ESSENTIAL
GENE

AR

DISEASES
Complete androgen insensitivity syndrome
SUMMARY

Complete androgen insensitivity syndrome (CAIS) is a form of androgen insensitivity syndrome (AIS; see this term), a disorder of sex development (DSD), characterized by the presence of female external genitalia in a 46,XY individual with normal testis development but undescended testes and unresponsiveness to age-appropriate levels of androgens.

CLINICAL DESCRIPTION

The typical presentation is primary amenorrhea in an adolescent female. CAIS may also present in infancy or childhood with an inguinal hernia or labial swelling containing a testis. Breast development at puberty is normal, but pubic and axillary hair is absent or scanty. The external genitalia are normal female but internal female genitalia are absent. Adult patients are tall. Other presentations may be serendipitous from a mismatch in prenatal sexing (XY) and birth female phenotype, history of an inguinal hernia repair in an older sister, or development of a pelvic tumor in later adult life.

Kennedy disease
SUMMARY

Kennedy's disease, also known as bulbospinal muscular atrophy (BSMA), is a rare X-linked recessive motor neuron disease characterized by proximal and bulbar muscle wasting.

CLINICAL DESCRIPTION

Disease onset occurs between 30-60 years of age. Initial clinical manifestations include tremor, muscle cramps, muscle twitching, fatigue and slurred speech. With disease progression patients additionally develop weakness and wasting of the limb and bulbar muscles, manifesting as dysarthria, dysphonia, hanging jaw, tongue wasting, chewing difficulty and impaired mobility. Intellectual decline is minimal to none. In the terminal stages of the disease some patients may be unable to swallow or breathe. Non-neurological manifestations include gynecomastia, hypogonadism (leading to infertility and impotence) and in rare cases Dupuytren's contracture, or groin hernia.

Partial androgen insensitivity syndrome
SUMMARY

A disorder of sex development (DSD) distinct from complete AIS (CAIS) characterized by the presence of abnormal genital development in a 46,XY individual with normal testis development and partial responsiveness to age-appropriate levels of androgens.

CLINICAL DESCRIPTION

Patients have a highly variable genital appearance. The prototypic form of presentation is severe hypospadias, micropenis, and bifid scrotum in which the testes may or may not be descended. In the more severe form of PAIS, patients have female external genitalia with clitoromegaly, partial labial fusion and labial swellings comprising testes. A mild end of the spectrum, labeled MAIS (mild or minimal AIS), is a male with gynecomastia at puberty or an adult presenting with male factor infertility.

Posterior hypospadias
SUMMARY

A rare, non-syndromic, congenital, urogenital tract malformation affecting males and characterized by penoscrotal, scrotal or perineal displacement of the urethral meatus, and commonly associated with curvation of the penis. The scrotum might appear bifid in severe cases, and the boy can also have a micropenis.

CLINICAL DESCRIPTION

The consequences of hypospadias, apart from the appearance, include spraying of the urinary stream, inability to urinate in standing position, and later in life curvature, unless corrected, leads to difficulties during intercourse. Fertility problems and decreased satisfaction with genital appearance are more common. Severe hypospadias and concomitant undescended testis, is regarded as a disorder of sex development (DSD) and should be referred to special multidisciplinary teams for molecular and hormonal evaluation.

VARIANTS

NM_000044.4(AR):c.2567G>A ; NM_000044.4(AR):c.2395C>G ; NM_000044.4(AR):c.1771A>T ; NM_000044.4(AR):c.2391G>A ; c.340C>T ; NM_000044.4(AR):c.2650A>T ; NM_000044.4(AR):c.2323C>T

GENE

ATP7A

DISEASES
Menkes disease
SUMMARY

A rare congenital disorder of copper metabolism with severe multisystemic manifestations that are primarily characterized by progressive neurodegeneration and marked connective tissue anomalies. A pathognomonic feature is the typical sparse, abnormal steely hair.

CLINICAL DESCRIPTION

Menkes disease (MD) manifests in the neonatal period. Most patients are born at term with appropriate birth measurements. Cephalohematomas and spontaneous fractures are occasionally observed at birth. In the early neonatal period, patients may present with prolonged jaundice, hypothermia, hypoglycemia and feeding difficulties. Pectus excavatum and umbilical and inguinal hernias have also been reported. Unusual sparse and dull scalp hair is often the initial observation at the age of 1-2 months. Characteristically, the hair appears hypopigmented/depigmented, resembles steel wool and is friable, especially in the areas of the scalp subjected to friction. Additional symptoms are failure to thrive, poor eating, vomiting, and diarrhea. The appearance of pale skin, frontal or occipital bossing, micrognathia and pudgy cheeks may be observed. Patients develop gradual motor dysfunction and seizures. Muscular hypotonia in early life is replaced later-on by spasticity and weakness of the extremities. The clinical course is usually severe. Variable forms exist with occipital horn syndrome (OHS) being the mildest recognized form, which further presents with prominent bony exostoses and bladder diverticula.

Occipital horn syndrome
SUMMARY

A rare congenital disorder of copper metabolism that is principally characterized by bony exostoses (including the pathognomonic occipital horns), and connective tissue manifestations with cutis laxa and bladder diverticula. Central nervous system involvement is variable.

CLINICAL DESCRIPTION

Age of onset ranges from infancy to childhood. Observations at birth may include cephalhematoma (12% of cases), loose and wrinkled skin, and umbilical or inguinal hernias. About one third of all patients primarily present with central nervous system involvement (hypotonia, developmental delay and/or seizures). Initial clinical presentation may occur later with bladder diverticula or skeletal manifestations. Bladder diverticula affects the majority of patients (>80%) and may manifest through recurrent urinary tract infections or pollakisuria. The most typical skeletal manifestation (present in 96% of all patients) is an exostosis on the occiput at the insertion of the trapezoid muscle (occipital horn), but exostoses may also occur on the tibia and radius. Other, more variable, skeletal features are hammer-shaped claviculae, scoliosis, pectus deformity, coxa valga, genua valga as well as dislocations of the radial head. Less frequently reported skeletal manifestations include bowing of the long bones, mid-diaphyseal broadening, metaphyseal spurring, rounding of the iliac wings and, rarely, osteopenia. Facial features become distinctive with age and includes a long face (46%), large ears (38%), sagging cheeks (45%) and coarse hair (74%). Trichoscopy may show pili torti. The skin is often hyperextensible and soft with fine wrinkling on the hands and feet. Skin redundancy is remarkable on the belly. Vascular tortuosity is common in the intracranial arteries (65%), but may also affect the cervical, splenic and splanchnic circulation and imposes a risk for aneurysm formation. Aortic root dilatation and dissection may rarely occur. Dysautonomia with postural orthostatic hypotension, temperature instability and chronic diarrhea is present in most patients (>90%). About half of all patients show a delayed motor development due to muscle hypotonia and joint hypermobility, and may report unusual clumsiness. Distal motor neuropathy has been recorded in at least one patient. About half of all patients have intellectual disability (ID) which is usually mild, but moderate to severe impairment may occur.

