARIANTS

NM_052845.3(MMAB):c.569G>A ; NM_052845.3:c.197-1G-A ; NM_052845.3(MMAB):c.197-1G>T ; c.220G>T ; NM_052845.3(MMAB):c.556C>T ; NM_052845.3(MMAB):c.568C>T ; NM_052845.3(MMAB):c.700C>T

GENE

MMACHC

DISEASES
Methylmalonic acidemia with homocystinuria, type cblC
SUMMARY

cblC type methylmalonic acidemia with homocystinuria is a form of methylmalonic acidemia with homocystinuria (see this term), an inborn error of vitamin B12 (cobalamin) metabolism characterized by megaloblastic anemia, lethargy, failure to thrive, developmental delay, intellectual deficit and seizures.

CLINICAL DESCRIPTION

The disease typically presents with failure to thrive, acute neurological deterioration, intellectual deficit, lethargy, seizures, microcephaly, a salt-and-pepper retinopathy, and signs of megaloblastic anemia (pallor, fatigue, anorexia). Severe brain abnormalities including hydrocephalus, white matter abnormalities, cerebral atrophy, and unusual basal ganglia lesions are common. Onset of the disorder can be early (infantile) or late (juvenile or adult), with the late-onset form characterized by ataxia, dementia and psychosis.

Methylcobalamin deficiency type cblDv1
SUMMARY

Homocystinuria without methylmalonic aciduria is an inborn error of vitamin B12 (cobalamin) metabolism characterized by megaloblastic anemia, encephalopathy and, sometimes, developmental delay, and associated with homocystinuria and hyperhomocysteinemia. There are three types of homocystinuria without methylmalonic aciduria; cblE, cblG and cblD-variant 1 (cblDv1).

CLINICAL DESCRIPTION

Homocystinuria without methylmalonic aciduria manifests mainly in early childhood with failure to thrive, megaloblastic anemia, developmental delay, hypotonia, seizures and cerebral atrophy with white matter abnormalities. Some patients may have an acute expression in the first few months of life, with vomiting, poor feeding and lethargy. Patients develop homocystinuria, hyperhomocysteinemia and, sometimes, hypomethioninemia. A mild clinical phenotype and late-onset disease in the absence of neurological involvement have also been described for the cblE disorder. Presentation in adulthood with ataxia, dementia or psychosis has been observed in cblG.

Methylmalonic acidemia with homocystinuria, type cblD
SUMMARY

cblD type methylmalonic acidemia with homocystinuria is a form of methylmalonic acidemia with homocystinuria (see this term), an inborn error of vitamin B12 (cobalamin) metabolism characterized by variable biochemical, neurological and hematological manifestations.

CLINICAL DESCRIPTION

Three different presentations have been described: the classic form with combined methylmalonic aciduria and homocystinuria; cblD variant 1 (cblDv1) with isolated homocystinuria; and cblD variant 2 (cblDv2) with isolated methylmalonic aciduria. Clinical presentation is extremely variable. The disorder can present from early infancy to late childhood. Presenting signs are variable depending on which aspect(s) of cobalamin metabolism are affected and can include developmental delay, severe learning difficulties, seizures, movement and gait abnormalities, behavioral problems and signs of megaloblastic anemia (pallor, fatigue, anorexia).

Vitamin B12-responsive methylmalonic acidemia, type cblDv2
SUMMARY

An inborn error of vitamin B12 (cobalamin) metabolism characterized by recurrent ketoacidotic comas or transient vomiting, dehydration, hypotonia and intellectual deficit, which responds to vitamin B12. There are three types: cblA, cblB and cblD-variant 2 (cblDv2).

CLINICAL DESCRIPTION

Patients usually present in infancy or early childhood with features including lethargy, failure to thrive, recurrent vomiting, dehydration, respiratory distress, muscle hypotonia, hepatomegaly and coma. They may also show signs of anemia (not megaloblastic), have potentially life-threatening ketoacidosis and/or hyperammonemia, and developmental delay and intellectual deficit, with metabolic stroke affecting the brain stem. MA frequently leads to end-stage renal failure by adolescence or adulthood. Patients with cblB are usually more severely affected than patients with cblA.

VARIANTS

NM_015506.2(MMACHC):c.271dupA ; NM_015506.2(MMACHC):c.389A>G ; NM_015506.2(MMACHC):c.616C>T ; NM_015506.2(MMACHC):c.347T>C ; NM_015506.2(MMACHC):c.388_390delTAC ; NM_015506.2(MMACHC):c.440G>C ; NM_015506.2(MMACHC):c.619dup ; NM_015506.2(MMACHC):c.688C>T ; NM_015506.2(MMACHC):c.331C>T ; NM_015506.2(MMACHC):c.394C>T ; NM_015506.2(MMACHC):c.481C>T ; NM_015506.2(MMACHC):c.482G>A ; NM_015506.2(MMACHC):c.547_548delGT ; NM_015506.2(MMACHC):c.608G>A ; NM_015506.2(MMACHC):c.609G>A ; NM_015506.2(MMACHC):c.615C>A ; NM_015506.2(MMACHC):c.615C>G ; NM_015506.2(MMACHC):c.658_660delAAG

GENE

MMUT

DISEASES
Vitamin B12-unresponsive methylmalonic acidemia type mut-
SUMMARY

Vitamin B12-unresponsive methylmalonic acidemia type mut- is an inborn error of metabolism characterized by recurrent ketoacidotic comas or transient vomiting, dehydration, hypotonia and intellectual deficit, which does not respond to administration of vitamin B12.

CLINICAL DESCRIPTION

The disease typically presents very early in life (<1 to 4 weeks), although later onset cases have been observed, with features including lethargy, failure to thrive, recurrent vomiting, dehydration, respiratory distress, muscle hypotonia, developmental delay, intellectual deficit, hepatomegaly and coma. Patients may show signs of anemia. They may also have potentially life-threatening ketoacidosis and/or hyperammonemia, renal and neurological complications, metabolic stroke and cardiomyopathy. mut- is generally less severe than vitamin B12-unresponsive methylmalonic acidemia type mut0 (see this term) and may in some cases respond to vitamin B12 therapy. Long term complications include metabolic stroke and development of end stage renal failure. These complications are more frequent in mut0 than in mut-.

VARIANTS

NM_000255.3:c.1924G-C ; NM_000255.3:c.312delC ; NM_000255.3:c.914T-C ; NM_000255.3(MMUT):c.1106G>A ; c.1181T>A ; NM_000255.3:c.1207C-T ; NM_000255.3(MMUT):c.1280G>A ; NM_000255.3(MMUT):c.1399C>T ; NM_000255.3:c.1420C-T ; NM_000255.3:c.1445-2A-G ; NM_000255.3:c.1658delT ; NM_000255.3(MMUT):c.1741C>T ; NM_000255.3:c.1867G-A ; NM_000255.3(MMUT):c.2080C>T ; NM_000255.3(MMUT):c.2150G>T ; NM_000255.3:c.278G-A ; NM_000255.3:c.280G-A ; NM_000255.3(MMUT):c.572C>A ; NM_000255.3(MMUT):c.607G>A ; NM_000255.3:c.643G-A ; NM_000255.3:c.655A-T ; NM_000255.3(MMUT):c.671_678dup ; NM_000255.3:c.682C-T ; NM_000255.3(MMUT):c.91C>T

GENE

MOCS1

DISEASES
Sulfite oxidase deficiency due to molybdenum cofactor deficiency type A
SUMMARY

Encephalopathy due to sulfite oxidase deficiency is a rare neurometabolic disorder characterized by seizures, progressive encephalopathy and lens dislocation.

CLINICAL DESCRIPTION

Symptoms usually occur within the first week after birth with feeding difficulties, vomiting and seizures which are difficult to control. The majority of patients exhibit facial dysmorphism (prominent forehead, narrow bifrontal diameter, sunken eyes, elongated palpebral fissures, puffy cheeks, small nose and long philtrum and thick lips). The course is progressive, with spasticity, severe intellectual deficit, and microcephaly seen in survivors. Lens dislocation usually occurs late in infancy but has been observed as early as two months of age. A late onset form with a milder phenotype has also been described.

VARIANTS

NM_005943.5:c.1027C-T ; NM_001075098.3(MOCS1):c.217C>T ; NM_005943.5:c.397_406delCCGGACGTGG ; NM_001075098.3(MOCS1):c.956G>A

GENE

MPI

DISEASES
MPI-CDG
SUMMARY

CDG Ib is clinically distinct from most other CDGs by the lack of significant central nervous system involvement. The predominant symptoms are chronic diarrhea with failure to thrive and protein-losing enteropathy with coagulopathy. Some patients develop hepatic fibrosis. CDG Ib is also different from other CDGs in that it can be treated effectively with oral mannose supplementation, but can be fatal if untreated. Thus, CDG Ib should be considered in the differential diagnosis of patients with unexplained hypoglycemia, chronic diarrhea, liver disease, or coagulopathy in order to allow early diagnosis and effective therapy.

CLINICAL DESCRIPTION

MPI-CDG is a form of congenital disorders of N-linked glycosylation, characterized by cyclic vomiting, profound hypoglycemia, failure to thrive, liver fibrosis, gastrointestinal complications (protein-losing enteropathy with hypoalbuminaemia, life-threatening intestinal bleeding of diffuse origin), and thrombotic events (protein C and S deficiency, low anti-thrombine III levels), whereas neurological development and cognitive capacity is usually normal. The clinical course is variable even within families. The disease is caused by loss of function of the gene MPI (15q24.1).

VARIANTS

NM_002435.1(MPI):c.656G>A ; NM_002435.2(MPI):c.305C>T ; NM_002435.2(MPI):c.413T>C ; c.833_836del ; NM_002435.2(MPI):c.884G>A

GENE

MPV17

DISEASES
Navajo neurohepatopathy
SUMMARY

Mitochondrial DNA depletion syndrome-6 is an autosomal recessive disorder characterized by infantile onset of progressive liver failure, often leading to death in the first year of life. Those that survive develop progressive neurologic involvement, including ataxia, hypotonia, dystonia, and psychomotor regression.

CLINICAL DESCRIPTION

A rare, life-threatening, mitochondrial DNA depletion syndrome disease characterized by severe, progressive sensorimotor neuropathy associated with corneal ulceration, scarring or anesthesia, acral mutilation, metabolic and immunologic derangement, and hepatopathy (which can manifest with fulminant hepatic failure, a Reye-like syndrome or indolent progression to liver cirrhosis, depending on clinical form involved), present in the Navajo Native American population. Clinical presentation includes failure to thrive, distal limb weakness with reduced sensation, limb contractures with loss of funtion, areflexia, recurrent metabolic acidosis with intercurrent illness, immunologic anomalies manifesting with severe systemic infections, and sexual infantilism.

VARIANTS

NM_002437.4(MPV17):c.263_265delAGA ; NM_002437.4(MPV17):c.148C>T ; NM_002437.4(MPV17):c.149G>A ; NM_002437.4(MPV17):c.284dupG ; NM_002437.4(MPV17):c.359G>A ; c.462-2A>C ; NM_002437.4(MPV17):c.498C>A ; NM_002437.4(MPV17):c.70G>T

GENE

MTHFR

DISEASES
Cervical spina bifida aperta
SUMMARY

CLINICAL DESCRIPTION

Cervical spina bifida cystica
SUMMARY

CLINICAL DESCRIPTION

Cervicothoracic spina bifida aperta
SUMMARY

CLINICAL DESCRIPTION

Cervicothoracic spina bifida cystica
SUMMARY

CLINICAL DESCRIPTION

Homocystinuria due to methylene tetrahydrofolate reductase deficiency
SUMMARY

Homocystinuria due to methylene tetrahydrofolate reductase (MTHFR) deficiency is a metabolic disorder characterised by neurological manifestations.

CLINICAL DESCRIPTION

Onset usually occurs during the first year of life with severe neurological signs, recurrent apnoea, microcephaly and convulsions. There is no megaloblastic anaemia. There are some forms with onset during childhood, adolescence, or adulthood beginning with mental regression, ataxia, and, most often, common psychiatric disorders of the schizophrenic type that may be linked to cerebrovascular accidents. Other symptoms such as subacute degeneration of the spinal chord have been reported.

Isolated anencephaly
SUMMARY

A neural tube defect. This malformation is characterized by the total or partial absence of the cranial vault and the covering skin, the brain being missing or reduced to a small mass. Most cases are stillborn, although some infants have been reported to survive for a few hours or even a few days.

CLINICAL DESCRIPTION

Neural tube defects have a birth incidence of approximately 1 in 1,000 in American Caucasians and are the second most common type of birth defect after congenital heart defects. The most common NTDs are open spina bifida (myelomeningocele) and anencephaly. Women with elevated plasma homocysteine, low folate, or low vitamin B12 (cobalamin) are at increased risk of having a child with a neural tube defect.

Isolated exencephaly
SUMMARY

A neural tube defect. This malformation is characterized by the total or partial absence of the cranial vault and the covering skin, the brain being missing or reduced to a small mass. Most cases are stillborn, although some infants have been reported to survive for a few hours or even a few days.

CLINICAL DESCRIPTION

Neural tube defects have a birth incidence of approximately 1 in 1,000 in American Caucasians and are the second most common type of birth defect after congenital heart defects. The most common NTDs are open spina bifida (myelomeningocele) and anencephaly. Women with elevated plasma homocysteine, low folate, or low vitamin B12 (cobalamin) are at increased risk of having a child with a neural tube defect.

Lumbosacral spina bifida aperta
SUMMARY

CLINICAL DESCRIPTION

Lumbosacral spina bifida cystica
SUMMARY

CLINICAL DESCRIPTION

NON RARE IN EUROPE: Non rare thrombophilia
SUMMARY

Thrombophilia is a multifactorial disorder of inappropriate clot formation resulting from an interaction of genetic, acquired, and circumstantial predisposing factors. Venous thromboembolism most commonly manifests as deep vein thrombosis, which may progress to pulmonary embolism if the clot dislodges and travels to the lung. Other manifestations include thromboses of the cerebral or visceral veins and recurrent pregnancy loss .

CLINICAL DESCRIPTION

Thoracolumbosacral spina bifida aperta
SUMMARY

CLINICAL DESCRIPTION

Thoracolumbosacral spina bifida cystica
SUMMARY

CLINICAL DESCRIPTION

Total spina bifida aperta
SUMMARY

CLINICAL DESCRIPTION

Total spina bifida cystica
SUMMARY

CLINICAL DESCRIPTION

Upper thoracic spina bifida aperta
SUMMARY

CLINICAL DESCRIPTION

Upper thoracic spina bifida cystica
SUMMARY

CLINICAL DESCRIPTION

VARIANTS

NM_005957.4(MTHFR):c.1129C>T ; NM_005957.4(MTHFR):c.1743G>A ; NM_005957.4:c.1768delC ; c.3G>A ; NM_005957.4:c.439C-T ; NM_005957.4(MTHFR):c.547C>T ; NM_005957.4(MTHFR):c.968T>C ; NM_005957.4(MTHFR):c.971A>G

GENE

MTM1

DISEASES
X-linked centronuclear myopathy
SUMMARY

A rare X-linked congenital myopathy characterized by numerous centrally placed nuclei on muscle biopsy and that presents at birth with marked weakness, hypotonia and respiratory failure.

CLINICAL DESCRIPTION

The disease is characterized by a severe phenotype in males presenting at birth with marked weakness, hypotonia and respiratory failure. Signs of antenatal onset are frequent and comprise reduced fetal movements and polyhydramnios. Thinning of the ribs is observed on chest radiographs of the newborn. Birth asphyxia may be the presenting feature. A family history of either male neonatal deaths or miscarriages is common. Affected infants are often macrosomic, with a body length above the 90th centile and large head circumference. External ophthalmoplegia is commonly associated. Testes are frequently undescended. Pyloric stenosis and cavernous hemangiomas of the liver have been reported in some long-term survivors.

X-linked myotubular myopathy-abnormal genitalia syndrome
SUMMARY

X-linked myotubular myopathy-abnormal genitalia syndrome is a rare chromosomal anomaly, partial deletion of the long arm of chromosome X, characterized by a combination of clinical manifestations of X-linked myotubular myopathy and a 46,XY disorder of sex development. Patients present with severe form of congenital myopathy and abnormal male genitalia.