X-linked distal spinal muscular atrophy type 3
SUMMARY

X-linked distal spinal muscular atrophy type 3 is a rare distal hereditary motor neuropathy characterized by slowly progressive atrophy and weakness of distal muscles of hands and feet with normal deep tendon reflexes or absent ankle reflexes and minimal or no sensory loss, sometimes mild proximal weakness in the legs and feet and hand deformities in males.

CLINICAL DESCRIPTION

The disorder was transmitted in an X-linked recessive pattern of inheritance. In 6 of 9 patients who were examined, age at onset ranged from 1 to 10 years, and the first detected symptom was foot deformity (pes cavus or pes varus); gait instability was reported in 2 other individuals. Subsequently, distal lower limb weakness and atrophy were observed, and finally, the hands were affected. Despite the large clinical variability, the disease progression was very slow and independent gait was maintained even late in life. There was no cognitive, pyramidal, or sensory impairment. EMG showed chronic denervation, muscle biopsy showed a neurogenic pattern, and sural nerve biopsy was normal.

VARIANTS

NM_000052.6(ATP7A):c.3915_3921delCTCCCCA ; c.3257_3258del ; NM_000052.6(ATP7A):c.1974_1977dupGTTT ; NM_000052.6(ATP7A):c.1639C>T ; c.3294+2T>G ; NM_000052.6(ATP7A):c.3911A>G ; NM_000052.6(ATP7A):c.2938C>T

GENE

BTK

DISEASES
Short stature due to isolated growth hormone deficiency with X-linked hypogammaglobulinemia
SUMMARY

IGHD3 is characterized by agammaglobulinemia and markedly reduced numbers of B cells, short stature, delayed bone age, and good response to treatment with growth hormone.

CLINICAL DESCRIPTION

X-linked agammaglobulinemia is an immunodeficiency characterized by failure to produce mature B lymphocytes and associated with a failure of Ig heavy chain rearrangement. The defect in this disorder resides in BTK, also known as BPK or ATK, a key regulator in B-cell development. The X-linked form accounts for approximately 85 to 90% of cases of the disorder.

VARIANTS

NM_000061.2(BTK):c.763C>T ; NM_000061.2(BTK):c.1766A>G ; NM_000061.2(BTK):c.919A>G ; NM_000061.2(BTK):c.1906G>T ; NM_000061.2(BTK):c.718G>T ; NM_000061.2(BTK):c.755G>A ; NM_000061.2(BTK):c.862C>T ; NM_000061.2(BTK):c.1559G>A ; NM_000061.2(BTK):c.1516T>C ; NM_000061.2(BTK):c.1082A>G ; NM_000061.2(BTK):c.1838G>A ; NM_000061.2(BTK):c.1773C>A ; NM_000061.2(BTK):c.1125T>G ; NM_000061.2(BTK):c.1288A>G ; NM_000061.2(BTK):c.338T>A ; NM_000061.2(BTK):c.1889T>A ; NM_000061.2(BTK):c.1558C>T ; NM_000061.2(BTK):c.1001A>C ; NM_000061.2(BTK):c.1820C>A ; NM_000061.2(BTK):c.1506C>A ; NM_000061.2(BTK):c.1275C>A ; NM_000061.2(BTK):c.1223T>C

GENE

CFTR

DISEASES
Cystic fibrosis
SUMMARY

A rare, genetic pulmonary disorder characterized by sweat, thick mucus secretions causing multisystem disease, chronic infections of the lungs, bulky diarrhea and short stature.

CLINICAL DESCRIPTION

CF is chronic and usually progressive. Symptoms often start at birth and involve the lungs and gastrointestinal tract. A common presentation might include thick secretions and chronic infections in the lung, bulky diarrhea and short stature. Abnormal airway secretions, inflammation and infections lead to bronchiectasis and early death. CF-related diabetes (CFRD) occurs at high frequency, rising to nearly 50% of patients surviving to age 50. Male sterility is common. Individuals with mild phenotypes may have mild or absent respiratory symptoms in childhood, but some may have infertility or may develop bronchiectasis or pancreatitis later in life. These individuals are typically diagnosed by newborn screening, but may be diagnosed later in life.

Aquagenic palmoplantar keratoderma
SUMMARY

A rare skin disease characterized by transient wrinkling of the skin, edema, formation of whitish papules, pruritus, burning sensation, or pain, on the palms and/or soles in response to contact with water. Duration of exposure and water temperature affect the rate of development and intensity of the lesions. The condition is more common in females than in males and frequently occurs in patients with cystic fibrosis.

CLINICAL DESCRIPTION

Congenital bilateral absence of vas deferens
SUMMARY

Congenital bilateral absence of the vas deferens (CBAVD) is a condition leading to male infertility.

CLINICAL DESCRIPTION

Infertile patients with CBAVD produce small volumes of acidic sperm (<1 ml with a pH<7.0).

Hereditary chronic pancreatitis
SUMMARY

A rare gastroenterologic disease characterized by recurrent acute pancreatitis and/or chronic pancreatitis in at least 2 first-degree relatives, or 3 or more second-degree relatives in 2 or more generations, for which no predisposing factors are identified. This rare inherited form of pancreatitis leads to irreversible damage to both exocrine and endocrine components of the pancreas.

CLINICAL DESCRIPTION

Onset of HCP is typically early in life, during childhood and adolescence. The clinical presentation is highly variable and includes chronic or intermittent mild to severe abdominal pain associated with exocrine pancreatic insufficiency, leading to maldigestion and/or pancreatic endocrine insufficiency (glucose intolerance progressing to diabetes mellitus type 3c) in some cases. The disease is slowly progressive. The risk of developing pancreatic carcinoma after the age of 50 is elevated in patients with HCP. However, the exact risk increase is difficult to assess.

Idiopathic bronchiectasis
SUMMARY

Idiopathic bronchiectasis(IB) is a progressive lung disease characterized by chronic dilation of the bronchi and destruction of the bronchial walls in the absence of any underlying cause (such as post infectious disease, aspiration, immunodeficiency, congenital abnormalities and ciliary anomalies).

CLINICAL DESCRIPTION

Male infertility with azoospermia or oligozoospermia due to single gene mutation
SUMMARY

Male infertility with azoospermia or oligospermia due to single gene mutation is a rare, genetic male infertility due to sperm disorder characterized by the absence of a measurable amount of spermatozoa in the ejaculate (azoospermia), or a number of sperm in the ejaculate inferior to 15 million/mL (oligozoospermia), resulting from a mutation in a single gene known to cause azoo- or oligo-spermia. Sperm morphology may be normal.

CLINICAL DESCRIPTION

Congenital bilateral aplasia of the vas deferens (CBAVD), which leads to male infertility, may occur in isolation or as a manifestation of cystic fibrosis. It has been found that males with cystic fibrosis are infertile because of failure of normal development of the vas deferens. Others concluded that the changes in the transport ducts of the male genital system are responsible for infertility and are not a developmental anomaly but a degenerative change due to obstruction similar to that which occurs in the pancreas and salivary glands in cystic fibrosis. 

VARIANTS

NM_000492.3(CFTR):c.571T>G (p.Phe191Val) ; NM_000492.3(CFTR):c.592G>A (p.Ala198Thr) ; NM_000492.3(CFTR):c.1046C>T (p.Ala349Val) ; NM_000492.3(CFTR):c.1399C>T (p.Leu467Phe) ; NM_000492.3(CFTR):c.1684G>C (p.Val562Leu) ; NM_000492.3(CFTR):c.2249C>T (p.Pro750Leu) ; NM_000492.3(CFTR):c.2855T>C (p.Met952Thr) ; NM_000492.3(CFTR):c.2939T>A (p.Ile980Lys) ; NM_000492.3(CFTR):c.4056G>T (p.Gln1352His) ; NM_000492.3(CFTR):c.328G>T (p.Asp110Tyr) ; NM_000492.3(CFTR):c.445G>T (p.Gly149Ter) ; NM_000492.3(CFTR):c.1438G>T (p.Gly480Cys) ; NM_000492.3(CFTR):c.3067_3072delATAGTG (p.Ile1023_Val1024del) ; NM_000492.3(CFTR):c.3536_3539delCCAA (p.Thr1179Asnfs) ; NM_000492.3(CFTR):c.445G>A (p.Gly149Arg) ; NM_000492.4:c.115C>T ; NM_000492.4:c.178G>T ; NM_000492.4:c.200C>T ; NM_000492.4:c.223C>T ; NM_000492.4:c.254G>A ; NM_000492.4:c.262_263delTT ; NM_000492.4:c.273+1G>A ; NM_000492.4:c.274-1G>A ; NM_000492.4:c.274G>A ; NM_000492.4:c.274G>T ; NM_000492.4:c.292C>T ; NM_000492.4:c.328G>C ; NM_000492.4:c.349C>T ; NM_000492.4:c.366T>A ; NM_000492.4:c.442delA ; NM_000492.4:c.489+1G>T ; NM_000492.4:c.531delT ; NM_000048.4:c.532G>A ; NM_000492.4:c.577G>T ; NM_000492.4:c.579+1G>T ; NM_000492.4:c.579+3A>G ; NM_000492.4:c.579+5G>A ; NM_000492.4:c.595C>T ; NM_000492.4:c.613C>T ; NM_000492.4:c.617T>G ; NM_000492.4:c.658C>T ; c.708del ; NM_000492.4:c.720_741delAGGGAGAATGATGATGAAGTAC ; NM_000492.4:c.803delA ; NC_000007.14:g.117540159_117540161TCT[2] ; NM_000492.4:c.988G>T ; NM_000492.4:c.1000C>T ; NM_000492.4:c.1007T>A ; NM_000492.4:c.1013C>T ; NM_000492.4:c.1021_1022dupTC ; NM_000492.4:c.1021T>C ; NM_000492.4:c.1040G>A ; NM_000492.4:c.1040G>C ; NM_000492.4:c.1055G>A ; NM_000492.4:c.1081delT ; NM_000492.3(CFTR):c.1297_1303delTTCTCAC (p.Ser434Leufs) ; NM_000492.4:c.1327_1330dupGATA ; NM_000492.4:c.1340delA ; NM_000492.4:c.1364C>A ; NM_000492.4:c.1393-1G>A ; NM_000492.4:c.1397C>A ; NM_000492.4:c.1397C>G ; NM_000492.4:c.1400T>C ; NM_000492.4:c.1466C>A ; NM_000492.4:c.1475C>T ; NM_000492.4:c.1477C>T ; NM_000492.4:c.1519_1521delATC ; NM_000492.4:c.1521_1523delCTT ; NM_000492.4:c.1545_1546delTA ; NM_000492.4:c.1585-1G>A ; NM_000492.4:c.1624G>T ; NM_000492.4:c.1692delA ; NM_000492.3(CFTR):c.1706A>G (p.Tyr569Cys) ; NM_000492.4:c.1721C>A ; NM_000492.4:c.1766+1G>A ; NM_000492.3:c.1970delG ; NM_000492.4:c.2012delT ; NM_000492.4:c.2052dupA ; NM_000492.4:c.2052delA ; NM_000492.4:c.2125C>T ; NM_000492.4:c.2128A>T ; NM_000492.4:c.2175dupA ; NM_000492.4:c.2195T>G ; NM_000492.4:c.2215delG ; NM_000492.4:c.2537G>A ; NM_000492.3(CFTR):c.2538G>A (p.Trp846Ter) ; NM_000492.4:c.2551C>T ; NM_000492.4:c.2583delT ; NM_000492.4:c.2657+5G>A ; NM_000492.4:c.2668C>T ; NM_000492.4:c.2737_2738insG ; NM_000492.4:c.2739T>A ; NM_000492.4:c.2780T>C ; NM_000492.4:c.2834C>T ; NM_000492.3:c.2869_2870insG ; NM_000492.4:c.2875delG ; NM_000492.4:c.2908G>C ; NM_000492.4:c.2989-1G>A ; NM_000492.4:c.3140-26A>G ; NM_000492.4:c.3194T>C ; NM_000492.4:c.3196C>T ; NM_000492.4:c.3197G>A ; NM_000492.4:c.3230T>C ; NM_000492.4:c.3266G>A ; NM_000492.4:c.3276C>A ; NM_000492.4:c.3276C>G ; NM_000492.4:c.3302T>A ; NM_000492.4:c.3310G>T ; NM_000492.4:c.3528delC ; NM_000492.4:c.3587C>G ; NM_000492.4:c.3611G>A ; NM_000492.4:c.3612G>A ; NM_000492.4:c.3659delC ; NM_000492.4:c.3731G>A ; NM_000492.4:c.3744delA ; NM_000492.4:c.3752G>A ; NM_000492.4:c.3761T>G ; NM_000492.4:c.3764C>A ; NM_000492.4:c.3773dupT ; NM_000492.4:c.3846G>A ; NM_000492.4:c.3909C>G ; NM_000492.4:c.3937C>T ; NM_000492.4:c.4251delA ; NM_000492.3(CFTR):c.4426C>T (p.Gln1476Ter) ; NM_000492.4:c.2175dupA ; NM_000492.4:c.2175dupA ; NM_000492.4:c.4077_4080delTGTTinsAA

GENE

DKC1

DISEASES
Dyskeratosis congenita
SUMMARY

A rare ectodermal dysplasia syndrome that often presents with the classic triad of nail dysplasia, skin pigmentary changes, and oral leukoplakia associated with a high risk of bone marrow failure (BMF) and cancer.

CLINICAL DESCRIPTION

DC has a wide phenotypic spectrum and age onset. It classically manifests during childhood with the triad of dysplastic nails, lacy reticular pigmentation and atrophy of the skin at the level of the neck and upper chest, and oral leukoplakia. Patients are at high risk of progressive BMF and may develop myelodysplastic syndrome or acute myelogenous leukemia at any age (the risk increasing with age). There is also an increased risk for solid tumors, typically squamous cell carcinoma of head and neck or anogenital cancer. Additional clinical findings have been reported and may include: developmental delay, short stature, microcephaly, blepharitis, epiphora, periodontal disease, taurodontism, decreased teeth/root ratio, esophageal stenosis, urethral stenosis, osteoporosis, avascular necrosis of femur and/or humerus, premature hair greying/alopecia, or abnormal eyelashes. Individuals with Patients with DC may also develop pulmonary fibrosis, pulmonary arteriovenous malformations, gastrointestinal telangiectasias, and liver disease. It is important to note that the clinical features of DC progress over time and that all features, including the mucocutaneous triad, may not be present.