CLINICAL DESCRIPTION

Facial diplegia and often external ophthalmoplegia are frequent. The newborn cases resemble those of congenital myotonic dystrophy; the distinction can be made by examination of their mother who in the latter situation will invariably show mild facial weakness and clinical or electrical myotonia. Polyhydramnios is a feature of both forms of congenital myopathy, i.e., myotonic dystrophy and X-linked myotubular myopathy.

VARIANTS

NM_000252.2(MTM1):c.1260+5G>A ; NM_000252.2(MTM1):c.1291G>A ; NM_000252.2(MTM1):c.1367T>C ; NM_000252.2(MTM1):c.1406A>G ; NM_000252.2(MTM1):c.688T>C ; NM_000252.2(MTM1):c.1036T>C ; NM_000252.2(MTM1):c.1180G>C ; NM_000252.2(MTM1):c.1204G>A ; NM_000252.2(MTM1):c.1233G>T ; NM_000252.2(MTM1):c.1234A>G ; NM_000252.2(MTM1):c.1307C>T ; NM_000252.2(MTM1):c.1325T>A ; NM_000252.2(MTM1):c.1328A>C ; NM_000252.2(MTM1):c.137-3T>G ; NM_000252.2(MTM1):c.1388T>C ; NM_000252.2(MTM1):c.1388T>G ; NM_000252.2(MTM1):c.1490C>A ; NM_000252.2(MTM1):c.342+4A>G ; NM_000252.2(MTM1):c.575A>G ; NM_000252.2(MTM1):c.63+3A>T ; NM_000252.2(MTM1):c.676C>A ; NM_000252.2(MTM1):c.679-1G>A ; NM_000252.2(MTM1):c.743G>T ; NM_000252.2(MTM1):c.924_926del ; NM_000252.2(MTM1):c.1014_1015insT ; NM_000252.2(MTM1):c.1040T>G ; NM_000252.2(MTM1):c.1053+1G>A ; NM_000252.2(MTM1):c.1053+1G>C ; NM_000252.2(MTM1):c.1088_1089del ; NM_000252.2(MTM1):c.1089dupA ; NM_000252.2(MTM1):c.109C>T ; NM_000252.2(MTM1):c.1120C>G ; NM_000252.2(MTM1):c.1132G>A ; NM_000252.2(MTM1):c.1136G>A ; NM_000252.2(MTM1):c.1137G>A ; NM_000252.2(MTM1):c.1139A>T ; NM_000252.2(MTM1):c.1160C>A ; NM_000252.2(MTM1):c.1178dup ; NM_000252.2(MTM1):c.1190A>G ; NM_000252.2(MTM1):c.1191T>G ; NM_000252.2(MTM1):c.1205G>C ; NM_000252.2(MTM1):c.1210G>A ; NM_000252.2(MTM1):c.1227_1228delAGinsT ; NM_000252.2(MTM1):c.1232G>A ; NM_000252.2(MTM1):c.1244G>A ; NM_000252.2(MTM1):c.1260+1G>A ; NM_000252.2(MTM1):c.1261-10A>G ; NM_000252.2(MTM1):c.1261-1G>C ; NM_000252.2(MTM1):c.1261C>T ; NM_000252.2(MTM1):c.1262G>A ; NM_000252.2(MTM1):c.1262G>T ; NM_000252.2(MTM1):c.1283_1286del ; NM_000252.2(MTM1):c.1283del ; NM_000252.2(MTM1):c.1304_1306del ; NM_000252.2(MTM1):c.1306_1310dupCCTAT ; NM_000252.2(MTM1):c.1307del ; NM_000252.2(MTM1):c.130dup ; NM_000252.2(MTM1):c.1337G>A ; c.1338G>A ; NM_000252.2(MTM1):c.1349_1353+4del ; NM_000252.2(MTM1):c.1353+1G>A ; NM_000252.2(MTM1):c.1353+2T>C ; NM_000252.2(MTM1):c.1354-1G>A ; NM_000252.2(MTM1):c.1357_1358delCC ; NM_000252.2(MTM1):c.137-11T>A ; NM_000252.2(MTM1):c.1376A>T ; NM_000252.2(MTM1):c.1378G>T ; NM_000252.2(MTM1):c.1381C>T ; NM_000252.2(MTM1):c.139_141del ; NM_000252.2(MTM1):c.1415_1416delGT ; NM_000252.2(MTM1):c.141_144delAGAA ; NM_000252.2(MTM1):c.1420C>T ; NM_000252.2(MTM1):c.1427G>T ; NM_000252.2:c.142G-T ; NM_000252.2(MTM1):c.142_143delGA ; NM_000252.2(MTM1):c.1433T>C ; NM_000252.2(MTM1):c.1456C>T ; NM_000252.2(MTM1):c.145G>A ; NM_000252.2(MTM1):c.145G>T ; NM_000252.2(MTM1):c.1464_1467del ; NM_000252.2(MTM1):c.1467+1G>A ; NM_000252.2(MTM1):c.1467+1G>T ; NM_000252.2(MTM1):c.1467+2T>A ; NM_000252.2(MTM1):c.1495T>C ; NM_000252.2(MTM1):c.1509del ; NM_000252.2(MTM1):c.153_156del ; NM_000252.2(MTM1):c.154del ; NM_000252.2(MTM1):c.1558C>T ; NM_000252.2(MTM1):c.1611C>A ; NM_000252.2(MTM1):c.1644+1G>T ; NM_000252.2(MTM1):c.1644+3_1644+6del ; NM_000252.2(MTM1):c.1792del ; NM_000252.2(MTM1):c.19delT ; NM_000252.2(MTM1):c.205C>G ; NM_000252.2(MTM1):c.205C>T ; NM_000252.2:c.208C-T ; NM_000252.2(MTM1):c.208C>T ; NM_000252.2(MTM1):c.226G>T ; NM_000252.2(MTM1):c.231+1G>A ; NM_000252.2(MTM1):c.231+2T>G ; NM_000252.2(MTM1):c.232-1G>A ; NM_000252.2(MTM1):c.232-2A>C ; NM_000252.2(MTM1):c.232-3C>A ; NM_000252.2(MTM1):c.252del ; NM_000252.2(MTM1):c.260T>C ; NM_000252.2:c.297_298insCG ; NM_000252.2(MTM1):c.2T>G ; NM_000252.2(MTM1):c.301A>G ; NM_000252.2(MTM1):c.340A>T ; NM_000252.2(MTM1):c.342+1G>A ; NM_000252.2(MTM1):c.342_342+4delAGTAA ; NM_000252.2(MTM1):c.343-2A>G ; NM_000252.2(MTM1):c.397_398del ; NM_000252.2(MTM1):c.3G>A ; NM_000252.2(MTM1):c.402del ; NM_000252.2(MTM1):c.419_420insA ; NM_000252.2(MTM1):c.420C>G ; NM_000252.2(MTM1):c.431delT ; NM_000252.2(MTM1):c.444+1G>A ; c.461T>G ; NM_000252.2(MTM1):c.465del ; NM_000252.2(MTM1):c.469G>A ; NM_000252.2(MTM1):c.469del ; NM_000252.2(MTM1):c.49G>T ; NM_000252.2(MTM1):c.514G>T ; NM_000252.2(MTM1):c.528+1G>T ; NM_000252.2(MTM1):c.529-2A>G ; NM_000252.2(MTM1):c.535C>T ; NM_000252.2(MTM1):c.539_545del ; NM_000252.2(MTM1):c.549G>A ; NM_000252.2(MTM1):c.549_550insG ; NM_000252.2(MTM1):c.550A>G ; NM_000252.2(MTM1):c.557C>T ; NM_000252.2(MTM1):c.564_566delTAA ; NM_000252.2(MTM1):c.566A>G ; NM_000252.2(MTM1):c.591_594del ; NM_000252.2(MTM1):c.593dupA ; NM_000252.2:c.594C-A ; NM_000252.2(MTM1):c.595_599delCCTGC ; NM_000252.2(MTM1):c.605del ; NM_000252.2(MTM1):c.611T>G ; NM_000252.2(MTM1):c.614C>T ; NM_000252.2(MTM1):c.629A>G ; NM_000252.2(MTM1):c.63+1G>A ; NM_000252.2(MTM1):c.637C>T ; NM_000252.2(MTM1):c.64-1G>A ; NM_000252.2:c.649_650insG ; NM_000252.2(MTM1):c.664C>T ; NM_000252.2(MTM1):c.670C>T ; NM_000252.2(MTM1):c.678+1G>A ; NM_000252.2(MTM1):c.679G>A ; NM_000252.2(MTM1):c.683T>C ; NM_000252.2:c.709_710delAC ; NM_000252.2(MTM1):c.70C>T ; NM_000252.2(MTM1):c.721C>T ; NM_000252.2(MTM1):c.757C>T ; NM_000252.2(MTM1):c.779A>C ; c.780T>A ; NM_000252.2(MTM1):c.791T>G ; NM_000252.2(MTM1):c.805_808del ; NM_000252.2(MTM1):c.85C>T ; NM_000252.2(MTM1):c.867+1G>A ; NM_000252.2(MTM1):c.867+1_867+2insGG ; NM_000252.2(MTM1):c.888_889del ; NM_000252.2(MTM1):c.912del ; NM_000252.2(MTM1):c.949dup ; NM_000252.2(MTM1):c.958T>C ; NM_000252.2(MTM1):c.961_962del ; NM_000252.2(MTM1):c.969del ; NM_000252.2(MTM1):c.969dup ; NM_000252.2(MTM1):c.96dup ; NC_000023.11:g.150596496A>G

GENE

MTTP

DISEASES
Abetalipoproteinemia
SUMMARY

A severe, familial hypobetalipoproteinemia characterized by permanently low levels (below the 5th percentile) of apolipoprotein B and LDL cholesterol, and by growth delay, malabsorption, hepatomegaly, and neurological and neuromuscular manifestations.

CLINICAL DESCRIPTION

Abetalipoproteinemia manifests during the first year of life or in young childhood. It is often associated with growth delay, hepatomegaly with steatosis, diarrhea with steatorrhea, and fat malabsorption. Spastic ataxia, atypical retinitis pigmentosa, acanthocytosis, a low level of liposoluble vitamins, and major cytolysis and even cirrhosis can occur.

NON RARE IN EUROPE: Familial hypobetalipoproteinemia
SUMMARY

Features are celiac syndrome, pigmentary degeneration of the retina, progressive ataxic neuropathy, and a peculiar 'burr-cell' malformation of the red cells called acanthocytosis. Intestinal absorption of lipids is defective, serum cholesterol very low, and serum beta lipoprotein absent.

CLINICAL DESCRIPTION

Abetalipoproteinemia and familial hypobetalipoproteinemia are rare diseases characterized by hypocholesterolemia and malabsorption of lipid-soluble vitamins leading to retinal degeneration, neuropathy, and coagulopathy. Hepatic steatosis is also common. The root cause of both disorders is improper packaging and secretion of apolipoprotein B-containing particles. Obligate heterozygous parents of ABL patients usually have normal lipids consistent with autosomal recessive inheritance, whereas obligate heterozygous parents of FBHL patients typically have half normal levels of apoB-containing lipoproteins consistent with autosomal codominant inheritance.

VARIANTS

NM_000253.3(MTTP):c.1619G>A ; NM_000253.3(MTTP):c.1769G>T ; NM_000253.2:c.2030delC ; NM_000253.3:c.2593G>T ; NM_000253.3(MTTP):c.708_709del ; NC_000004.12:g.99611241G>A

GENE

MYO15A

DISEASES
Autosomal recessive non-syndromic sensorineural deafness type DFNB
SUMMARY

Deafness is the most frequent form of sensorial deficit. In the vast majority of cases, the deafness is termed nonsyndromic or isolated and the hearing loss is the only clinical anomaly reported. In developed counties, 60-80% of cases of early-onset hearing loss are of genetic origin.

CLINICAL DESCRIPTION

The majority of cases presenting at birth concern perceptive deafness (with a neurosensory origin associated with the inner ear) rather than conductive deafness (anomalies in the amplification of sound waves between the middle ear - tympanum and auditory ossicles - and the outer ear). Autosomal dominant forms are characterised by very early onset and bilateral hearing loss with varying degrees of severity (ranging from mild to profound). No malformations of the inner ear can be detected by CT scan. Mutations in the PDS gene are responsible for 7% of cases of childhood deafness. In these cases, the deafness is marked by early-onset, usually bilateral (but sometimes asymmetric) hearing loss with autosomal recessive transmission. This form of deafness is always associated with malformations of the inner ear that can be detected by CT scan. In rare cases, thyroid gland disease may also be present. For the autosomal dominant forms of deafness, mutations in the COCH gene result in progressive postlingual deafness associated with severe attacks of vertigo and subjective tinnitus. This form of deafness should be distinguished from Meniere's disease (see this term). Autosomal dominant mutations in the WFS1 gene cause either a form of hearing loss affecting mainly low frequency sounds or deafness associated with optic atrophy.

VARIANTS

NM_016239.4(MYO15A):c.10573del ; NM_016239.3(MYO15A):c.3313G>T ; NM_016239.4(MYO15A):c.3336del ; NM_016239.3(MYO15A):c.3385C>T ; c.3693-2A>G ; NM_016239.4(MYO15A):c.3756+1G>T ; c.4751_4752dup ; c.5326C>T ; NM_016239.3(MYO15A):c.5492G>T ; NM_016239.3:c.6004delG ; NM_016239.3:c.6046.2T-G ; NM_016239.3(MYO15A):c.625G>T ; c.6864_6874del ; NM_016239.3:c.755dupA ; NM_016239.3(MYO15A):c.8148G>T ; NM_016239.3:c.8410A-T ; NM_016239.3:c.8429_8447delGCGGGCAGCTGCGGGTCCT ; c.8548C>T ; NM_016239.4(MYO15A):c.9958_9961del

GENE

MYO7A

DISEASES
Autosomal dominant non-syndromic sensorineural deafness type DFNA
SUMMARY

Deafness is the most frequent form of sensorial deficit. In the vast majority of cases, the deafness is termed nonsyndromic or isolated and the hearing loss is the only clinical anomaly reported. In developed counties, 60-80% of cases of early-onset hearing loss are of genetic origin.

CLINICAL DESCRIPTION

The majority of cases presenting at birth concern perceptive deafness (with a neurosensory origin associated with the inner ear) rather than conductive deafness (anomalies in the amplification of sound waves between the middle ear - tympanum and auditory ossicles - and the outer ear). Autosomal dominant forms are characterised by very early onset and bilateral hearing loss with varying degrees of severity (ranging from mild to profound). No malformations of the inner ear can be detected by CT scan. Mutations in the PDS gene are responsible for 7% of cases of childhood deafness. In these cases, the deafness is marked by early-onset, usually bilateral (but sometimes asymmetric) hearing loss with autosomal recessive transmission. This form of deafness is always associated with malformations of the inner ear that can be detected by CT scan. In rare cases, thyroid gland disease may also be present. For the autosomal dominant forms of deafness, mutations in the COCH gene result in progressive postlingual deafness associated with severe attacks of vertigo and subjective tinnitus. This form of deafness should be distinguished from Meniere's disease (see this term). Autosomal dominant mutations in the WFS1 gene cause either a form of hearing loss affecting mainly low frequency sounds or deafness associated with optic atrophy.

Autosomal recessive non-syndromic sensorineural deafness type DFNB
SUMMARY

Deafness is the most frequent form of sensorial deficit. In the vast majority of cases, the deafness is termed nonsyndromic or isolated and the hearing loss is the only clinical anomaly reported. In developed counties, 60-80% of cases of early-onset hearing loss are of genetic origin.

CLINICAL DESCRIPTION

The majority of cases presenting at birth concern perceptive deafness (with a neurosensory origin associated with the inner ear) rather than conductive deafness (anomalies in the amplification of sound waves between the middle ear - tympanum and auditory ossicles - and the outer ear). Autosomal dominant forms are characterised by very early onset and bilateral hearing loss with varying degrees of severity (ranging from mild to profound). No malformations of the inner ear can be detected by CT scan. Mutations in the PDS gene are responsible for 7% of cases of childhood deafness. In these cases, the deafness is marked by early-onset, usually bilateral (but sometimes asymmetric) hearing loss with autosomal recessive transmission. This form of deafness is always associated with malformations of the inner ear that can be detected by CT scan. In rare cases, thyroid gland disease may also be present. For the autosomal dominant forms of deafness, mutations in the COCH gene result in progressive postlingual deafness associated with severe attacks of vertigo and subjective tinnitus. This form of deafness should be distinguished from Meniere's disease (see this term). Autosomal dominant mutations in the WFS1 gene cause either a form of hearing loss affecting mainly low frequency sounds or deafness associated with optic atrophy.

Usher syndrome type 1
SUMMARY

Usher syndrome type I is an autosomal recessive condition characterized by profound congenital hearing impairment with unintelligible speech, early retinitis pigmentosa (usually evident within the first decade), and constant vestibular dysfunction. Type I is distinguished from type II on the basis of severity of hearing loss and the extent of vestibular involvement. Type I patients are profoundly deaf, whereas type II patients are 'hard of hearing.' Vestibular function is defective in type I patients, whereas type II patients have normal vestibular function. Patients with type III (USH3) have progressive hearing loss.

CLINICAL DESCRIPTION

A rare ciliopathy characterized by profound congenital deafness, retinitis pigmentosa and vestibular dysfunction. Retinitis pigmentosa results in visual loss and generally manifests as night blindness, progressively constricted visual fields, and impaired visual acuity. Vestibular dysfunction a defining feature of this form, manifests as delayed motor development with affected infants taking longer to sit independently and to walk. Later on, vestibular dysfunction results in difficulty with activities requiring balance.

Usher syndrome type 2
SUMMARY

Usher syndrome type I is an autosomal recessive condition characterized by profound congenital hearing impairment with unintelligible speech, early retinitis pigmentosa (usually evident within the first decade), and constant vestibular dysfunction. Type I is distinguished from type II on the basis of severity of hearing loss and the extent of vestibular involvement. Type I patients are profoundly deaf, whereas type II patients are 'hard of hearing.' Vestibular function is defective in type I patients, whereas type II patients have normal vestibular function. Patients with type III (USH3) have progressive hearing loss.

CLINICAL DESCRIPTION

A rare ciliopathy characterized by congenital moderate-to-severe deafness, retinitis pigmentosa developing in the first or second decade, and normal vestibular function. Congenital bilateral sensorineural hearing loss is mild to moderate in the low frequencies and severe to profound in the higher frequencies. Additional manifestations include night blindness, constricted visual field (tunnel vision), and later on decreased visual acuity sometimes ending with bare light perception.

VARIANTS

NM_000260.3(MYO7A):c.5618G>A ; NM_000260.3(MYO7A):c.3508G>A ; NM_000260.3(MYO7A):c.3719G>A ; NM_000260.3(MYO7A):c.3764delA ; NM_000260.3(MYO7A):c.3G>A ; NM_000260.3(MYO7A):c.4024delT ; NM_000260.3(MYO7A):c.494C>T ; NM_000260.3(MYO7A):c.5824G>T ; NM_000260.3(MYO7A):c.635G>A ; NM_000260.3(MYO7A):c.1184G>A ; NM_000260.3(MYO7A):c.133-2A>G ; c.1344-1G>A ; NM_000260.3(MYO7A):c.1797G>A ; NM_000260.3(MYO7A):c.1884C>A ; NM_000260.3(MYO7A):c.1996C>T ; NM_000260.4:c.2476G>A ; NM_000260.3(MYO7A):c.3504-1G>C ; NM_000260.3:c.3596dupT ; NM_000260.3(MYO7A):c.448C>T ; NM_000260.3(MYO7A):c.5392C>T ; NM_000260.3(MYO7A):c.5886_5889delCTTT ; c.5967C>G ; NM_000260.3(MYO7A):c.6025delG ; NM_000260.3(MYO7A):c.634C>T ; NM_000260.4:c.640G>A ; NM_000260.3(MYO7A):c.731G>C

GENE

NAGS

DISEASES
Hyperammonemia due to N-acetylglutamate synthase deficiency
SUMMARY

N-acetylglutamate synthase (NAGS) deficiency is a urea cycle disorder leading to hyperammonaemia.

CLINICAL DESCRIPTION

Onset occurs at any age, but neonatal presentation appears to be the most frequent. The clinical manifestations are variable but common features include vomiting, hyperactivity or lethargy, diarrhoea, poor feeding, seizures, hypotonia, delayed psychomotor development and respiratory distress. The hyperammonaemia is often severe and may lead to hyperammonaemic coma.

VARIANTS

NM_153006.2(NAGS):c.1025del ; NM_153006.2(NAGS):c.1289T>C ; NM_153006.2(NAGS):c.1299G>C ; NM_153006.3(NAGS):c.1307dup ; NM_153006.2(NAGS):c.916-2A>T ; NM_153006.2(NAGS):c.971G>A

GENE

NDRG1

DISEASES
Charcot-Marie-Tooth disease type 4D
SUMMARY

By convention, the designation CMT4 is applied to autosomal recessive forms of demyelinating Charcot-Marie-Tooth disease, which is a peripheral neuropathy characterized by distal motor and sensory impairment resulting in gait difficulties and associated with foot deformities. Motor nerve conduction velocities are decreased, and sural nerve biopsies show loss of myelinated fibers. The age at onset and severity is variable.

CLINICAL DESCRIPTION

Charcot-Marie-Tooth disease type 4D (CMT4D) is a subtype of Charcot-Marie-Tooth disease type 4 characterized by a childhood-onset of severe, progressive, demyelinating sensorimotor neuropathy manifesting with distal muscle weakness and atrophy, sensorineural hearing impairment leading to deafness (usually in third decade), severely reduced nerve conduction velocities, and skeletal, especially foot, deformities. Tongue atrophy has also been reported.

VARIANTS

NM_006096.3(NDRG1):c.538-1G>A ; c.-18-2_-18-1del ; NM_006096.3:c.16C-T ; NM_001135242.1(NDRG1):c.442C>T ; c.928C>T

GENE

NEB

DISEASES
Childhood-onset nemaline myopathy
SUMMARY

Childhood onset nemaline myopathy, or mild nemaline myopathy is a type of nemaline myopathy (NM; see this terms) characterized by distal muscle weakness, and sometimes slowness of muscle contraction.

CLINICAL DESCRIPTION

Childhood onset NM might represent 10-15% of total cases. Onset is around 10 years of age, with initial presentation of symmetric weakness of ankle dorsiflexion and foot drop, or a general slowness of muscle contraction. All movements at the ankle and more proximal limb muscles may be disturbed. Weakness is slowly progressive. Facial, respiratory and cardiac muscles are generally normal, but patients are unable to jump or run because of muscle weakness or slowness.

Distal nebulin myopathy
SUMMARY

Distal nebulin myopathy is a rare, slowly progressive, autosomal recessive distal myopathy characterized by early onset of predominantly distal muscle weakness and atrophy affecting lower leg extensor muscles, finger extensors and neck flexors. Muscle histology does not always show nemaline rods.

CLINICAL DESCRIPTION

Distal nebulin myopathy manifests initially, in early childhood or young adulthood, by foot drop, but the first symptoms can be seen as early as one year of age. The most severely affected muscles include the ankle dorsiflexors, the finger extensors and the neck flexors. Patients are usually not able to walk on their heels and later in the disease course, there is a mild proximal muscle involvement. Additional features include early-onset moderate facial weakness and mild respiratory problems, such as shortness of breath on strenuous exercise (although only one patient presenting decreased vital capacity has been reported). Cardiac muscle is usually not affected, however cardiomyopathy has been described in one patient.

Intermediate nemaline myopathy
SUMMARY

Intermediate nemaline myopathy is a type of nemaline myopathy (NM; see this term) that shows features of typical NM (see this term) in neonates with a more severe progression.

CLINICAL DESCRIPTION

Neonates with intermediate NM present with spontaneous anti-gravity movements and active respiratory muscles, but with a progressive generalized weakness which prevents achievement of gross motor milestones or leads to loss of ambulation and/or independent respiration by age 11 years. Children often develop joint contractures.

Lethal multiple pterygium syndrome
SUMMARY

A rare genetic multiple pterygium syndrome characterized by intrauterine growth retardation, fetal akinesia, multiple joint contractures causing severe arthrogryposis and pterygia (webbing) across multiple joints. Cystic hygroma and/or fetal hydrops are almost invariably present.

CLINICAL DESCRIPTION

Lethal multiple pterygium syndrome (LMPS) is characterized by growth deficiency of prenatal onset, pterygia present in multiple areas (chin to sternum, cervical, axillary, humero-ulnar, crural, popliteal and the ankles) and flexion contractures giving rise to severe arthrogryposis. Subcutaneous edema varies from mildly edematous skin to fetal hydrops with cystic hygroma, lung hypoplasia, and oligo or polyhydramnios. Facial anomalies include hypertelorism, down-slanting palpebral fissures, epicanthic folds, flat nasal root, microretrognathism, microstomia, low-set malformed ears and cleft palate. Other anomalies include a small chest, reduced muscle bulk, cryptorchidism, central nervous system abnormalities (in particular cerebellar hypoplasia, ventricular dilatation and polymicrogyria), hypoplastic dermal ridges and creases, and less frequently a mid-forehead hemangioma, intestinal malrotation, cardiac hypoplasia, diaphragmatic hernia, obstructive uropathy, rocker bottom feet, microcephaly and/or cerebellar and pontine hypoplasia.

Severe congenital nemaline myopathy
SUMMARY

Severe congenital nemaline myopathy is a severe form of nemaline myopathy (NM; see this term) characterized by severe hypotonia with little spontaneous movement in neonates.

CLINICAL DESCRIPTION

Neonates have sucking and swallowing difficulties, and gastroesophageal reflux, which leads to failure to thrive. Involvement of diaphragm and intercostal muscles contributes to respiratory insufficiency. Cardiomyopathy and arthrogryposis may occur.

Typical nemaline myopathy
SUMMARY

Typical nemaline myopathy is a moderate neonatal form of nemaline myopathy (NM; see this term) characterized by facial and skeletal muscle weakness and mild respiratory involvement.

CLINICAL DESCRIPTION

Disease onset is in the neonatal period. Patients have a long face, a high-arched palate and a tented upper lip. Skeletal anomalies may include kyphoscoliosis, pectus carinatum and pes cavus. In the first year of life, hypotonia and facial weakness are present and often contribute to failure to thrive and delayed motor development. Anti-gravity movements are present and respiratory muscle involvement is frequent. Nocturnal hypoxia and hypercarbia and lower respiratory tract infections are common manifestations. Joint hypermobility can be observed. In a minority of children weakness is more distal. Progression is very slow or absent and most patients are able to live an independent active life.

VARIANTS

NM_001164507.1(NEB):c.21076C>T ; NM_001271208.1(NEB):c.23526_23527delAG ; NM_001271208.1(NEB):c.24094C>T ; NM_001271208.1(NEB):c.24770_24771delTT ; NM_001271208.1(NEB):c.8031_8041delAAATAAACGAG ; NM_004543.4:c.11474_11475delTG ; NM_004543.4:c.19306-1G-A ; c.2173G>T ; c.21945+1G>A ; c.24687_24688del ; NM_001271208.1(NEB):c.25279G>T ; ENST00000397345.7:c.25404+1_25404+2insATGGA ; NM_004543.4:c.6105dupT ; c.843T>G

GENE

NPC1

DISEASES
Niemann-Pick disease type C, adult neurologic onset
SUMMARY

A rare lysosomal lipid storage disease characterized by variable clinical signs, depending on the age of onset, such as prolonged unexplained neonatal jaundice or cholestasis, isolated unexplained splenomegaly, and progressive, often severe neurological symptoms such as cognitive decline, cerebellar ataxia, vertical supranuclear gaze palsy (VSPG), dysarthria, dysphagia, dystonia, seizures, gelastic cataplexy, and psychiatric disorders.

CLINICAL DESCRIPTION

The clinical onset and presentation is heterogeneous. NPDC is classically a neurovisceral condition with hepatosplenomegaly usually preceding the neurological symptoms, occurring in infancy or childhood but possibly occurring much later. Some patients exhibit lung disease early on and a small subset of patients can develop rapidly deteriorating hepatic or respiratory failure in early infancy. Neurological onset varies between early infancy to adulthood. Typically, neurologic involvement is progressive and consists mainly of dystonia, cerebellar ataxia, dysarthria, dysphagia, and progressive dementia. VSGP and cataplexy (with or without narcolepsy) are characteristic. Psychiatric disturbances are frequent in late-onset patients.

Niemann-Pick disease type C, juvenile neurologic onset
SUMMARY

A rare lysosomal lipid storage disease characterized by variable clinical signs, depending on the age of onset, such as prolonged unexplained neonatal jaundice or cholestasis, isolated unexplained splenomegaly, and progressive, often severe neurological symptoms such as cognitive decline, cerebellar ataxia, vertical supranuclear gaze palsy (VSPG), dysarthria, dysphagia, dystonia, seizures, gelastic cataplexy, and psychiatric disorders.

CLINICAL DESCRIPTION

The clinical onset and presentation is heterogeneous. NPDC is classically a neurovisceral condition with hepatosplenomegaly usually preceding the neurological symptoms, occurring in infancy or childhood but possibly occurring much later. Some patients exhibit lung disease early on and a small subset of patients can develop rapidly deteriorating hepatic or respiratory failure in early infancy. Neurological onset varies between early infancy to adulthood. Typically, neurologic involvement is progressive and consists mainly of dystonia, cerebellar ataxia, dysarthria, dysphagia, and progressive dementia. VSGP and cataplexy (with or without narcolepsy) are characteristic. Psychiatric disturbances are frequent in late-onset patients.

Niemann-Pick disease type C, late infantile neurologic onset
SUMMARY

A rare lysosomal lipid storage disease characterized by variable clinical signs, depending on the age of onset, such as prolonged unexplained neonatal jaundice or cholestasis, isolated unexplained splenomegaly, and progressive, often severe neurological symptoms such as cognitive decline, cerebellar ataxia, vertical supranuclear gaze palsy (VSPG), dysarthria, dysphagia, dystonia, seizures, gelastic cataplexy, and psychiatric disorders.

CLINICAL DESCRIPTION

The clinical onset and presentation is heterogeneous. NPDC is classically a neurovisceral condition with hepatosplenomegaly usually preceding the neurological symptoms, occurring in infancy or childhood but possibly occurring much later. Some patients exhibit lung disease early on and a small subset of patients can develop rapidly deteriorating hepatic or respiratory failure in early infancy. Neurological onset varies between early infancy to adulthood. Typically, neurologic involvement is progressive and consists mainly of dystonia, cerebellar ataxia, dysarthria, dysphagia, and progressive dementia. VSGP and cataplexy (with or without narcolepsy) are characteristic. Psychiatric disturbances are frequent in late-onset patients.

Niemann-Pick disease type C, severe early infantile neurologic onset
SUMMARY

A rare lysosomal lipid storage disease characterized by variable clinical signs, depending on the age of onset, such as prolonged unexplained neonatal jaundice or cholestasis, isolated unexplained splenomegaly, and progressive, often severe neurological symptoms such as cognitive decline, cerebellar ataxia, vertical supranuclear gaze palsy (VSPG), dysarthria, dysphagia, dystonia, seizures, gelastic cataplexy, and psychiatric disorders.

CLINICAL DESCRIPTION

The clinical onset and presentation is heterogeneous. NPDC is classically a neurovisceral condition with hepatosplenomegaly usually preceding the neurological symptoms, occurring in infancy or childhood but possibly occurring much later. Some patients exhibit lung disease early on and a small subset of patients can develop rapidly deteriorating hepatic or respiratory failure in early infancy. Neurological onset varies between early infancy to adulthood. Typically, neurologic involvement is progressive and consists mainly of dystonia, cerebellar ataxia, dysarthria, dysphagia, and progressive dementia. VSGP and cataplexy (with or without narcolepsy) are characteristic. Psychiatric disturbances are frequent in late-onset patients.