Hoyeraal-Hreidarsson syndrome
SUMMARY

An X-linked syndromic intellectual disability considered to be a severe variant of dyskeratosis congenita characterized by intrauterine growth retardation, microcephaly, cerebellar hypoplasia, progressive combined immune deficiency and aplastic anemia.

CLINICAL DESCRIPTION

The disease generally presents in early childhood and primarily affects males. Growth retardation is usually of prenatal onset. Other clinical manifestations include microcephaly, mucocutaneous lesions (hyperpigmentation, nail dystrophy, premalignant leukoplakia affecting oral and gastrointestinal mucosa), early onset bone marrow failure, immunodeficiency and pancytopenia. Cancer predisposition is also reported.

VARIANTS

NM_001363.4(DKC1):c.91C>A ; NM_001363.4(DKC1):c.204C>A ; NM_001363.4(DKC1):c.91C>G ; NM_001363.4(DKC1):c.196A>G ; NM_001363.4(DKC1):c.200C>T ; NM_001363.4(DKC1):c.194G>C ; NM_001363.4(DKC1):c.214_215delCTinsTA

GENE

DMD

DISEASES
Becker muscular dystrophy
SUMMARY

A rare, genetic muscular dystrophy characterized by progressive muscle wasting and weakness due to degeneration of skeletal, smooth and cardiac muscle.

CLINICAL DESCRIPTION

Onset is usually in childhood, typically after 7 years of age, but can be later. Presenting features in children include toe walking gait and or exercise-related cramps with or without myoglobinuria. Some patients may present following anesthetic induced acute rhabdomyolysis. In older patients, cardiomyopathy may be the presenting feature. As the condition progresses, muscle weakness leads to functional difficulties (difficulty climbing stairs or rising from a chair). Rarely, cardiomyopathy may be the presenting feature. Clinical examination reveals muscle pseudohypertrophy of the calf muscles and there may be atrophy of more proximal muscles such as the quadriceps. There is symmetrical and proximal muscle weakness, with the lower limbs being more severely affected than the upper limbs. There may be joint contractures, especially of the tendo- Achilles. The facial, ophthalmic and bulbar muscles are not involved. The condition is slowly progressive and about 40% of affected patients will eventually become wheelchair-dependent. In wheelchair dependent patients, restrictive respiratory insufficiency occurs due to weakness of the intercostal muscles and diaphragm. Cardiac involvement leads to dilated cardiomyopathy, which can be disproportionate to skeletal muscle involvement.

Duchenne muscular dystrophy
SUMMARY

A rare, genetic, muscular dystrophy characterized by rapidly progressive muscle weakness and wasting due to degeneration of skeletal, smooth and cardiac muscle.

CLINICAL DESCRIPTION

Onset occurs in early childhood, and affected boys may show a delay in walking (after 18 months of age) accompanied with speech and/or global developmental delay. Autism and behavioral problems, such as ADHD (attention deficit hyperactivity disorder), anxiety, obsessive compulsive disorder, are relatively common. Untreated children with DMD rarely achieve the ability to run or jump. The condition progresses rapidly and the child develops a waddling gait and a positive Gowers' sign. Climbing stairs becomes difficult and the child falls frequently. Loss of independent ambulation occurs between the ages of 6 and 13 years, the average being 9.5 years in non-steroid treated patients. Once ambulation is lost, joint contractures and scoliosis develop rapidly. Untreated patients die during late teens to early twenties from respiratory failure and or cardiomyopathy

Familial isolated dilated cardiomyopathy
SUMMARY

A rare familial cardiomyopathy characterized by the dilation of left ventricle and progressively impairing of systolic ventricular function, in the absence of abnormal loading conditions or coronary artery disease sufficient to cause global systolic impairment. The disease may cause heart failure or arrhythmia. The disease is isolated when no additional atypical cardiac or extracardiac manifestations are present.

CLINICAL DESCRIPTION

The disease is defined by the presence of two major clinical criteria: left ventricular (LV) fractional shortening less than 25% and/or LV ejection fraction less than 45% with LV end diastolic diameter greater than 117% of the predicted value (corrected for age and body surface area based on Henry's formula), in the absence of abnormal loading conditions or coronary artery disease sufficient to cause global systolic impairment. The disease can develop at any age, in either sex. LV mass is often greatly increased in this disorder but LV wall thickness is normal. Symptoms of heart failure may be present as well as arrhythmias. Other presentations include the incidental detection of asymptomatic cardiomegaly and symptoms related to coexisting conduction disturbance or thromboembolic complications. Typically, there is a history of DCM in the family.

Symptomatic form of muscular dystrophy of Duchenne and Becker in female carriers
SUMMARY

A rare, genetic muscular dystrophy affecting female carriers and characterized by variable degrees of muscle weakness due to progressive skeletal myopathy, sometimes associated with dilated cardiomyopathy or left ventricle dilation.

CLINICAL DESCRIPTION

Symptomatic female carriers usually present later than males with DMD or BMD. The muscle weakness is generally less severe than in affected males and is usually proximal and, unlike males, has an asymmetric distribution. The upper limbs may be weaker than the lower limbs. Myalgia and cramps have also been reported. The serum creatine kinase level is raised. Some patients may present with cardiac manifestations alone.

X-linked non-syndromic intellectual disability
SUMMARY

MECP2 duplication syndrome is an X-linked neurodevelopmental disorder characterized by severe to profound mental retardation, infantile hypotonia, mild dysmorphic features, poor speech development, autistic features, seizures, progressive spasticity, and recurrent infections. Only males are affected, although female carriers may have some mild neuropsychiatric features, such as anxiety. Submicroscopic Xq28 duplications encompassing MECP2 are considered nonrecurrent events, because the breakpoint locations and rearrangement sizes vary among affected individuals.

CLINICAL DESCRIPTION

VARIANTS

c.3087G>A ; g.26102-57302794 ; NM_004006.2(DMD):c.8608C>T ; NM_004006.2(DMD):c.2804-1G>A ; NM_004006.2(DMD):c.8069T>G ; g.31645986-31773985 ; c.1664G>A ; NM_004006.2(DMD):c.4471_4472delAA ; NM_004006.2(DMD):c.5899C>T ; c.3076G>T ; NM_004006.2(DMD):c.9337C>T ; NM_004006.2(DMD):c.3432+3A>G ; NM_004006.2(DMD):c.4806A>T ; NM_004006.2(DMD):c.9361+1G>A ; c.171G>A ; NM_004006.2(DMD):c.2816T>A ; NM_004006.2(DMD):c.627delA ; NM_004006.2(DMD):c.10033C>T ; c.2380+2T>C ; NM_004006.2(DMD):c.2804-2A>T ; c.6936del ; NM_004006.2(DMD):c.2547delT ; c.2758C>T ; NM_004006.2(DMD):c.6000T>A ; c.220del ; g.32557406-32754551 ; c.1900_1903dup ; c.1734del ; NM_004006.2(DMD):c.1286C>A ; NM_004006.2(DMD):c.676_678delAAG ; NM_004006.2(DMD):c.3295C>T ; NM_004006.2(DMD):c.2125delC ; g.31540244-32059446 ; NM_004006.2(DMD):c.6986dupA ; NM_004006.2(DMD):c.8443C>T ; c.2803+1G>A ; c.2587del ; g.32341945-32596022 ; NM_004006.2(DMD):c.3432+1G>A ; c.2266_2267del ; c.2866C>T ; NM_004006.2(DMD):c.6238delC ; NM_004006.2(DMD):c.9650-2A>G ; g.31724913-31806626 ; NM_004006.2(DMD):c.9862G>T ; g.10679-36186635 ; NM_004006.2(DMD):c.8064_8065delTA ; NM_004006.2(DMD):c.1341_1342dupAG ; g.32203741-32353533 ; g.31744885-32562211 ; NM_004006.2(DMD):c.1012G>T ; c.3124A>T ; NM_004006.2(DMD):c.8652_8653delCT ; NM_004006.2(DMD):c.433C>T ; c.277C>T ; NM_004006.2:c.2169-3_2169-1delinsAA ; c.7764dup ; NM_004006.2(DMD):c.3276+1G>A ; g.32501716-32932295 ; g.31856886-32482971 ; NM_004006.2(DMD):c.10141C>T ; NM_004006.2(DMD):c.6906G>A ; NM_004006.2(DMD):c.1261C>T ; NM_004006.2(DMD):c.10086+1G>A ; NM_004006.2(DMD):c.10446_10447delCT ; NM_004006.2(DMD):c.2484T>G ; NM_004006.2(DMD):c.4375C>T ; g.251879-35885004 ; g.31745624-31876916 ; g.31121669-33339588 ; g.30093911-34060667 ; c.489G>A ; g.31180370-31206667 ; g.10679-52213731 ; c.4486del ; NM_004006.2(DMD):c.9164-1G>C ; NM_004006.2(DMD):c.9854_9863delTGAGACTGGA ; g.31632068-31954142 ; NM_004006.2(DMD):c.1371delG ; NM_004006.2(DMD):c.2281_2285delGAAAA ; c.5570_5571dup ; c.2929dup ; c.6964del ; NM_004006.2(DMD):c.6391_6392delCA ; c.1900A>T ; NM_004006.2(DMD):c.615T>A ; g.32631403-32907656 ; c.530+1del ; NM_004006.2(DMD):c.1048G>T ; NM_004006.2(DMD):c.2755A>T ; c.2479del ; NM_004006.2(DMD):c.3747delG ; NM_004006.2(DMD):c.2815_2816delTT ; c.4409_4412dup ; c.6943G>T ; c.977-1G>T ; NM_004006.2(DMD):c.6182delC ; NM_004006.2(DMD):c.4518+5G>A ; g.10701-49071220 ; g.251880-51643625 ; NM_004006.2(DMD):c.1529_1530delTC ; NM_004006.2(DMD):c.6373C>T ; g.32380341-32412502 ; NM_004006.2(DMD):c.2803+1G>T ; c.6340A>T ; NM_004006.2(DMD):c.5773G>T ; c.3697del ; g.32341945-32816915 ; c.6763-2A>G ; c.4735G>T ; c.5671A>T ; c.5807T>A ; g.31744863-31846787 ; g.31627435-31774446 ; g.31679229-31968838 ; NM_004006.2(DMD):c.1306dupG ; g.32697662-32699472 ; NM_004006.2(DMD):c.7682G>A ; c.4500del ; NM_004006.2(DMD):c.6392_6393insCA ; c.1159C>T ; NM_004006.2(DMD):c.137_138dupAT ; g.31444405-31806767 ; g.32452761-32645074 ; NM_004006.2(DMD):c.5530C>T ; NM_004006.2(DMD):c.6982A>T ; c.3022A>T ; c.2523del ; NM_004006.2(DMD):c.9568C>T ; g.31819658-31932544 ; NM_004006.2(DMD):c.583C>T ; c.8086del ; NM_004006.2(DMD):c.5363C>G ; g.31898812-32022323 ; NM_004006.2(DMD):c.4405C>T ; NM_004006.2(DMD):c.2332C>T ; NM_004006.2(DMD):c.4117C>T ; g.31679229-31932544 ; g.32662366-32758964 ; NM_004006.2(DMD):c.8656C>T ; NM_004006.2(DMD):c.2302C>T ; NM_004006.2(DMD):c.2380+1G>C ; c.6014_6017del ; c.204dup ; NM_004006.2(DMD):c.5353C>T ; NM_004006.2(DMD):c.6292C>T ; c.2137C>T ; NM_004006.2(DMD):c.2294_2297delCCAT ; c.5313dup ; c.199G>T ; g.32432957-32823439 ; g.32267823-32372572 ; NM_004006.2(DMD):c.3639dupA ; g.31147275-31173604 ; c.1193C>G ; c.6226G>T ; c.6834del ; g.13020141-143473520 ; NM_004006.2(DMD):c.10454delT ; g.31870708-32353592 ; NM_004006.2(DMD):c.8944C>T ; g.10701-53131191 ; NM_004006.2(DMD):c.7894C>T ; NM_004006.2(DMD):c.412_413delAA ; NM_004006.2(DMD):c.4843A>T ; NM_004006.2(DMD):c.1332-9A>G ; NM_004006.2(DMD):c.2650C>T ; NM_004006.2(DMD):c.8713C>T ; g.31874956-31932544 ; NM_004006.2(DMD):c.8374_8375delAA ; NM_004006.2(DMD):c.5554C>T ; NM_004006.2(DMD):c.7683G>A ; g.31518752-31636035 ; g.31609490-32699472 ; NM_004006.2(DMD):c.1070delC ; NM_004006.2(DMD):c.9361+1G>C ; g.31929292-31968838 ; g.32364355-32390415 ; NM_004006.2(DMD):c.133C>T ; g.32216645-32651039 ; NM_004006.2:c.3246_3247insTTTCTAAAAA ; NM_004006.2(DMD):c.1489C>T ; g.32275729-32353585 ; g.31695292-31840818 ; NM_004006.2(DMD):c.9564-1G>A ; NM_004006.2(DMD):c.3779_3785delCTTTGGAinsGG ; g.31773859-31932544 ; g.31627435-31932544 ; g.31836597-31932544 ; NM_004006.2(DMD):c.3121C>T ; NM_004006.2(DMD):c.5697delA ; NM_004006.2(DMD):c.7771G>T ; NM_004006.2(DMD):c.7922delA ; g.31640772-31665565 ; g.31431098-31525874 ; g.32411633-33020588 ; g.31121669-31134568 ; NM_004006.2(DMD):c.1886C>A ; g.31931923-31932544 ; g.31965009-31968838 ; g.33019769-33020588 ; NM_004006.2(DMD):c.5287C>T ; g.31189847-31945183 ; NM_004006.2(DMD):c.5640T>A ; g.31133877-31134568 ; g.32380341-32380904

GENE

EDA

DISEASES
NON RARE IN EUROPE: Hypodontia
SUMMARY

CLINICAL DESCRIPTION

Oligodontia
SUMMARY

Oligodontia is a rare developmental dental anomaly in humans characterized by the absence of six or more teeth.