Niemann-Pick disease type C, severe perinatal form
SUMMARY

A rare lysosomal lipid storage disease characterized by variable clinical signs, depending on the age of onset, such as prolonged unexplained neonatal jaundice or cholestasis, isolated unexplained splenomegaly, and progressive, often severe neurological symptoms such as cognitive decline, cerebellar ataxia, vertical supranuclear gaze palsy (VSPG), dysarthria, dysphagia, dystonia, seizures, gelastic cataplexy, and psychiatric disorders.

CLINICAL DESCRIPTION

The clinical onset and presentation is heterogeneous. NPDC is classically a neurovisceral condition with hepatosplenomegaly usually preceding the neurological symptoms, occurring in infancy or childhood but possibly occurring much later. Some patients exhibit lung disease early on and a small subset of patients can develop rapidly deteriorating hepatic or respiratory failure in early infancy. Neurological onset varies between early infancy to adulthood. Typically, neurologic involvement is progressive and consists mainly of dystonia, cerebellar ataxia, dysarthria, dysphagia, and progressive dementia. VSGP and cataplexy (with or without narcolepsy) are characteristic. Psychiatric disturbances are frequent in late-onset patients.

VARIANTS

NM_000271.4(NPC1):c.2972_2973delAG ; NM_000271.4(NPC1):c.2974G>T ; NM_000271.4(NPC1):c.3019C>G ; NM_000271.4(NPC1):c.3107C>T ; NM_000271.4(NPC1):c.813_815delCAT ; NM_000271.4(NPC1):c.1628C>T ; NM_000271.4(NPC1):c.2072C>T ; NM_000271.4(NPC1):c.2761C>T ; NM_000271.4(NPC1):c.2842G>A ; NM_000271.4(NPC1):c.2848G>A ; NM_000271.4(NPC1):c.2861C>T ; NM_000271.4(NPC1):c.2932C>T ; NM_000271.4(NPC1):c.2974G>A ; NM_000271.4(NPC1):c.3104C>T ; NM_000271.4(NPC1):c.3175C>T ; NM_000271.4(NPC1):c.3425T>C ; NM_000271.4(NPC1):c.3467A>G ; NM_000271.4(NPC1):c.530G>A ; NM_000271.4:c.1042C-T ; NM_000271.5:c.1211G>A ; NM_000271.4(NPC1):c.2324A>C ; NM_000271.4(NPC1):c.2873G>A ; NM_000271.4(NPC1):c.3182T>C ; NM_000271.4(NPC1):c.337T>C ; NM_000271.4(NPC1):c.352_353delAG ; NM_000271.4(NPC1):c.3611_3614del ; NM_000271.4(NPC1):c.3662del

GENE

NPC2

DISEASES
Niemann-Pick disease type C, adult neurologic onset
SUMMARY

A rare lysosomal lipid storage disease characterized by variable clinical signs, depending on the age of onset, such as prolonged unexplained neonatal jaundice or cholestasis, isolated unexplained splenomegaly, and progressive, often severe neurological symptoms such as cognitive decline, cerebellar ataxia, vertical supranuclear gaze palsy (VSPG), dysarthria, dysphagia, dystonia, seizures, gelastic cataplexy, and psychiatric disorders.

CLINICAL DESCRIPTION

The clinical onset and presentation is heterogeneous. NPDC is classically a neurovisceral condition with hepatosplenomegaly usually preceding the neurological symptoms, occurring in infancy or childhood but possibly occurring much later. Some patients exhibit lung disease early on and a small subset of patients can develop rapidly deteriorating hepatic or respiratory failure in early infancy. Neurological onset varies between early infancy to adulthood. Typically, neurologic involvement is progressive and consists mainly of dystonia, cerebellar ataxia, dysarthria, dysphagia, and progressive dementia. VSGP and cataplexy (with or without narcolepsy) are characteristic. Psychiatric disturbances are frequent in late-onset patients.

Niemann-Pick disease type C, juvenile neurologic onset
SUMMARY

A rare lysosomal lipid storage disease characterized by variable clinical signs, depending on the age of onset, such as prolonged unexplained neonatal jaundice or cholestasis, isolated unexplained splenomegaly, and progressive, often severe neurological symptoms such as cognitive decline, cerebellar ataxia, vertical supranuclear gaze palsy (VSPG), dysarthria, dysphagia, dystonia, seizures, gelastic cataplexy, and psychiatric disorders.

CLINICAL DESCRIPTION

The clinical onset and presentation is heterogeneous. NPDC is classically a neurovisceral condition with hepatosplenomegaly usually preceding the neurological symptoms, occurring in infancy or childhood but possibly occurring much later. Some patients exhibit lung disease early on and a small subset of patients can develop rapidly deteriorating hepatic or respiratory failure in early infancy. Neurological onset varies between early infancy to adulthood. Typically, neurologic involvement is progressive and consists mainly of dystonia, cerebellar ataxia, dysarthria, dysphagia, and progressive dementia. VSGP and cataplexy (with or without narcolepsy) are characteristic. Psychiatric disturbances are frequent in late-onset patients.

Niemann-Pick disease type C, late infantile neurologic onset
SUMMARY

A rare lysosomal lipid storage disease characterized by variable clinical signs, depending on the age of onset, such as prolonged unexplained neonatal jaundice or cholestasis, isolated unexplained splenomegaly, and progressive, often severe neurological symptoms such as cognitive decline, cerebellar ataxia, vertical supranuclear gaze palsy (VSPG), dysarthria, dysphagia, dystonia, seizures, gelastic cataplexy, and psychiatric disorders.

CLINICAL DESCRIPTION

The clinical onset and presentation is heterogeneous. NPDC is classically a neurovisceral condition with hepatosplenomegaly usually preceding the neurological symptoms, occurring in infancy or childhood but possibly occurring much later. Some patients exhibit lung disease early on and a small subset of patients can develop rapidly deteriorating hepatic or respiratory failure in early infancy. Neurological onset varies between early infancy to adulthood. Typically, neurologic involvement is progressive and consists mainly of dystonia, cerebellar ataxia, dysarthria, dysphagia, and progressive dementia. VSGP and cataplexy (with or without narcolepsy) are characteristic. Psychiatric disturbances are frequent in late-onset patients.

Niemann-Pick disease type C, severe early infantile neurologic onset
SUMMARY

A rare lysosomal lipid storage disease characterized by variable clinical signs, depending on the age of onset, such as prolonged unexplained neonatal jaundice or cholestasis, isolated unexplained splenomegaly, and progressive, often severe neurological symptoms such as cognitive decline, cerebellar ataxia, vertical supranuclear gaze palsy (VSPG), dysarthria, dysphagia, dystonia, seizures, gelastic cataplexy, and psychiatric disorders.

CLINICAL DESCRIPTION

The clinical onset and presentation is heterogeneous. NPDC is classically a neurovisceral condition with hepatosplenomegaly usually preceding the neurological symptoms, occurring in infancy or childhood but possibly occurring much later. Some patients exhibit lung disease early on and a small subset of patients can develop rapidly deteriorating hepatic or respiratory failure in early infancy. Neurological onset varies between early infancy to adulthood. Typically, neurologic involvement is progressive and consists mainly of dystonia, cerebellar ataxia, dysarthria, dysphagia, and progressive dementia. VSGP and cataplexy (with or without narcolepsy) are characteristic. Psychiatric disturbances are frequent in late-onset patients.

Niemann-Pick disease type C, severe perinatal form
SUMMARY

A rare lysosomal lipid storage disease characterized by variable clinical signs, depending on the age of onset, such as prolonged unexplained neonatal jaundice or cholestasis, isolated unexplained splenomegaly, and progressive, often severe neurological symptoms such as cognitive decline, cerebellar ataxia, vertical supranuclear gaze palsy (VSPG), dysarthria, dysphagia, dystonia, seizures, gelastic cataplexy, and psychiatric disorders.

CLINICAL DESCRIPTION

The clinical onset and presentation is heterogeneous. NPDC is classically a neurovisceral condition with hepatosplenomegaly usually preceding the neurological symptoms, occurring in infancy or childhood but possibly occurring much later. Some patients exhibit lung disease early on and a small subset of patients can develop rapidly deteriorating hepatic or respiratory failure in early infancy. Neurological onset varies between early infancy to adulthood. Typically, neurologic involvement is progressive and consists mainly of dystonia, cerebellar ataxia, dysarthria, dysphagia, and progressive dementia. VSGP and cataplexy (with or without narcolepsy) are characteristic. Psychiatric disturbances are frequent in late-onset patients.

VARIANTS

NM_006432.4(NPC2):c.190+5G>A ; NM_006432.3(NPC2):c.436C>T ; NM_006432.4(NPC2):c.115G>A ; NM_006432.3(NPC2):c.27delG ; NM_006432.4(NPC2):c.295T>C ; NM_006432.4(NPC2):c.352G>T ; NM_006432.4(NPC2):c.358C>T ; NM_006432.3(NPC2):c.58G>T

GENE

NPHP1

DISEASES
Bardet-Biedl syndrome
SUMMARY

Bardet-Biedl syndrome (BBS) is a ciliopathy with multisystem involvement.

CLINICAL DESCRIPTION

This disorder is characterized by a combination of clinical signs: obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities, many of which appear several years after disease onset. Clinical expression is variable but most patients manifest the majority of clinical signs during the disease course. Pigmentary retinopathy is the only constant clinical sign after childhood. BBS may also be associated with several other manifestations including diabetes, hypertension, congenital cardiopathy and Hirschsprung disease (see this term).

Joubert syndrome with renal defect
SUMMARY

Joubert syndrome with renal defect is a rare subtype of Joubert syndrome and related disorders (JSRD, see this term) characterized by the neurological features of JS associated with renal disease, in the absence of retinopathy.

CLINICAL DESCRIPTION

In most cases, renal disease manifests as juvenile nephronophthisis, with onset of clinical symptoms in the late first/early second decade of life, although in rare cases there may be infantile NPH, with onset in the first years of life.

Juvenile nephronophthisis
SUMMARY

A rare, genetic, renal ciliopathy characterized by reduced ability of the kidneys to concentrate solutes, chronic tubulointerstitial nephritis, cystic renal disease and progression to end stage renal disease (ESRD). The three clinical subtypes are characterized by the age of onset of ESRD which includes infantile, juvenile and late onset.

CLINICAL DESCRIPTION

Three main forms have been described. Juvenile NPHP, the most frequent form, progresses to end-stage renal failure at median age of 13 and is responsible for 15% of cases of childhood ESRD. Infantile NPHP can present in utero with oligohydramnios sequence or postnatally with reduced kidney function and progresses to ESRD before age 3. Late-onset NPHP is a rare form of the disease and presents clinical and histological signs similar to the juvenile form but with ESRD occurring later (median age of 19 years). The typical clinical symptoms include polyuria, polydipsia with regular fluid intake, impaired sodium reabsorption that cause hypovolemia and hyponatremia, anemia and growth delay. Renal ultrasonography in early stages is normal or shows unspecific changes with increased renal echogenicity, with advancing kidney disease poor cortico-medullary differentiation is described; corticomedullary cysts are present in the 70% of patients. Renal histopathology in NPHP is characterized by the triad of tubular cysts, tubular basement membrane disruption, and interstitial fibrosis with interstitial cell infiltration. Retinal degeneration is the most frequent extrarenal findings (10%), cerebellar vermis aplasia, liver fibrosis and skeletal defects could be also present. Extrarenal phenotypes are distinct but they overlap in some syndromic forms of NPHP (such as Joubert syndrome, Senior-Loken syndrome, Meckel-Gruber syndrome).

Senior-Loken syndrome
SUMMARY

A rare autosomal recessive oculo-renal ciliopathy characterized by the association of nephronophthisis (NPHP), a chronic kidney disease, with retinal dystrophy.

CLINICAL DESCRIPTION

The disease typically presents in the first two decades of life as a combination of nephronophthisis (NPH) with retinal degeneration. Depending on the genetic background either the visual disorder or chronic kidney disease determine the clinical picture. NPH typically presents with symptoms such as polyuria, polydipsia, secondary enuresis and anemia. Chronic kidney disease usually slowly progresses to end-stage kidney disease (ESKD). Ocular features include congenital or early-onset severe visual loss due to retinal dystrophy (Leber congenital amaurosis) or a milder phenotype determined by a slowly progressing tube-like restriction of visual fields and night blindness (tapeto-retinal degeneration). Funduscopy reveals various degrees of atrophic and pigmentary retinal alterations. In rare occasions, other additional clinical signs may be observed like liver fibrosis, obesity and neurologic disorders.

VARIANTS

NM_000272.3(NPHP1):c.1184dupC ; NM_000272.3(NPHP1):c.1884+1G>T ; c.1del ; NM_000272.3:c.455C-G ; NM_000272.3(NPHP1):c.555dupA ; NM_000272.3(NPHP1):c.80T>A ; NM_000272.3:c.829C-T

GENE

NPHS1

DISEASES
Genetic steroid-resistant nephrotic syndrome
SUMMARY

A rare, hereditary nephrotic syndrome characterized by proteinuria, hypoalbuminemia, edema, and hyperlipidemia, with an absence of response to an initial trial of corticosteroids (i.e. steroid-resistant nephrotic syndrome; SRNS) and a generally complicated course.

CLINICAL DESCRIPTION

Disease onset may occur anywhere between birth and adulthood but predominantly presents in younger populations. The nephrotic syndrome is defined by severe proteinuria (Urinary Protein/Creatinine ration > 200 mg/mmol) with low serum albumin (<30 g/l) and possible edema. Biopsy shows minimal change disease (MCD), focal segmental glomerulosclerosis (FSGS) or, more rarely, diffuse mesangial sclerosis (DMS), and podocyte foot process effacement by electron microscopy. It is multi-drug resistant and usually progresses to end-stage kidney failure; however, patients have a very low risk of recurrence after kidney transplantation.

VARIANTS

NM_004646.3(NPHS1):c.1307_1308dupAC ; NM_004646.3(NPHS1):c.1715G>A ; NM_004646.3(NPHS1):c.2491C>T ; NM_004646.3(NPHS1):c.2928G>T ; NM_004646.3(NPHS1):c.121_122delCT ; NM_004646.3(NPHS1):c.1481delC ; NM_004646.3:c.3109.1G-A ; NM_004646.3(NPHS1):c.3250delG ; NM_004646.3(NPHS1):c.3250dupG ; NM_004646.3(NPHS1):c.3325C>T ; NM_004646.3(NPHS1):c.3478C>T

GENE

NR0B1

DISEASES
46,XX testicular disorder of sex development
SUMMARY

A rare disorder of sex development (DSD) associated with a 46, XX karyotype and characterized by male external genitalia, ranging from normal to atypical with associated testosterone deficiency.

CLINICAL DESCRIPTION

The clinical phenotype is variable, with features that include: normal male external to atypical genitalia, undescended testes with absent Müllerian structures and infertility. Presentation depends on the presence of the SRY gene (sex determining region of the Y chromosome). SRY positive cases (80-90%) are usually otherwise normal men who present after puberty with short stature, normal pubic hair and penile size but small testes, gynecomastia and azoospermia-related sterility. Undescended testes and hypospadias are also reported. There are usually no concerns about gender role and identity. SRY negative individuals (10-20%) usually present at birth with features such as penoscrotal hypospadias and undescended testes. Long-term complications due to male hypogonadism include: low libido, erectile dysfunction, decreased secondary sexual characteristics, osteopenia and depression.

46,XY complete gonadal dysgenesis
SUMMARY

A rare disorder of sex development (DSD) associated with anomalies in gonadal development that result in the presence of female external and internal genitalia despite the 46,XY karyotype.

CLINICAL DESCRIPTION

Patients present during adolescence or early adulthood with normal female external genitalia but lack pubertal development although adrenarche is normal. Completely undeveloped streak gonads are present and are associated with an increased risk of abdominal tumours (most commonly dysgerminoma; see this term), which may be the presenting feature in some cases. Stature is normal or above normal, and features of Turner syndrome (see this term) are absent.