CLINICAL DESCRIPTION

Clinical features of oligodontia include six or more missing teeth, lack of development of maxillary and mandibular alveolar bone height and reduced lower facial height. Variation in tooth morphology is also observed along with problems in tooth development, eruption and exfoliation.

X-linked hypohidrotic ectodermal dysplasia
SUMMARY

CLINICAL DESCRIPTION

Hypohidrotic, or anhidrotic, ectodermal dysplasia (HED/EDA) is characterized by a triad of signs comprising sparse hair (hypotrichosis), abnormal or missing teeth (anodontia or hypodontia), and inability to sweat (anhidrosis or hypohidrosis). Typical clinical manifestations also include dryness of the skin, eyes, airways, and mucous membranes presumably due to the defective development of several exocrine glands. Hypohidrotic ectodermal dysplasia can be associated with dysmorphic features (forehead bumps, rings under the eyes, everted nose, and prominent lips) and occasionally with absent nipples. Ectodermal dysplasia-1, due to mutation in the EDA gene, is the most frequent form of hypohidrotic ectodermal dysplasia.

X-linked Emery-Dreifuss muscular dystrophy
SUMMARY

A neuromuscular disease that is characterized by muscular weakness and atrophy, with early joint contractures and cardiomyopathy.

CLINICAL DESCRIPTION

The clinical triad is comprised of joint contractures of the Achilles, elbow and posterior neck tendons (beginning during early childhood and worsening to result in limited joint movement). It presents slowly progressive muscle weakness and atrophy (initially and generally with a humeroperoneal distribution but later becoming more diffuse). Cardiac anomalies (conduction defects, rhythm disturbances and dilated cardiomyopathy) that usually manifest at the turn of the 2nd to the 3rd decade of life and may lead to sudden death (sometimes the presenting feature of the disease) and ischemic accidents due to embolism. Disease course and severity vary between families and between patients from the same family.

VARIANTS

NM_001399.4(EDA):c.187G>A ; NM_001399.4(EDA):c.183C>G ; NM_001399.4(EDA):c.467G>A ; NM_001399.5(EDA):c.573_574insT ; NM_001399.4(EDA):c.463C>T ; NM_001399.4(EDA):c.466C>T ; NM_001399.4(EDA):c.671G>C ; NM_001399.4(EDA):c.826C>T ; NM_001399.4(EDA):c.1045G>A ; NM_001399.4(EDA):c.181T>C

GENE

EMD

DISEASES
SUMMARY

CLINICAL DESCRIPTION

VARIANTS

NM_000117.2(EMD):c.547C>A ; c.631_635del

GENE

F8

DISEASES
Mild hemophilia A
SUMMARY

Mild hemophilia A is a form of hemophilia A (see this term) characterized by a small deficiency of factor VIII leading to abnormal bleeding as a result of minor injuries, or following surgery or tooth extraction.

CLINICAL DESCRIPTION

The biological activity of factor VIII is between 5 and 40%. Spontaneous hemorrhages do not occur.

Moderately severe hemophilia A
SUMMARY

Moderately severe hemophilia A is a form of hemophilia A (see this term) characterized by factor VIII deficiency leading to abnormal bleeding as a result of minor injuries, or following surgery or tooth extraction.

CLINICAL DESCRIPTION

The biological activity of factor VIII is between 1% and 5%. Spontaneous hemorrhages are rare.

Severe hemophilia A
SUMMARY

Severe hemophilia A is a form of hemophilia A (see this term) characterized by a large deficiency of factor VIII leading to frequent spontaneous hemorrhage and abnormal bleeding as a result of minor injuries, or following surgery or tooth extraction.

CLINICAL DESCRIPTION

The biological activity of factor VIII is below 1%.

Symptomatic form of hemophilia A in female carriers
SUMMARY

Symptomatic hemophilia A in female carriers is a form of hemophilia A (see this term) that manifests in some women with mutations in the F8 gene (Xq28), encoding coagulation factor VIII.

CLINICAL DESCRIPTION

Symptoms include abnormal bleeding as a result of minor injuries, or following surgery or tooth extraction. Spontaneous hemorrhages may occur occasionally.