46,XY partial gonadal dysgenesis
SUMMARY

46,XY partial gonadal dysgenesis (46,XY PGD) is a disorder of sex development (DSD) associated with anomalies in gonadal development that results in genital ambiguity of variable degree ranging from almost female phenotype to almost male phenotype in a patient carrying a male 46,XY karyotype.

CLINICAL DESCRIPTION

46,XY PGD is characterized by ambiguous external genitalia with or without Müllerian structures. The degree of genital ambiguity varies along a spectrum, ranging from an almost female phenotype with clitoromegaly at one extreme to an almost male phenotype with isolated hypospadias at the other. Many patients present ambiguous genitalia or severe micropenis associated with complete regression of testicular tissue in one or both sides. Embryonic Testicular regression syndrome (ETRS; see this term) is considered as part of the clinical spectrum of PGD. Depending on the mutation, patients can have adrenal insufficiency or renal involvement (i.e. Wilms tumors or nephrotic syndrome). Gonadoblastomas or invasive germ cell tumors occur in around 20-30% of patients.

X-linked adrenal hypoplasia congenita
SUMMARY

A rare genetic adrenal disease characterized by primary adrenal insufficiency (AI) and/or hypogonadotropic hypogonadism (HH). Male patients typically present with AI with acute onset in infancy or insidious onset in childhood. Clinical features of AI include hyperpigmentation, vomiting, poor feeding, failure to thrive, seizures, vascular collapse, and sometimes sudden death. HH manifests later as delayed or arrested puberty. In rare cases, patients become symptomatic in early adulthood with delayed-onset AI, partial HH, and/or infertility. Histologically, the adrenal glands lack the permanent adult cortical zone. The remaining cells are larger than fetal adrenal cells (''cytomegalic'') and contain characteristic nuclear inclusions.

CLINICAL DESCRIPTION

Congenital adrenal hypoplasia (AHC) is a rare disorder that can be inherited in an X-linked or autosomal recessive pattern. In X-linked AHC, primary adrenocortical failure occurs because the adrenal glands lack the permanent adult cortical zone. The remaining cells are termed 'cytomegalic' because they are larger than typical fetal adrenal cells. Patients with AHC usually present in early infancy with primary adrenal failure. Hypogonadotropic hypogonadism (HHG) is a hallmark of the disorder, and is recognized during adolescence because of the absence or interruption of normal pubertal development. Abnormal spermatogenesis has also been observed in these patients. Milder forms of the disease have been described, with adrenal insufficiency sometimes occurring in childhood or even early adulthood.

VARIANTS

NM_000475.4(NR0B1):c.1094T>C ; NM_000475.4(NR0B1):c.1141C>T ; NM_000475.4(NR0B1):c.542_557del ; NM_000475.4(NR0B1):c.848A>C ; NM_000475.4(NR0B1):c.109C>T ; NM_000475.4(NR0B1):c.1107G>A ; NM_000475.4(NR0B1):c.1123_1124insT ; NM_000475.4(NR0B1):c.1138T>G ; NM_000475.4(NR0B1):c.1142T>A ; NM_000475.4(NR0B1):c.1146G>T ; NM_000475.4(NR0B1):c.1168+1_1168+20del ; NM_000475.4(NR0B1):c.1169-1G>A ; NM_000475.4(NR0B1):c.116G>A ; NM_000475.4(NR0B1):c.1183C>T ; NM_000475.4(NR0B1):c.1197C>A ; NM_000475.4(NR0B1):c.1231_1234delCTCA ; NM_000475.4(NR0B1):c.1234_1235delAG ; NM_000475.4(NR0B1):c.1267delC ; NM_000475.4(NR0B1):c.1274G>T ; NM_000475.4(NR0B1):c.1301delT ; NM_000475.4(NR0B1):c.1316T>G ; NM_000475.4(NR0B1):c.1319A>T ; NM_000475.4(NR0B1):c.1340T>C ; NM_000475.4(NR0B1):c.1364_1365delCA ; NM_000475.4(NR0B1):c.273C>A ; c.388_389del ; NM_000475.4(NR0B1):c.463_467delCAAACinsTGAGCTCCG ; NM_000475.4(NR0B1):c.501delA ; NM_000475.4(NR0B1):c.513G>A ; NM_000475.4(NR0B1):c.515G>A ; NM_000475.4(NR0B1):c.516G>A ; NM_000475.4(NR0B1):c.528C>G ; NM_000475.4(NR0B1):c.543delA ; NM_000475.4(NR0B1):c.545_546insCCCA ; NM_000475.4(NR0B1):c.548delG ; NM_000475.4(NR0B1):c.548dup ; NM_000475.4(NR0B1):c.551_552delAA ; NM_000475.4(NR0B1):c.552delA ; NM_000475.4(NR0B1):c.580delG ; NM_000475.4(NR0B1):c.591C>A ; NM_000475.4(NR0B1):c.625C>T ; NM_000475.4(NR0B1):c.638_654del17insCATC ; NM_000475.4(NR0B1):c.652dup ; NM_000475.4(NR0B1):c.704G>A ; NM_000475.4(NR0B1):c.708G>A ; NM_000475.4(NR0B1):c.745_746delAA ; NM_000475.4(NR0B1):c.754delC ; NM_000475.4(NR0B1):c.765C>A ; NM_000475.4(NR0B1):c.773C>A ; NM_000475.4(NR0B1):c.788T>A ; NM_000475.4(NR0B1):c.800G>C ; NM_000475.4(NR0B1):c.806T>A ; NM_000475.4(NR0B1):c.813C>G ; NM_000475.4(NR0B1):c.822C>A ; NM_000475.4(NR0B1):c.844C>T ; NM_000475.4(NR0B1):c.847C>T ; NM_000475.4:c.857_862del ; NM_000475.4(NR0B1):c.871T>C ; NM_000475.4(NR0B1):c.872G>C ; NM_000475.4(NR0B1):c.873G>C ; NM_000475.4(NR0B1):c.890T>C ; NM_000475.4(NR0B1):c.901C>T ; NM_000475.4(NR0B1):c.919G>T ; NM_000475.4(NR0B1):c.952C>T ; NM_000475.4(NR0B1):c.99del

GENE

NR2E3

DISEASES
Goldmann-Favre syndrome
SUMMARY

Goldmann-Favre syndrome (GFS) is a vitreoretinal dystrophy characterized by early onset of night blindness, reduced bilateral visual acuity, and typical fundus findings (progressive pigmentary degenerative changes, macular edema, retinoschisis).

CLINICAL DESCRIPTION

The onset is usually in childhood. GFS manifests with progressive loss of visual acuity and night blindness. Peripheral vision can be decreased. Cataract is a frequent complication. Optic atrophy has been occasionally reported. The vitreous changes are degenerative and may include microfibrillar strands, liquefaction and posterior vitreous detachment. The fundus features include annular pigmentary changes (clumped pigment deposits), central or peripheral retinoschisis, cystoid macular edema. The GFS features are usually bilateral and symmetrical. The electroretinogram (ERG) is abnormal: both rod and cone ERGs are markedly diminished and may be non-detectable. Patients may have an increased sensitivity to blue light due to increased S-cone sensitivity.

Retinitis pigmentosa
SUMMARY

Retinitis pigmentosa (RP) is an inherited retinal dystrophy leading to progressive loss of the photoreceptors and retinal pigment epithelium and resulting in blindness usually after several decades.

CLINICAL DESCRIPTION

Retinitis pigmentosa is slowly progressive but relentless. There is however broad variability in age of onset, rate of progression and secondary clinical manifestations. Affected individuals generally first develop night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and over time loss of central vision, usually at late stages, often around midlife. Central visual acuity loss may occur at any age as a result of cystoid macular edema or photoreceptor loss. Posterior subcapsular cataracts are common and severity is age dependent. Reduced color vision may also be found. Fundus examination reveals bone spicule pigment deposits, attenuated retinal vessels, retinal atrophy and waxy optic nerve pallor. Severity is partly correlated with the pattern of inheritance with X-linked cases having the most severe course, autosomal recessive and single occurrence cases having intermediate severity, and autosomal dominant the most favorable course.

VARIANTS

NM_016346.3(NR2E3):c.1034_1038del ; NM_016346.4:c.119-2A>C ; NM_014249.3(NR2E3):c.226C>T ; c.298_299del ; NM_014249.4:c.932G>A

GENE

NTRK1

DISEASES
Differentiated thyroid carcinoma
SUMMARY

A rare, slow-growing, epithelial thyroid carcinoma typically presenting as an asymptomatic thyroid mass and is classed as either papillary thyroid cancer (PTC), follicular thyroid cancer (FTC) or Hurthle cell thyroid cancer (HCTC).

CLINICAL DESCRIPTION

PTC, FTC, and HCTC have similar presentations, and constitute about 75, 20, and 5 percent of cases, respectively. About 10 percent of PTC are classified as tall cell variant, the most aggressive from of PTC. HCTC is generally considered slightly more aggressive than PTC and FTC. The age at diagnosis is usually over 30 years. Presentation is typically with an asymptomatic thyroid nodule. Rare but worrisome presentations include hoarseness due to vocal cord paralysis and obstruction of the airway or esophagus, and may suggest an aggressive variant of DTC or anaplastic thyroid carcinoma. DTC grows slowly, and distant metastases are rare at the time of presentation. The most common metastatic site is the cervical lymph nodes. Distant metastasis to lungs or bones is rare (about 5%). Pediatric cases are rare. They are more frequently present with lymph node involvement. Despite this apparently more aggressive presentation, the prognosis is excellent. Pathologically, PTC are usually composed of a mixture of papillae and follicles, frequently with relatively large nuclei containing folds and a clear center. About 50% contain calcium deposits. Different histological PTC subtypes have been described. FTC are characterized by microfollicles and presence of capsular and vascular invasion. HCTC, pathologically similar to FTC, are distinguished by mitochondria-rich, eosinophilic cytoplasm. Noninvasive follicular thyroid neoplasm with papillary-like nuclear features (NIFTP) is a recently described variant; it is currently unclear if it is a pre-malignant lesion or a DTC variant.

Familial medullary thyroid carcinoma
SUMMARY

Multiple endocrine neoplasia type IIA is an autosomal dominant syndrome of multiple endocrine neoplasms, including medullary thyroid carcinoma (MTC), pheochromocytoma, and parathyroid adenomas. MEN2B, characterized by MTC with or without pheochromocytoma and with characteristic clinical abnormalities such as ganglioneuromas of the lips, tongue and colon, but without hyperparathyroidism, is also caused by mutation in the RET gene.

CLINICAL DESCRIPTION

Hereditary sensory and autonomic neuropathy type 4
SUMMARY

A rare hereditary sensory and autonomic neuropathy characterized by anhidrosis, insensitivity to pain, self-mutilating behavior and episodes of fever.

CLINICAL DESCRIPTION

The disease typically presents in early infancy, but may occasionally present during the neonatal period. Consanguinity has been reported in 50% of patients. Episodic fevers without obvious infections, extreme hyperpyrexia and febrile convulsions due to inability to dissipate heat as a result of anhidrosis as well as self-mutilation are usually the earliest signs of the disease. The cardinal feature is absence of sweating on the trunk and extremities, with occasional patients producing some moisture on the forehead, tip of the nose and gluteal sulcus. The skin becomes thick and callused with lichenification of palms, areas of hypotrichosis on the scalp and dystrophic nails. Deep tendon reflexes are usually present. Pain insensitivity is profound resulting in self-mutilation, auto-amputation, and corneal scarring but some patients retain temperature perception. Vibration sense and proprioception are normal or moderately decreased Bone fractures are slow to heal and large weight bearing joints are particularly susceptible to repeated trauma and frequently go on to the development of Charcot joints and osteomyelitis. Hypotonia and delayed developmental milestones are frequent in the early years, but sometimes normalize with age. Speech is usually clear, but patients have severe learning difficulties, irritability, hyperactivity, and cognitive impairment. Normal intelligence, however, has been reported in a few patients. Mild postural hypotension with compensatory tachycardia may be present, but not episodic hypertension. Around 20% of patients have scoliosis.

Hereditary sensory and autonomic neuropathy type 5
SUMMARY

A disorder that is characterized by loss of pain perception and impaired temperature sensitivity, in the absence of any other major neurological anomalies.

CLINICAL DESCRIPTION

Other findings include ulcers, self-mutilation and damaged joints. Intelligence is normal.

VARIANTS

NM_001007792.1(NTRK1):c.986A>G ; NM_001007792.1(NTRK1):c.1621G>C ; NM_001007792.1(NTRK1):c.1651A>G ; NM_001012331.1:c.1709delT ; NM_001012331.1:c.1908_1909insT ; NM_001007792.1:c.1976C>T ; NM_001007792.1(NTRK1):c.2231G>C

GENE

OAT

DISEASES
Gyrate atrophy of choroid and retina
SUMMARY

Gyrate atrophy of the choroid and retina (GACR) is a very rare, inherited retinal dystrophy, characterized by progressive chorioretinal atrophy, myopia and early cataract.

CLINICAL DESCRIPTION

Age at diagnosis is highly variable (1 month - 44 years). High phenotypic variability is noted among patients even within the same family, as well variable disease progression. The first complaints of the patients are night blindness (nyctalopia) and constriction of the visual field caused by multiple round areas of chorioretinal atrophy in the periphery. Over the years, the atrophic areas increase, coalesce and spread towards the macula leading to central visual loss in the 4th to 7th decade of life. Other ocular manifestations include myopia with marked astigmatism, early posterior subcapsular cataract, and cystoid macular edema.

VARIANTS

NM_000274.3(OAT):c.901-2A>G ; NM_000274.3(OAT):c.952G>A ; NM_000274.3(OAT):c.952delG ; NM_000274.3(OAT):c.994G>A ; NM_000274.3(OAT):c.1205T>C ; NM_000274.3(OAT):c.1250C>T ; NM_000274.3(OAT):c.1276C>T ; NM_000274.3(OAT):c.159delC ; NM_000274.3(OAT):c.268C>G ; NM_000274.3(OAT):c.278G>T ; NM_000274.3(OAT):c.533G>A ; NM_000274.3(OAT):c.539G>C ; NM_000274.3(OAT):c.596C>A ; NM_000274.3(OAT):c.627T>A ; NM_000274.3(OAT):c.677C>T ; NM_000274.3(OAT):c.812G>A ; NM_000274.3(OAT):c.824G>A ; NM_000274.3(OAT):c.955C>T

GENE

OCRL

DISEASES
Dent disease type 2
SUMMARY

Dent disease type 2 is a type of Dent disease in which patients have the manifestations of Dent disease type 1 associated with extra-renal features.

CLINICAL DESCRIPTION

All of them had hypercalciuria and low-molecular-weight (LMW) proteinuria. In addition, these patients may also have nephrocalcinosis, nephrolithiasis, hematuria, hypophosphatemia and/or renal insufficiency. Only a minority (approximately one fourth) of these patients have been observed to have mild intellectual deficit, hypotonia and sub-clinical cataract. The presence of intellectual impairment and sub-clinical cataract were so mild as to dissuade the clinicians from considering a diagnosis of Lowe syndrome (see this term), which is characterized by congenital cataracts, delayed motor milestones, some degree of intellectual impairment in almost all affected males, growth retardation, rickets and renal proximal tubulopathy. Moreover, the patients with Dent disease type 2 and mild intellectual deficit were adults, who had not, over time, developed more overt features of Lowe syndrome.

Oculocerebrorenal syndrome of Lowe
SUMMARY

A rare multisystem disorder characterized by congenital cataracts, glaucoma, intellectual disabilities, seizures, postnatal growth retardation and renal tubular dysfunction with chronic renal failure.

CLINICAL DESCRIPTION

Oculocerebrorenal syndrome of Lowe (OCRL) is a congenital disorder characterized by ocular abnormalities (bilateral congenital discoid cataracts, glaucoma with or without buphthalmos, strabismus, hypermetropia and corneal and conjunctival cheloids), neurological involvement (developmental delay, seizures, hypotonia present at birth typically with absence of deep tendon reflexes), stereotypic behavior (temper tantrums, aggressiveness and obsessive compulsive behavior), postnatal growth retardation, mild to severe intellectual disability (mean IQ 40-50), stereotypic hand movements, renal dysfunction of the Fanconi type (proximal tubular acidosis; phosphate wasting leading to renal rickets, osteomalacia and pathological fractures) and progressive decline in kidney function leading to end-stage renal failure in adulthood. Subtle cataracts are obligate findings in female carriers after puberty. Other clinical manifestations include facial dysmorphism (frontal bossing, deep-set eyes, chubby cheeks, fair complexion), destructive teno-synovitis in older patients, short stature, mucocutaneous anomalies (eruptive vellus hair cysts, tricoepithiloma, excess skin folds and eruption cysts in oral cavity), dental malformations, cryptorchidism and bleeding tendency due to platelet dysfunction.

VARIANTS

NM_000276.3(OCRL):c.1498C>G ; NM_000276.3(OCRL):c.1040G>A ; NM_000276.3(OCRL):c.1124A>G ; NM_000276.3(OCRL):c.1477C>T ; NM_000276.3(OCRL):c.1505T>C ; NM_000276.3(OCRL):c.1570C>T ; NM_000276.3(OCRL):c.560+1G>C ; NM_000276.3(OCRL):c.723-2dup ; NM_000276.3(OCRL):c.952C>A ; NM_000276.3(OCRL):c.952C>T ; NC_000023.11:g.129589844G>A ; NM_000276.3(OCRL):c.1000C>T ; NM_000276.3(OCRL):c.1095delC ; NM_000276.3(OCRL):c.1436A>G ; NM_000276.3(OCRL):c.1499G>A ; NM_000276.3(OCRL):c.1572C>G ; NM_000276.3(OCRL):c.1573A>C ; NM_000276.3(OCRL):c.1576C>T ; NM_000276.3(OCRL):c.1621C>T ; NM_000276.3(OCRL):c.1714-1G>A ; NM_000276.3(OCRL):c.2299C>T ; NM_000276.3(OCRL):c.2360_2361delTG ; NM_000276.3(OCRL):c.238+4701A>G ; NM_000276.3(OCRL):c.2389G>C ; NM_000276.3:c.2403dupA ; NM_000276.4(OCRL):c.2428C>T ; NM_000276.3(OCRL):c.2470-2A>G ; NM_000276.3(OCRL):c.2530C>T ; NM_000276.3:c.2535delA ; NM_000276.3(OCRL):c.2563delG ; NM_000276.3(OCRL):c.2582-1G>A ; NM_000276.3(OCRL):c.2582-1G>T ; NM_000276.3(OCRL):c.860dup ; NM_000276.3(OCRL):c.909_910delAG ; NM_000276.3(OCRL):c.940-11G>A ; NM_000276.3(OCRL):c.970_986del17 ; NC_000023.11:g.129558953_129558954AT[1] ; NC_000023.11:g.129567337_129567338CT[1] ; NC_000023.11:g.129576344T>A ; NC_000023.11:g.129576416A>C ; NC_000023.11:g.129589008C>T

GENE

OTC

DISEASES
Ornithine transcarbamylase deficiency
SUMMARY

A rare, genetic disorder of urea cycle metabolism and ammonia detoxification characterized by either a severe, neonatal-onset disease found mainly in males, or later-onset (partial) forms of the disease. Both present with episodes of hyperammonemia that can be fatal and which can lead to neurological sequelae.

CLINICAL DESCRIPTION

Males with the severe, neonatal-onset type are normal at birth but develop poor sucking, hypotonia and lethargy after a few days, rapidly progressing into somnolence and coma. Seizures and hyperventilation may also be present. If untreated, severe encephalopathy will develop with a high risk for death. Patients with a milder form can present at any age. In infants, symptoms can be induced when switching from breast milk to whole milk. In children and adults, environmental stressors (i.e. fasting, high protein diet, pregnancy and the postpartum period, intercurrent illness, surgery) can trigger episodes of hyperammonemic encephalopathy along with nausea, vomiting, headaches, erratic behavior, delirium and combativeness. These episodes can also result in hyperammonemic coma. Neurological complications of hyperammonemic coma include developmental delay and, sometimes, severe cognitive impairment. Many female carriers are asymptomatic; however, they can be affected to the same extent as males if the degree of X-inactivation of the disease allele is unfavorable. Coagulopathy is a frequent finding during metabolic decompensation and sometimes evolves into acute liver failure.

VARIANTS

NM_000531.5(OTC):c.-115C>T ; NM_000531.5(OTC):c.-116C>T ; NM_000531.5(OTC):c.-139A>G ; NM_000531.5(OTC):c.-142G>A ; NM_000531.5(OTC):c.-157T>G ; NM_000531.5(OTC):c.118C>T ; NM_000531.5(OTC):c.167T>C ; NM_000531.5(OTC):c.228A>C ; NM_000531.5(OTC):c.254T>C ; NM_000531.5(OTC):c.365A>G ; NM_000531.5(OTC):c.418G>C ; NM_000531.5(OTC):c.494A>G ; NM_000531.5(OTC):c.505C>G ; NM_000531.5(OTC):c.596A>G ; NM_000531.5(OTC):c.613A>G ; NM_000531.5(OTC):c.673C>T ; NM_000531.5(OTC):c.77+2dup ; NM_000531.5(OTC):c.868-2A>T ; NM_000531.5(OTC):c.943G>T ; NM_000531.6(OTC):c.961T>C ; NM_000531.5(OTC):c.988A>G ; NM_000531.5(OTC):c.1005+1G>T ; NM_000531.5(OTC):c.1005+2T>C ; NM_000531.5(OTC):c.1005G>A ; NM_000531.5(OTC):c.1006-1G>A ; NM_000531.5(OTC):c.1006-3C>G ; NM_000531.5(OTC):c.1006G>T ; NM_000531.5(OTC):c.1009G>C ; NM_000531.5(OTC):c.1015G>C ; NM_000531.5(OTC):c.1018T>C ; NM_000531.5(OTC):c.1022T>C ; NM_000531.5(OTC):c.1028C>A ; NM_000531.5(OTC):c.1033T>C ; NM_000531.5(OTC):c.1033T>G ; NM_000531.5(OTC):c.1034A>G ; NM_000531.5(OTC):c.1039C>A ; NM_000531.5(OTC):c.1042C>T ; NM_000531.5(OTC):c.1061T>G ; NM_000531.5(OTC):c.106C>T ; NM_000531.5(OTC):c.115G>T ; NM_000531.5(OTC):c.119G>A ; NM_000531.5(OTC):c.122A>G ; NM_000531.5(OTC):c.127C>T ; NM_000531.5(OTC):c.131C>T ; NM_000531.5(OTC):c.133C>G ; NM_000531.5(OTC):c.134T>C ; NM_000531.5(OTC):c.140A>T ; NM_000531.5(OTC):c.140_141insG ; NM_000531.5(OTC):c.143T>C ; NM_000531.5(OTC):c.145A>C ; NM_000531.5(OTC):c.148G>T ; NM_000531.5(OTC):c.154G>A ; NM_000531.5(OTC):c.154G>T ; NM_000531.5(OTC):c.155A>G ; NM_000531.5(OTC):c.156A>T ; NM_000531.5(OTC):c.158T>G ; NM_000531.5(OTC):c.163T>G ; NM_000531.5(OTC):c.170T>A ; NM_000531.5(OTC):c.174G>A ; NM_000531.5(OTC):c.179C>T ; NM_000531.5(OTC):c.188T>C ; NM_000531.5(OTC):c.1A>G ; NM_000531.5(OTC):c.1A>T ; NM_000531.5(OTC):c.200T>G ; NM_000531.5(OTC):c.205C>T ; NM_000531.5(OTC):c.216+1G>A ; NM_000531.5(OTC):c.216+1G>T ; NM_000531.5(OTC):c.216+1delG ; NM_000531.5(OTC):c.217-1G>A ; NM_000531.5(OTC):c.217-2dupA ; NM_000531.5(OTC):c.227T>C ; NM_000531.5(OTC):c.231G>T ; NM_000531.5(OTC):c.232C>T ; NM_000531.5(OTC):c.236G>A ; NM_000531.5(OTC):c.238A>G ; NM_000531.5(OTC):c.240G>T ; NM_000531.5(OTC):c.243_245delCTT ; NM_000531.5(OTC):c.245T>G ; NM_000531.5(OTC):c.247G>C ; NM_000531.5(OTC):c.248G>A ; NM_000531.5(OTC):c.259G>A ; NM_000531.5(OTC):c.264A>T ; NM_000531.5(OTC):c.268A>G ; NM_000531.5(OTC):c.269G>A ; NM_000531.5(OTC):c.270T>G ; NM_000531.5(OTC):c.271delA ; NM_000531.5(OTC):c.274C>G ; NM_000531.5(OTC):c.274C>T ; NM_000531.5(OTC):c.275G>A ; NM_000531.5(OTC):c.277A>G ; NM_000531.5(OTC):c.281G>C ; NM_000531.5(OTC):c.284T>C ; NM_000531.5(OTC):c.28_31delAACA ; NM_000531.5(OTC):c.298+1G>A ; NM_000531.5(OTC):c.298+1G>T ; NM_000531.5(OTC):c.298+1_298+5delGTAAG ; NM_000531.5(OTC):c.298+2T>G ; NM_000531.5(OTC):c.299G>A ; NM_000531.5(OTC):c.2T>C ; NM_000531.5(OTC):c.305C>A ; NM_000531.5(OTC):c.314G>T ; NM_000531.5(OTC):c.316G>A ; NM_000531.5(OTC):c.317G>A ; NM_000531.5(OTC):c.317G>T ; NM_000531.5(OTC):c.327delT ; NM_000531.5(OTC):c.332T>C ; NM_000531.5(OTC):c.350A>G ; NM_000531.5(OTC):c.350A>T ; NM_000531.5(OTC):c.358_359delGT ; NM_000531.5(OTC):c.364_365insTT ; NM_000531.5(OTC):c.375delG ; NM_000531.5(OTC):c.377A>G ; NM_000531.5(OTC):c.386+1G>A ; NM_000531.5(OTC):c.386+1G>T ; NM_000531.5(OTC):c.386+2T>C ; NM_000531.5(OTC):c.386G>A ; NM_000531.5(OTC):c.386G>C ; NM_000531.5(OTC):c.386G>T ; NM_000531.5(OTC):c.387-2A>C ; NM_000531.5(OTC):c.387-2A>G ; NM_000531.5(OTC):c.387-2A>T ; NM_000531.5(OTC):c.390_391insTTA ; NM_000531.6(OTC):c.391_397dup ; NM_000531.5(OTC):c.392T>C ; NM_000531.5(OTC):c.394T>C ; NM_000531.5(OTC):c.395C>T ; NM_000531.5(OTC):c.3G>A ; NM_000531.5(OTC):c.403delG ; NM_000531.5(OTC):c.404C>A ; NM_000531.5(OTC):c.407A>T ; NM_000531.5(OTC):c.409G>A ; NM_000531.5(OTC):c.40delT ; NM_000531.5(OTC):c.416T>C ; NM_000531.5(OTC):c.421C>T ; NM_000531.5(OTC):c.422G>A ; NM_000531.5(OTC):c.422G>C ; NM_000531.5(OTC):c.425T>A ; NM_000531.5(OTC):c.430A>T ; NM_000531.5(OTC):c.437C>G ; NM_000531.5(OTC):c.443T>C ; NM_000531.5(OTC):c.443T>G ; NM_000531.5(OTC):c.444G>C ; NM_000531.5(OTC):c.444G>T ; NM_000531.5(OTC):c.449delC ; NM_000531.5(OTC):c.452T>G ; NM_000531.5(OTC):c.455C>T ; NM_000531.5(OTC):c.460G>T ; NM_000531.5(OTC):c.463G>C ; NM_000531.5(OTC):c.463G>T ; NM_000531.5(OTC):c.464C>A ; NM_000531.5(OTC):c.476T>C ; NM_000531.5(OTC):c.479T>A ; NM_000531.5(OTC):c.479T>C ; NM_000531.5(OTC):c.479T>G ; NM_000531.5(OTC):c.481A>G ; NM_000531.5(OTC):c.482A>G ; NM_000531.5(OTC):c.484G>A ; NM_000531.5(OTC):c.484G>C ; NM_000531.5(OTC):c.485G>A ; NM_000531.5(OTC):c.490T>C ; NM_000531.5(OTC):c.491C>G ; NM_000531.5(OTC):c.493G>T ; NM_000531.5(OTC):c.501C>A ; NM_000531.5(OTC):c.501C>G ; NM_000531.5(OTC):c.503A>C ; NM_000531.5(OTC):c.503A>G ; NM_000531.5(OTC):c.504T>A ; NM_000531.5(OTC):c.506C>T ; NM_000531.5(OTC):c.514A>T ; NM_000531.5(OTC):c.516C>G ; NM_000531.5(OTC):c.517C>G ; NM_000531.5(OTC):c.520G>C ; NM_000531.5(OTC):c.524A>G ; NM_000531.5(OTC):c.524A>T ; NM_000531.5(OTC):c.526T>C ; NM_000531.5(OTC):c.527A>G ; NM_000531.5(OTC):c.532_537delACGCTC ; NM_000531.5(OTC):c.533C>T ; NM_000531.5(OTC):c.536T>C ; NM_000531.5(OTC):c.53delA ; NM_000531.5(OTC):c.540+1G>C ; NM_000531.5(OTC):c.540+1G>T ; NM_000531.5(OTC):c.540+265G>A ; NM_000531.5(OTC):c.540+2T>A ; NM_000531.5(OTC):c.540+2T>C ; NM_000531.5(OTC):c.540G>C ; NM_000531.5(OTC):c.541-2A>G ; NM_000531.5(OTC):c.542A>G ; NM_000531.5(OTC):c.545A>T ; NM_000531.5(OTC):c.547T>G ; NM_000531.5(OTC):c.548A>G ; NM_000531.5(OTC):c.562G>C ; NM_000531.5(OTC):c.562_563delGG ; NM_000531.5(OTC):c.563G>T ; NM_000531.5(OTC):c.571C>T ; NM_000531.5(OTC):c.576C>G ; NM_000531.5(OTC):c.577T>C ; NM_000531.5(OTC):c.577T>G ; NM_000531.5(OTC):c.578G>A ; NM_000531.5(OTC):c.583G>A ; NM_000531.5(OTC):c.583delG ; NM_000531.5(OTC):c.586G>A ; NM_000531.5(OTC):c.586G>T ; NM_000531.5(OTC):c.587A>T ; NM_000531.5(OTC):c.590G>A ; NM_000531.5(OTC):c.593A>T ; NM_000531.5(OTC):c.594C>A ; NM_000531.5(OTC):c.595A>G ; NM_000531.5(OTC):c.602T>C ; NM_000531.5(OTC):c.604C>T ; NM_000531.5(OTC):c.605A>C ; NM_000531.5(OTC):c.608C>G ; NM_000531.5(OTC):c.615G>C ; NM_000531.5(OTC):c.617T>G ; NM_000531.5(OTC):c.618G>C ; NM_000531.5(OTC):c.620G>A ; NM_000531.5(OTC):c.621C>A ; NM_000531.5(OTC):c.622G>A ; NM_000531.5(OTC):c.626C>T ; NM_000531.5(OTC):c.628A>C ; NM_000531.5(OTC):c.634G>T ; NM_000531.5(OTC):c.640C>T ; NM_000531.5(OTC):c.643C>T ; NM_000531.5(OTC):c.645_646insT ; NM_000531.5(OTC):c.646C>G ; NM_000531.5(OTC):c.650C>A ; NM_000531.5(OTC):c.658C>G ; NM_000531.5(OTC):c.659C>T ; NM_000531.5(OTC):c.663+1G>A ; NM_000531.5(OTC):c.663+1G>T ; NM_000531.5(OTC):c.663+2T>C ; NM_000531.5(OTC):c.663G>A ; NM_000531.5(OTC):c.663G>C ; NM_000531.5(OTC):c.664-1G>A ; NM_000531.5(OTC):c.664-1delG ; NM_000531.5(OTC):c.673C>A ; NM_000531.5(OTC):c.674C>T ; NM_000531.5(OTC):c.67C>T ; NM_000531.5(OTC):c.698C>T ; NM_000531.5(OTC):c.700G>T ; NM_000531.5(OTC):c.716A>G ; NM_000531.5(OTC):c.716A>T ; NM_000531.5(OTC):c.717+1G>A ; NM_000531.5(OTC):c.717+1G>T ; NM_000531.5(OTC):c.717+2T>C ; NM_000531.5(OTC):c.717+3A>G ; NM_000531.5(OTC):c.717+7_717+22delTCTTTACATGTAAAGC ; NM_000531.5(OTC):c.717G>A ; NM_000531.5(OTC):c.717G>C ; NM_000531.5(OTC):c.718-2A>G ; NM_000531.5(OTC):c.718-4_729delCTAGAATGGTACCAAG ; NM_000531.5(OTC):c.725C>T ; NM_000531.5(OTC):c.72_77+18del24 ; NM_000531.5(OTC):c.731T>A ; NM_000531.5(OTC):c.731_739delTGTTGCTGA ; NM_000531.5(OTC):c.740C>A ; NM_000531.5(OTC):c.757G>A ; NM_000531.5(OTC):c.757G>C ; NM_000531.5(OTC):c.759delA ; NM_000531.5(OTC):c.764A>C ; NM_000531.5(OTC):c.77+1G>A ; NM_000531.5(OTC):c.77+1G>T ; NM_000531.5(OTC):c.77+4A>C ; NM_000531.5(OTC):c.77+5G>A ; NM_000531.5(OTC):c.779T>C ; NM_000531.5(OTC):c.77G>A ; NM_000531.5(OTC):c.78-1G>C ; NM_000531.5(OTC):c.78-3C>G ; NM_000531.5(OTC):c.785C>A ; NM_000531.5(OTC):c.785C>T ; NM_000531.5(OTC):c.787G>A ; NM_000531.5(OTC):c.788A>G ; NM_000531.5(OTC):c.790A>G ; NM_000531.5(OTC):c.791C>A ; NM_000531.5(OTC):c.791C>T ; NM_000531.5(OTC):c.793T>C ; NM_000531.5(OTC):c.794G>T ; NM_000531.5(OTC):c.795G>A ; NM_000531.5(OTC):c.799A>C ; NM_000531.5(OTC):c.803T>C ; NM_000531.5(OTC):c.806G>A ; NM_000531.5(OTC):c.808C>T ; NM_000531.5(OTC):c.809A>C ; NM_000531.5(OTC):c.818delA ; NM_000531.5(OTC):c.829C>T ; NM_000531.5(OTC):c.830G>A ; NM_000531.5(OTC):c.830G>T ; NM_000531.5(OTC):c.835C>T ; NM_000531.5(OTC):c.867+1G>A ; NM_000531.5(OTC):c.867+1G>T ; NM_000531.5(OTC):c.867G>T ; NM_000531.5(OTC):c.875delA ; NM_000531.5(OTC):c.882delT ; NM_000531.5(OTC):c.889_892delGACT ; NM_000531.5(OTC):c.892_893delTG ; NM_000531.5(OTC):c.893G>C ; NM_000531.5(OTC):c.903A>T ; NM_000531.5(OTC):c.904C>T ; NM_000531.5(OTC):c.905A>G ; NM_000531.5(OTC):c.905A>T ; NM_000531.5(OTC):c.906C>G ; NM_000531.5(OTC):c.906delC ; NM_000531.5(OTC):c.907T>C ; NM_000531.5(OTC):c.907T>G ; NM_000531.5(OTC):c.908G>A ; NM_000531.5(OTC):c.912G>T ; NM_000531.5(OTC):c.914C>A ; NM_000531.5(OTC):c.914C>G ; NM_000531.5(OTC):c.919A>G ; NM_000531.5(OTC):c.928G>T ; NM_000531.5(OTC):c.929A>G ; NM_000531.5(OTC):c.931G>A ; NM_000531.5(OTC):c.940_942delGAA ; NM_000531.5(OTC):c.944T>A ; NM_000531.5(OTC):c.944T>G ; NM_000531.5(OTC):c.947T>C ; NM_000531.5(OTC):c.94C>T ; NM_000531.5(OTC):c.953C>T ; NM_000531.5(OTC):c.958C>T ; NM_000531.5(OTC):c.959G>T ; NM_000531.5(OTC):c.962C>A ; NM_000531.5(OTC):c.976G>A ; NM_000531.5(OTC):c.982G>T ; NM_000531.5(OTC):c.991A>T ; NM_000531.5(OTC):c.994T>A ; NM_000531.5(OTC):c.995G>A ; NM_000531.5(OTC):c.996G>A