VARIANTS

NM_000132.3(F8):c.872A>G ; c.788-1G>C ; c.6130del ; c.3251C>G ; c.4339dup ; c.4382_4383del ; c.3152del ; c.1438_1439del ; c.6070dup ; NM_000132.3(F8):c.687_688delAG ; c.889del ; c.415C>T ; c.1941_1944del ; c.3833del ; c.985dup ; c.2373dup ; c.3053del ; c.4619del ; c.4935G>A ; c.446del ; c.355C>T ; NM_000132.3(F8):c.1630G>A ; c.3409_3410del ; c.4999del ; c.5243del ; c.1538-2A>T ; c.1165del ; c.4719_4729del ; c.4662_4663del ; c.3907_3911del ; c.3991_3992del ; c.1653T>G ; NM_000132.3(F8):c.6464_6465delAA ; c.63_64del ; c.4408G>T ; c.3385del ; c.3031A>T ; NM_000132.3(F8):c.5879G>T ; c.4035del ; NM_000132.3(F8):c.1293delG ; c.516del ; c.1904-1G>A ; c.6136dup ; c.3913C>T ; c.4474A>T ; c.616G>T ; c.4934G>A ; c.89del ; c.1990_1991del ; c.420T>A ; c.3735_3744delinsATTTCTTTTTCTTT ; c.3863dup ; c.4969C>T ; NM_000132.3(F8):c.404A>G ; c.5301C>A ; c.6089dup ; c.985del ; c.5348_5357del ; c.1357G>T ; c.5697del ; c.510del ; c.709C>T ; c.3624del ; c.3402del ; NM_000132.3(F8):c.943delG ; c.729del ; c.6120_6135del ; c.3607G>T ; c.566C>A ; c.4450del ; c.5964_5967dup ; c.3421C>T ; c.496-2A>G ; c.3417dup ; c.3298A>T ; c.4942C>T ; c.3982C>T ; c.4156C>T ; NM_000132.3(F8):c.907delG ; c.1996_1999dup ; c.560T>A ; NM_000132.3:c.770_771insCC ; c.628_635del ; c.6115+1G>A ; c.4006C>T ; c.169+1G>T ; NM_000132.3(F8):c.849delT ; c.3827C>G ; c.5343T>A ; c.392del ; c.3967C>T ; c.5254del ; c.120del ; c.1410_1413del ; c.173del ; c.2412_2421del ; c.4492del ; c.974_975del ; c.1925_1928del ; c.1675G>T ; c.6116-2A>G ; c.169+1G>A ; c.850G>T ; c.787+2T>C ; c.4895dup ; NM_000132.3(F8):c.986G>A ; c.4697_4701dup ; c.4430_4431del ; c.4926del ; c.3344del ; c.2409del ; c.3902del ; c.5220-1G>A ; c.3540del ; c.591G>A ; c.1338del ; c.3844A>T ; c.4658del ; NM_000132.3(F8):c.1952A>C ; c.519_523del ; c.6194G>A ; c.2404C>T ; NM_000132.3(F8):c.1988C>T ; c.4199del ; c.4549_4550del ; c.3964C>T ; c.1443+2T>C ; c.5689_5690del ; c.3500dup ; c.788-1G>A ; c.4339del ; c.1394C>G ; c.5010del ; c.4265_4266del ; c.3496A>T ; c.607del ; c.73del ; c.1336dup ; c.195C>A ; c.4922dup ; c.1189dup ; c.948_951del ; c.3631A>T ; c.525C>A ; c.935del ; c.1442_1443dup ; c.3565dup ; c.2058_2059del ; c.160_161del ; c.128dup ; c.4425_4426del ; c.5251A>T ; c.4841del ; c.4072C>T ; c.6078_6079del ; c.3651del ; c.3772del ; c.3302_3303del ; c.6250A>T ; c.4806del ; c.4094_4100del ; NM_000132.3(F8):c.6865C>T ; c.1A>G ; c.3371C>A ; c.3652del ; c.4687del ; c.4492_4496del ; c.4363C>T ; c.3203_3204del ; c.3493G>T ; c.1538-1G>T ; c.2384_2388del ; c.6099del ; c.4318del ; c.92del ; c.201_202dup ; c.335_336del ; c.2032A>T ; c.4694_4697del ; c.4814C>A ; c.2462_2463del ; NM_000132.3:c.3150_3151insTC ; c.4996C>T ; c.6084del ; c.1202G>A ; NM_000132.3(F8):c.3548_3549delAA ; c.3922G>T ; c.3736del ; c.5337del ; c.5675dup ; c.3860del ; c.4446dup ; c.2089_2090del ; c.452_462del ; c.4280del ; c.4345del ; c.4345G>T ; c.4542del ; c.4201C>T ; c.4242dup ; c.333del ; c.185C>G ; c.4460del ; NM_000132.3:c.514_515insTCAAGATA ; c.3300del ; c.871G>T ; NM_000132.3(F8):c.6263C>T ; c.482del ; NM_000132.3(F8):c.7031G>A ; c.4770T>A ; c.72del ; c.1175C>G ; c.1390G>T ; c.6253G>T ; c.3416_3417del ; NM_000132.3(F8):c.1596_1597insG ; c.796G>T ; c.3994_3997del ; c.5953del ; c.4519del ; c.472C>T ; c.2397del ; c.1203G>A ; c.465G>A ; c.5960_5961del ; c.1595G>A ; c.4895del ; c.5766C>A ; c.6116_6117del ; c.5696dup ; c.4561C>T ; c.4272del ; c.224del ; c.2419dup ; c.685_686del ; c.98G>A ; c.471G>A ; NM_000132.3(F8):c.4473C>A ; c.4712_4715del ; NM_000132.3(F8):c.1175C>A ; c.1560del ; NM_000132.3(F8):c.6016G>T ; c.4918G>T ; c.3490del ; c.1311del ; c.5923dup ; c.495+1G>A ; c.5914_5915del ; c.680G>A ; c.4987A>T ; c.6120T>A ; c.3984dup ; c.4483del ; c.4483G>T ; NM_000132.3:c.1440_1441insA ; c.4473C>G ; c.2338del ; c.4686del ; c.4103del ; NM_000132.3(F8):c.2029T>C ; c.1200_1201del ; c.4805_4806del ; c.1947_1950del ; c.4798A>T ; NM_000132.3(F8):c.6912_6916delAAATC ; NM_000132.3(F8):c.4858delC ; c.3224del ; NM_000132.3(F8):c.493C>T ; c.6273+1G>A ; NM_000132.3(F8):c.1214T>G ; c.4899del ; c.60del ; c.5227_5228del ; c.4241C>A ; c.5869C>T ; c.5752del ; c.788-1G>T ; c.96del ; c.2000del ; c.919del ; c.4423C>T ; c.4512del ; c.2360del ; NM_000132.3(F8):c.5719_5720insA ; c.1596G>A ; c.3505del ; c.5271del ; c.6115+2T>C ; c.583del ; c.695_698del ; c.4848del ; c.3887del ; c.3830del ; c.3168_3187del ; NM_000132.3(F8):c.1075_1078delAATG ; c.1996_1999del ; c.3710del ; NM_000132.3(F8):c.832G>A ; c.1331_1332del ; c.3766G>T ; c.514_515del ; c.3851_3852del ; c.1443+1G>A ; NM_000132.3(F8):c.1726G>T ; c.3756del ; NM_000132.3(F8):c.4293_4297delCTCTT ; c.355del ; c.334G>T ; c.4720del ; c.4543_4544delinsA ; c.2102_2106del ; c.4492_4493del ; NM_000132.3(F8):c.1078_1079delGA ; c.421G>T ; c.265+1G>T ; NM_000132.3(F8):c.6533G>A ; c.4672_4675del ; c.3255_3258del ; c.64_65del ; c.3289C>T ; NM_000132.3(F8):c.199_200delAA ; c.143+1G>A ; NM_000132.3(F8):c.822G>A ; c.788-2A>T

GENE

F9

DISEASES
Mild hemophilia B
SUMMARY

Mild hemophilia B is a form of hemophilia B (see this term) characterized by a small deficiency of factor IX leading to abnormal bleeding as a result of minor injuries, or following surgery or tooth extraction.

CLINICAL DESCRIPTION

The biological activity of factor IX is between 5 and 40%. Spontaneous hemorrhages do not occur.

Moderately severe hemophilia B
SUMMARY

Moderately severe hemophilia B is a form of hemophilia B (see this term) characterized by factor IX deficiency leading to abnormal bleeding as a result of minor injuries, or following surgery or tooth extraction.

CLINICAL DESCRIPTION

The biological activity of factor IX is between 1% and 5%. Spontaneous hemorrhages are rare.

Severe hemophilia B
SUMMARY

Severe hemophilia B is a form of hemophilia B (see this term) characterized by a large deficiency of factor IX leading to frequent spontaneous hemorrhage and abnormal bleeding as a result of minor injuries, or following surgery or tooth extraction.

CLINICAL DESCRIPTION

The biological activity of factor IX is below 1%.

Symptomatic form of hemophilia B in female carriers
SUMMARY

Symptomatic hemophilia B in female carriers is a form of hemophilia B (see this term) that manifests in some women with mutations in the F9 gene (Xq28), encoding coagulation factor IX.

CLINICAL DESCRIPTION

Symptoms include abnormal bleeding as a result of minor injuries, or following surgery or tooth extraction. Spontaneous hemorrhages may occur occasionally.