GENE

PAH

DISEASES
Classic phenylketonuria
SUMMARY

A severe form of phenylketonuria (PKU) due to phenylalanine hydroxylase deficiency, an inborn error of amino acid metabolism, characterized in untreated patients by severe intellectual deficit and neuropsychiatric complications.

CLINICAL DESCRIPTION

Late diagnosed patients present mostly with progressive developmental delay associated with severe signs including stunted growth, microcephaly, seizures, tremors, eczema, vomiting, musty odor, and subsequently behavioral (hyperactivity) and motor disorders. Untreated patients develop profound, permanent intellectual impairment and deterioration of cognitive performance and motor skills. Demyelination and decreased dopamine, norepinephrine, and serotonin production have been found in patients who do not pursue dietary restrictions into adulthood. Complications later on include exaggerated deep tendon reflexes, tremor, and paraplegia or hemiplegia. In treated patients, clinical signs vary based on treatment and diet compliance, and may include psychiatric disorders such as attention deficit-hyperactivity disorder and depression.

Maternal phenylketonuria
SUMMARY

A rare disorder of phenylalanine (Phe) metabolism, an inborn error of amino acid metabolism, characterized by the development of microcephaly, growth retardation, congenital heart disease, facial dysmorphism and intellectual disability in non-phenylketonuric offspring of mothers with excess blood Phe concentrations.

CLINICAL DESCRIPTION

Hyperphenylalaninemia is classified by blood Phe concentrations of more than 1,200 micromol/L (classic PKU) or less than 600 micromol/L (mild hyperphenylalaninemia), between 600 and 1,200 micromol/L as mild PKU. Maternal phenylketonuria syndrome has been shown to result in intrauterine and postnatal growth retardation with associated low birth weight, microcephaly, and intellectual disability in the offspring. Congenital heart malformation is also found and may include double-chambered right ventricle, tetralogy of Fallot, and ventricular septal defects. In severe cases, facial dysmorphism may also occur with various features reported including receding forehead, ptosis or fused eyes, strabismus, dysplastic ear helices, high palate, underdeveloped philtrum, anteverted nostrils, broad flat nasal bridge, deviated nasal septum, and micrognathia. Optimal maternal blood Phe concentrations should be strictly maintained throughout pregnancy to reduce the risk of these abnormalities. This can be achieved by minimal dietary Phe intake, along with tyrosine-enriched supplements. Studies have also shown that dietary treatment to control blood Phe concentrations can prevent the disorder if started before conception.

Mild hyperphenylalaninemia
SUMMARY

A rare form of phenylketonuria, an inborn error of amino acid metabolism, characterized by blood phenylalanine (Phe) concentrations of 120-600 micromol/L with or without clinical manifestations of impaired cognitive function, and behavioral and developmental disorders.

CLINICAL DESCRIPTION

Phenylketonuria (PKU) is an autosomal recessive inborn error of metabolism resulting from a deficiency of phenylalanine hydroxylase (PAH), an enzyme that catalyzes the hydroxylation of phenylalanine to tyrosine, the rate-limiting step in phenylalanine catabolism. If undiagnosed and untreated, phenylketonuria can result in impaired postnatal cognitive development resulting from a neurotoxic effect of hyperphenylalaninemia.

Mild phenylketonuria
SUMMARY

A mild to moderate form of phenylketouria (PKU), an inborn error of amino acid metabolism, characterized by blood phenylalanine concentrations of 600-1,200 micromol/L and manifests with reduced cognitive function and behavioral and developmental disorders. Dietary phenylalanine tolerance is 400-600 mg/day.

CLINICAL DESCRIPTION

Phenylketonuria (PKU) is an autosomal recessive inborn error of metabolism resulting from a deficiency of phenylalanine hydroxylase (PAH; 612349), an enzyme that catalyzes the hydroxylation of phenylalanine to tyrosine, the rate-limiting step in phenylalanine catabolism. If undiagnosed and untreated, phenylketonuria can result in impaired postnatal cognitive development resulting from a neurotoxic effect of hyperphenylalaninemia.

Tetrahydrobiopterin-responsive hyperphenylalaninemia/phenylketonuria
SUMMARY

A form of phenylketonuria (PKU), an inborn error of amino acid metabolism, characterized by mild to moderate symptoms of PKU including impaired cognitive function, seizures, and behavioral and developmental disorders, and a marked reduction of elevated phenylalanine concentrations after oral loading with tetrahydrobiopterin (BH4), an essential cofactor of phenylalanine hydroxylase.

CLINICAL DESCRIPTION

Phenylketonuria (PKU) is an autosomal recessive inborn error of metabolism resulting from a deficiency of phenylalanine hydroxylase (PAH), an enzyme that catalyzes the hydroxylation of phenylalanine to tyrosine, the rate-limiting step in phenylalanine catabolism. If undiagnosed and untreated, phenylketonuria can result in impaired postnatal cognitive development resulting from a neurotoxic effect of hyperphenylalaninemia.

VARIANTS

NM_000277.1(PAH):c.1033G>T ; NM_000277.2(PAH):c.1066-3C>T ; NM_000277.2(PAH):c.1166delC ; NM_000277.2(PAH):c.1199+17G>A ; NM_000277.2(PAH):c.1199+1G>A ; NM_000277.3(PAH):c.1217T>C ; NM_000277.1(PAH):c.204A>T ; NM_000277.1(PAH):c.250G>T ; NM_000277.2(PAH):c.261C>A ; NM_000277.2(PAH):c.284_286delTCA ; NM_000277.2(PAH):c.320A>G ; NM_000277.2(PAH):c.357delC ; NM_000277.2(PAH):c.441+1G>A ; NM_000277.2(PAH):c.482T>C ; NM_000277.3(PAH):c.490A>G ; NM_000277.1(PAH):c.611A>G ; NM_000277.3(PAH):c.688G>A ; NM_000277.2(PAH):c.722delG ; NM_000277.2(PAH):c.733G>C ; NM_000277.2(PAH):c.764T>C ; NM_000277.3(PAH):c.818C>T ; NM_000277.1(PAH):c.842+5G>A ; NM_000277.1(PAH):c.896T>G ; NM_000277.2(PAH):c.926C>A ; NM_000277.1(PAH):c.1042C>G ; NM_000277.3:c.1045T>C ; NM_000277.3:c.1066-11G>A ; NM_000277.3(PAH):c.1068C>A ; NM_000277.3(PAH):c.1139C>T ; NM_000277.3(PAH):c.1162G>A ; NM_000277.3(PAH):c.1169A>G ; NM_000277.1(PAH):c.117C>G ; NM_000277.3(PAH):c.1197A>T ; NM_000277.3:c.1208C>T ; NM_000642.3:c.1222C>T ; NM_000277.3(PAH):c.1238G>C ; NM_000277.3(PAH):c.1241A>G ; NM_000277.3(PAH):c.1243G>A ; NM_000277.3:c.1315+1G>A ; NM_000277.1(PAH):c.136G>A ; NM_000277.3:c.143T>C ; NM_000277.3:c.165T>G ; NM_000277.3(PAH):c.194T>C ; NM_000277.3(PAH):c.311C>A ; NM_000277.3(PAH):c.331C>T ; NM_000277.3:c.441+5G>T ; NM_000277.3(PAH):c.442-1G>A ; NM_000277.2(PAH):c.442-5C>G ; c.450dup ; NM_000277.3(PAH):c.472C>T ; NM_000277.3:c.473G>A ; NM_000277.2(PAH):c.47_48delCT ; NM_000277.2(PAH):c.503delA ; NM_000277.3(PAH):c.508C>G ; NM_000277.1(PAH):c.527G>T ; NM_000277.3(PAH):c.529G>A ; NM_000277.3:c.533A>G ; NM_000277.2(PAH):c.569T>C ; NM_000277.3(PAH):c.638T>C ; NM_000277.3(PAH):c.721C>T ; NM_000277.3:c.722G>A ; NM_000277.3(PAH):c.727C>T ; NM_000277.1(PAH):c.728G>A ; NM_000277.3(PAH):c.734T>C ; NM_000277.2(PAH):c.737C>A ; NM_000277.3(PAH):c.745C>T ; NM_000277.3:c.754C>T ; NM_000277.3(PAH):c.755G>A ; NM_000277.3:c.782G>A ; NM_000277.2(PAH):c.806delT ; NM_000277.2(PAH):c.809G>A ; NM_000277.3(PAH):c.814G>T ; NM_000277.3(PAH):c.823C>T ; NM_000277.3(PAH):c.829T>G ; NM_000277.1(PAH):c.838G>A ; NM_000277.3:c.898G>T ; NM_000277.3(PAH):c.912+1G>A ; NM_000277.3(PAH):c.926C>T ; NM_000277.2(PAH):c.955G>T

GENE

PANK2

DISEASES
Atypical pantothenate kinase-associated neurodegeneration
SUMMARY

Pantothenate kinase-associated neurodegeneration (PKAN) is the most common type of neurodegeneration with brain iron accumulation (NBIA; see this term), a rare neurodegenerative disorder characterized by progressive extrapyramidal dysfunction (dystonia, rigidity, choreoathetosis), iron accumulation on the brain and axonal spheroids in the central nervous system.

CLINICAL DESCRIPTION

Classic PKAN (75% of cases) is characterized by early onset, usually before six years of age, and rapid progression. Atypical PKAN (25% of cases) has later onset, between 13 and 14 years of age, and slower progression. Patients present with symptoms anywhere along a continuum between the two. In classic PKAN, patients present with impaired gait and falling, often related to dystonia, rigidity, impaired balance, or spasticity, and usually lose the ability to ambulate by 10-15 years after onset. Episodes of rapid decline, which may include status dystonicus, occur interspersed with longer periods of relative stability. Developmental delay (primarily motor, sometimes global) may occur. Patients frequently develop pigmentary retinal degeneration and dysarthria. Later in disease course common complications include dysphagia, gastro-oesophageal reflux, chronic constipation, aspiration pneumonia and malnutrition. In atypical PKAN, patients present with speech difficulty, mild gait abnormalities, prominent psychiatric symptoms that may include depression, emotional lability, impulsivity, or violent outbursts, pigmentary retinal degeneration (less frequently than in classic PKAN) and both verbal and motor tourettism. Motor involvement is generally less severe and loss of ambulation occurs within 15-40 years of onset. The association of hyperprebetalipoproteinemia, acanthocytes and retinitis pigmentosa (HARP syndrome) is within the PKAN spectrum.

Classic pantothenate kinase-associated neurodegeneration
SUMMARY

Pantothenate kinase-associated neurodegeneration (PKAN) is the most common type of neurodegeneration with brain iron accumulation (NBIA; see this term), a rare neurodegenerative disorder characterized by progressive extrapyramidal dysfunction (dystonia, rigidity, choreoathetosis), iron accumulation on the brain and axonal spheroids in the central nervous system.

CLINICAL DESCRIPTION

Classic PKAN (75% of cases) is characterized by early onset, usually before six years of age, and rapid progression. Atypical PKAN (25% of cases) has later onset, between 13 and 14 years of age, and slower progression. Patients present with symptoms anywhere along a continuum between the two. In classic PKAN, patients present with impaired gait and falling, often related to dystonia, rigidity, impaired balance, or spasticity, and usually lose the ability to ambulate by 10-15 years after onset. Episodes of rapid decline, which may include status dystonicus, occur interspersed with longer periods of relative stability. Developmental delay (primarily motor, sometimes global) may occur. Patients frequently develop pigmentary retinal degeneration and dysarthria. Later in disease course common complications include dysphagia, gastro-oesophageal reflux, chronic constipation, aspiration pneumonia and malnutrition. In atypical PKAN, patients present with speech difficulty, mild gait abnormalities, prominent psychiatric symptoms that may include depression, emotional lability, impulsivity, or violent outbursts, pigmentary retinal degeneration (less frequently than in classic PKAN) and both verbal and motor tourettism. Motor involvement is generally less severe and loss of ambulation occurs within 15-40 years of onset. The association of hyperprebetalipoproteinemia, acanthocytes and retinitis pigmentosa (HARP syndrome) is within the PKAN spectrum.

VARIANTS

NM_153638.3(PANK2):c.1561G>A ; NM_153638.3(PANK2):c.1583C>T ; NM_153638.3(PANK2):c.790C>T ; c.823_824del ; NC_000020.11:g.3910806A>T

GENE

PC

DISEASES
Pyruvate carboxylase deficiency, benign type
SUMMARY

Benign pyruvate carboxylase (PC) deficiency (Type C) is a rare, very mild form of PC deficiency characterized by episodic metabolic acidosis and normal or mildly delayed neurological development.

CLINICAL DESCRIPTION

Onset typically occurs during the first year of life with episodic metabolic acidosis associated with lactic acidemia and occasionally with ketoacidosis during metabolic stress. Neurological development is normal or mildly impaired. Other signs include dystonia, episodic ataxia, dysarthria, transitory hemiparesis and seizures.

Pyruvate carboxylase deficiency, infantile type
SUMMARY

Infantile pyruvate carboxylase (PC) deficiency (Type A) is a rare, severe form of PC deficiency characterized by infantile-onset, mild to moderate lactic acidemia, and a generally severe course.

CLINICAL DESCRIPTION

Patients with Type A PC deficiency usually first present with symptoms at the age of two to five months, often after normal early development. Clinical manifestations include mild to moderate metabolic acidosis with acute vomiting and tachypnea, failure to thrive, apathy, delayed intellectual and motor development, hypotonia, pyramidal dysfunction, ataxia, nystagmus and seizures. Renal tubular acidosis has also been reported.

Pyruvate carboxylase deficiency, severe neonatal type
SUMMARY

Severe neonatal pyruvate carboxylase (PC) deficiency (Type B) is a rare, extremely severe form of PC deficiency characterized by severe, early-onset metabolic acidosis, and a generally fatal outcome in early infancy.

CLINICAL DESCRIPTION

Patients develop clinical manifestations during the first 72 hours of life with severe truncal hypotonia and tachypnea. Subsequent clinical signs include anorexia, failure to thrive, hepatomegaly, myoclonic or generalized tonic-clonic seizures, stupor, pyramidal dysfunction, abnormal movements (high-amplitude tremor and dyskinesia), abnormal limb and ocular movements and severe impairment of mental and motor development. Renal tubular acidosis has been reported.

VARIANTS

NM_001040716.1(PC):c.1748G>T ; NM_000920.3(PC):c.434T>C

GENE

PCCA

DISEASES
Propionic acidemia
SUMMARY

Propionic acidemia (PA) is an organic aciduria caused by the deficient activity of the propionyl Coenzyme A carboxylase and is characterized by life threatening episodes of metabolic decompensation, neurological dysfunction and that may be complicated by cardiomyopathy.

CLINICAL DESCRIPTION

Propionic acidemia can present in one of the following forms: severe neonatal onset, intermittent late onset or a chronic progressive form. In the severe neonatal onset form, the affected infants present with symptoms of metabolic intoxication (poor feeding, vomiting, altered sensorium) and pancytopenia within several hours to weeks after birth. In the intermittent late onset form, the disease presents after a year or even later in life with episodes of metabolic decompensation provoked by periods of catabolic stress like fever, vomiting and trauma. Patients may also present with acute neurological crisis characterized by dystonia, rigidity, choreoathetosis and dementia (due to infarction of basal ganglia). In the chronic progressive form, the disease presents as failure to thrive, chronic vomiting, psychomotor delay, hypotonia, seizures and movement disorders. Intellectual disability, optic neuropathy, cardiomyopathy, long QT syndrome, pancreatitis, dermatitis, and immune dysfunction are known complications.

VARIANTS

NM_000282.3(PCCA):c.1284+1G>A ; NM_000282.3(PCCA):c.1891G>C ; NM_000282.3(PCCA):c.229C>T ; NM_000282.3(PCCA):c.1023dupT ; NM_000282.3(PCCA):c.1118T>A ; NM_000282.3:c.1226_1227delTT ; NM_000282.3:c.1598_1601delTTGT ; NM_000282.3(PCCA):c.1899+4_1899+7delAGTA ; NM_000282.3:c.261_262insT ; NM_000282.3(PCCA):c.412G>A ; c.600+1G>A ; NM_000282.3(PCCA):c.862A>T

GENE

PCCB

DISEASES
Propionic acidemia
SUMMARY

Propionic acidemia (PA) is an organic aciduria caused by the deficient activity of the propionyl Coenzyme A carboxylase and is characterized by life threatening episodes of metabolic decompensation, neurological dysfunction and that may be complicated by cardiomyopathy.

CLINICAL DESCRIPTION

Propionic acidemia can present in one of the following forms: severe neonatal onset, intermittent late onset or a chronic progressive form. In the severe neonatal onset form, the affected infants present with symptoms of metabolic intoxication (poor feeding, vomiting, altered sensorium) and pancytopenia within several hours to weeks after birth. In the intermittent late onset form, the disease presents after a year or even later in life with episodes of metabolic decompensation provoked by periods of catabolic stress like fever, vomiting and trauma. Patients may also present with acute neurological crisis characterized by dystonia, rigidity, choreoathetosis and dementia (due to infarction of basal ganglia). In the chronic progressive form, the disease presents as failure to thrive, chronic vomiting, psychomotor delay, hypotonia, seizures and movement disorders. Intellectual disability, optic neuropathy, cardiomyopathy, long QT syndrome, pancreatitis, dermatitis, and immune dysfunction are known complications.

VARIANTS

NM_000532.4(PCCB):c.1228C>T ; NM_000532.4(PCCB):c.1304A>G ; NM_000532.4(PCCB):c.1606A>G ; NM_000532.4(PCCB):c.331C>T ; NM_000532.4(PCCB):c.502G>A ; NM_000532.4(PCCB):c.562G>A ; NM_000532.4(PCCB):c.1173dupT ; NM_000532.4(PCCB):c.1218_1231delGGGCATCATCCGGCinsTAGAGCACAGGA ; c.1219_1224delinsAA ; NM_000532.4:c.1223_1226delTCAT ; NM_000532.4:c.1229_1230insT ; NM_000532.4(PCCB):c.1283C>T ; NM_000532.4(PCCB):c.1534C>T ; NM_000532.4(PCCB):c.1539_1540insCCC ; NM_000532.4(PCCB):c.337C>T ; NM_000532.4(PCCB):c.683C>T ; NM_000532.4(PCCB):c.990dupT

GENE

PCDH15

DISEASES
Autosomal recessive non-syndromic sensorineural deafness type DFNB
SUMMARY

Deafness is the most frequent form of sensorial deficit. In the vast majority of cases, the deafness is termed nonsyndromic or isolated and the hearing loss is the only clinical anomaly reported. In developed counties, 60-80% of cases of early-onset hearing loss are of genetic origin.

CLINICAL DESCRIPTION

The majority of cases presenting at birth concern perceptive deafness (with a neurosensory origin associated with the inner ear) rather than conductive deafness (anomalies in the amplification of sound waves between the middle ear - tympanum and auditory ossicles - and the outer ear). Autosomal dominant forms are characterised by very early onset and bilateral hearing loss with varying degrees of severity (ranging from mild to profound). No malformations of the inner ear can be detected by CT scan. Mutations in the PDS gene are responsible for 7% of cases of childhood deafness. In these cases, the deafness is marked by early-onset, usually bilateral (but sometimes asymmetric) hearing loss with autosomal recessive transmission. This form of deafness is always associated with malformations of the inner ear that can be detected by CT scan. In rare cases, thyroid gland disease may also be present. For the autosomal dominant forms of deafness, mutations in the COCH gene result in progressive postlingual deafness associated with severe attacks of vertigo and subjective tinnitus. This form of deafness should be distinguished from Meniere's disease (see this term). Autosomal dominant mutations in the WFS1 gene cause either a form of hearing loss affecting mainly low frequency sounds or deafness associated with optic atrophy.

Usher syndrome type 1
SUMMARY

Usher syndrome type I is an autosomal recessive condition characterized by profound congenital hearing impairment with unintelligible speech, early retinitis pigmentosa (usually evident within the first decade), and constant vestibular dysfunction. Type I is distinguished from type II on the basis of severity of hearing loss and the extent of vestibular involvement. Type I patients are profoundly deaf, whereas type II patients are 'hard of hearing.' Vestibular function is defective in type I patients, whereas type II patients have normal vestibular function. Patients with type III (USH3) have progressive hearing loss.

CLINICAL DESCRIPTION

A rare ciliopathy characterized by profound congenital deafness, retinitis pigmentosa and vestibular dysfunction. Retinitis pigmentosa results in visual loss and generally manifests as night blindness, progressively constricted visual fields, and impaired visual acuity. Vestibular dysfunction a defining feature of this form, manifests as delayed motor development with affected infants taking longer to sit independently and to walk. Later on, vestibular dysfunction results in difficulty with activities requiring balance.

VARIANTS

NM_033056.3(PCDH15):c.1006C>T ; NM_033056.3(PCDH15):c.1737C>G ; NM_033056.3(PCDH15):c.400C>G ; NM_001142772.1(PCDH15):c.400C>T ; NM_033056.3(PCDH15):c.7C>T ; NM_033056.3(PCDH15):c.1086delT ; NM_033056.3(PCDH15):c.1583T>A ; NM_033056.3(PCDH15):c.1940C>G ; c.2645_2646del ; c.3718-2A>G ; NM_033056.3:c.4548_4551dupATCT ; c.4864del ; c.4937_4940dup ; NM_033056.3:c.4961_4962insTGAT ; NM_033056.3:c.5659A-T ; NM_033056.3:c.5724_5755delACGCACAAATGTTTCAGAACTTCAAACTATGT ; NM_033056.3(PCDH15):c.785G>A

GENE

PDHA1

DISEASES
Leigh syndrome with leukodystrophy
SUMMARY

Leigh syndrome is a clinically and genetically heterogeneous disorder resulting from defective mitochondrial energy generation. It most commonly presents as a progressive and severe neurodegenerative disorder with onset within the first months or years of life, and may result in early death. Affected individuals usually show global developmental delay or developmental regression, hypotonia, ataxia, dystonia, and ophthalmologic abnormalities, such as nystagmus or optic atrophy. The neurologic features are associated with the classic findings of T2-weighted hyperintensities in the basal ganglia and/or brainstem on brain imaging. Leigh syndrome can also have detrimental multisystemic affects on the cardiac, hepatic, gastrointestinal, and renal organs. Biochemical studies in patients with Leigh syndrome tend to show increased lactate and abnormalities of mitochondrial oxidative phosphorylation.

CLINICAL DESCRIPTION

Pyruvate dehydrogenase E1-alpha deficiency
SUMMARY

A disorder that is the most frequent form of pyruvate dehydrogenase deficiency (PDHD) characterized by variable lactic acidosis, impaired psychomotor development, hypotonia and neurological dysfunction.

CLINICAL DESCRIPTION

Patients present with a range of classic signs and symptoms of PDHD, including lactic acidosis, poor feeding, lethargy, tachypnea, developmental delay, growth retardation, poor acquisition or loss of motor milestones, hypotonia, seizures, ataxia and dystonia. Structural brain lesions including cortical atrophy, dilated ventricles, and incomplete corpus callosum, absence of the medullary pyramids and ectopia of the olivary nuclei are commonly observed, especially in female patients heterozygous for the disease-causing mutations that result in complete deficiency of E1-alpha subunit protein in cells expressing the gene mutation.

VARIANTS

NM_000284.3(PDHA1):c.311T>C ; NM_000284.3(PDHA1):c.1025T>G ; NM_000284.3(PDHA1):c.1046C>T ; NM_000284.3(PDHA1):c.1100A>C ; NM_000284.3(PDHA1):c.214C>T ; NM_000284.3(PDHA1):c.300_301dup ; NM_000284.3(PDHA1):c.364G>A ; NM_000284.3(PDHA1):c.409G>A ; NM_000284.3(PDHA1):c.455C>T ; NM_000284.3(PDHA1):c.461A>G ; NM_000284.3(PDHA1):c.536T>G ; NM_000284.3(PDHA1):c.640T>C ; NM_000284.3(PDHA1):c.642G>A ; NM_000284.3(PDHA1):c.707C>A ; NM_000284.3(PDHA1):c.738C>T ; NM_000284.3(PDHA1):c.746T>G ; NM_000284.3(PDHA1):c.754C>G ; NM_000284.3(PDHA1):c.832G>A ; NC_000023.11:g.19355494C>T ; NM_000284.3(PDHA1):c.*79_*90dup ; NM_000284.3(PDHA1):c.1008+1_1008+27del27 ; NM_000284.3(PDHA1):c.1026_1039del14 ; NM_000284.3(PDHA1):c.1034_1037dup ; NM_000284.3(PDHA1):c.1073_1092del ; NM_000284.3(PDHA1):c.1074_1109dup ; NM_000284.3(PDHA1):c.1132C>T ; NM_000284.3(PDHA1):c.1142_1145dupATCA ; NM_000284.3(PDHA1):c.1159_1160del ; NM_000284.3(PDHA1):c.1159_1162dupAAGT ; NM_000284.3(PDHA1):c.1167_1170del ; NM_001173454.1(PDHA1):c.1247G>A ; c.1277C>A ; NM_000284.3(PDHA1):c.225G>T ; NM_000284.3(PDHA1):c.292-1G>A ; NM_000284.3(PDHA1):c.292-23A>G ; NM_000284.3(PDHA1):c.29G>C ; NM_000284.3(PDHA1):c.422G>A ; NM_000284.3(PDHA1):c.482A>G ; NM_000284.3(PDHA1):c.483C>T ; NM_000284.3(PDHA1):c.491A>G ; NM_000284.3(PDHA1):c.506C>T ; NM_000284.3(PDHA1):c.523G>A ; NM_000284.3(PDHA1):c.58-1G>A ; NM_000284.3(PDHA1):c.615C>G ; NM_000284.3(PDHA1):c.648A>C ; NM_000284.3(PDHA1):c.650C>T ; NM_000284.3(PDHA1):c.727T>A ; NM_000284.3(PDHA1):c.735A>C ; NM_000284.3(PDHA1):c.760-1G>T ; NM_000284.3(PDHA1):c.773A>C ; NM_000284.3(PDHA1):c.787C>G ; NM_000284.3(PDHA1):c.832-1G>A ; NM_000284.3(PDHA1):c.858_861dupTTAC ; NM_000284.3(PDHA1):c.861_862insT ; NM_000284.3(PDHA1):c.863G>A ; NM_000284.3(PDHA1):c.900-2A>G ; NM_000284.3(PDHA1):c.904C>T ; NM_000284.3(PDHA1):c.905G>A ; NM_000284.3(PDHA1):c.910C>T ; NM_000284.3(PDHA1):c.917_918insTAGTTACCGTACACGAGAAGA ; NM_000284.3(PDHA1):c.921_932dupTCAGGAAGTAAG ; NM_000284.3(PDHA1):c.929_932delTAAG ; NM_000284.3(PDHA1):c.930_932delAAG ; NM_000284.3(PDHA1):c.934_940del ; NM_000284.3(PDHA1):c.936_939delTAAG ; NM_000284.3(PDHA1):c.937_939del ; NM_000284.3(PDHA1):c.937_940dupAAGA ; NM_000284.3(PDHA1):c.943G>A ; NM_000284.3(PDHA1):c.954dupG ; NM_000284.3(PDHA1):c.985_998dupCTTGCCAGTGTGGA

GENE

PEX1

DISEASES
Deafness-enamel hypoplasia-nail defects syndrome