VARIANTS

NM_000133.3(F9):c.1031T>C ; NM_000133.3(F9):c.79G>A ; NM_000133.3(F9):c.52T>C ; NM_000133.3(F9):c.1136G>A ; NM_000133.3(F9):c.82T>C ; NM_000133.3(F9):c.1150C>T

GENE

GJB2

DISEASES
Autosomal dominant non-syndromic sensorineural deafness type DFNA
SUMMARY

Deafness is the most frequent form of sensorial deficit. In the vast majority of cases, the deafness is termed nonsyndromic or isolated and the hearing loss is the only clinical anomaly reported. In developed counties, 60-80% of cases of early-onset hearing loss are of genetic origin.

CLINICAL DESCRIPTION

The majority of cases presenting at birth concern perceptive deafness (with a neurosensory origin associated with the inner ear) rather than conductive deafness (anomalies in the amplification of sound waves between the middle ear - tympanum and auditory ossicles - and the outer ear). Autosomal dominant forms are characterised by very early onset and bilateral hearing loss with varying degrees of severity (ranging from mild to profound). No malformations of the inner ear can be detected by CT scan. Mutations in the PDS gene are responsible for 7% of cases of childhood deafness. In these cases, the deafness is marked by early-onset, usually bilateral (but sometimes asymmetric) hearing loss with autosomal recessive transmission. This form of deafness is always associated with malformations of the inner ear that can be detected by CT scan. In rare cases, thyroid gland disease may also be present. For the autosomal dominant forms of deafness, mutations in the COCH gene result in progressive postlingual deafness associated with severe attacks of vertigo and subjective tinnitus. This form of deafness should be distinguished from Meniere's disease (see this term). Autosomal dominant mutations in the WFS1 gene cause either a form of hearing loss affecting mainly low frequency sounds or deafness associated with optic atrophy.

Autosomal recessive non-syndromic sensorineural deafness type DFNB
SUMMARY

Deafness is the most frequent form of sensorial deficit. In the vast majority of cases, the deafness is termed nonsyndromic or isolated and the hearing loss is the only clinical anomaly reported. In developed counties, 60-80% of cases of early-onset hearing loss are of genetic origin.

CLINICAL DESCRIPTION

The majority of cases presenting at birth concern perceptive deafness (with a neurosensory origin associated with the inner ear) rather than conductive deafness (anomalies in the amplification of sound waves between the middle ear - tympanum and auditory ossicles - and the outer ear). Autosomal dominant forms are characterised by very early onset and bilateral hearing loss with varying degrees of severity (ranging from mild to profound). No malformations of the inner ear can be detected by CT scan. Mutations in the PDS gene are responsible for 7% of cases of childhood deafness. In these cases, the deafness is marked by early-onset, usually bilateral (but sometimes asymmetric) hearing loss with autosomal recessive transmission. This form of deafness is always associated with malformations of the inner ear that can be detected by CT scan. In rare cases, thyroid gland disease may also be present. For the autosomal dominant forms of deafness, mutations in the COCH gene result in progressive postlingual deafness associated with severe attacks of vertigo and subjective tinnitus. This form of deafness should be distinguished from Meniere's disease (see this term). Autosomal dominant mutations in the WFS1 gene cause either a form of hearing loss affecting mainly low frequency sounds or deafness associated with optic atrophy.

Keratoderma hereditarium mutilans
SUMMARY

Keratoderma hereditarium mutilans is a rare, diffuse, mutilating, hereditary palmoplantar keratoderma disorder characterized by severe, honeycomb-pattern palmoplantar keratosis and pseudoainhum of the digits leading to autoamputation, associated with mild to moderate congenital sensorineural hearing loss. Additional features include stellate keratosis on the extensor surfaces of the fingers, feet, elbows and knees. Alopecia, onychogryphosis, nail dystrophy or clubbing, spastic paraplegia and myopathy may also be associated.

CLINICAL DESCRIPTION

KID syndrome
SUMMARY

A rare congenital ectodermal disorder characterized by vascularizing keratitis, hyperkeratotic skin lesions and hearing loss.

CLINICAL DESCRIPTION

Patients usually present at birth with generalized erythema and ichthyosiform scaling. The skin manifestations are progressive with erythrokeratoderma characterized by well-demarcated erythematous and keratotic plaques with a verrucous appearance predominantly located on the face, scalp, ears, elbows and knees. Other skin changes include deep furrows around the mouth, palmoplantar hyperkeratosis (PPHK) with leather grain-like keratoderma, follicular HK on the trunk, and spiky HK (hystrix-like ichthyosis) in some cases. The skin lesions are prone to infection and rare fatal cases of severe recurrent infections with septicemia have been reported. Nail dystrophy, alopecia, and sparse or absent eyebrows and eyelashes are also frequent. KID/HID patients have an increased susceptibility for squamous cell and tongue carcinomas. Hearing loss is congenital, usually sensorineural and is often profound. Ocular findings may be absent in some patients but when present onset usually occurs during childhood or adolescence with photophobia, punctate keratitis and progressive corneal vascularization leading to vision loss. The combined vision and hearing loss may lead to severe developmental delay. Cerebellar and neuromuscular defects have been reported in a few cases.

Knuckle pads-leukonychia-sensorineural deafness-palmoplantar hyperkeratosis syndrome
SUMMARY

Bart-Pumphrey syndrome (BAPS) is an autosomal dominant disorder characterized by sensorineural hearing loss, palmoplantar keratoderma, knuckle pads, and leukonychia, which show considerable phenotypic variability.

CLINICAL DESCRIPTION

A rare, syndromic genetic deafness disease characterized by symmetric or asymmetirc knuckle pads (typically located on the distal and interphalangeal joints), leukonychia, diffuse palmoplantar keratoderma, and congenital, mild to moderate sensorineural deafness.

Palmoplantar keratoderma-deafness syndrome
SUMMARY

Palmoplantar keratoderma-deafness syndrome is a keratinization disorder characterized by focal or diffuse palmoplantar keratoderma. A patchy distribution is observed with accentuation on the thenars, hypothenars and the arches of the feet. The disease becomes apparent in infancy and is associated with sensorineural hearing loss that shows a variable age of onset. Due to genetic and clinical similarities, it has been proposed that palmoplantar keratoderma-deafness syndrome, knuckle pads-leukonychia-sensorineural deafness-palmoplantar hyperkeratosis syndrome and keratoderma hereditarium mutilans may represent variants of one broad disorder of syndromic deafness with heterogeneous phenotype. The disease is transmitted in an autosomal dominant manner with incomplete penetrance.

CLINICAL DESCRIPTION

Porokeratotic eccrine ostial and dermal duct nevus
SUMMARY

CLINICAL DESCRIPTION

VARIANTS

NM_004004.5(GJB2):c.132G>A ; NM_004004.5(GJB2):c.416G>A ; NM_000151.4:c.229T>C ; c.516G>A ; NM_004004.5(GJB2):c.238C>T ; NM_004004.5(GJB2):c.269T>C ; NM_004004.5(GJB2):c.269dupT ; NM_004004.6:c.35delG ; c.402del ; c.310_323del ; NM_004004.5(GJB2):c.250G>C ; c.270dup ; NM_004004.6(GJB2):c.427C>T ; NM_004004.5(GJB2):c.313_326delAAGTTCATCAAGGG ; NM_004004.5(GJB2):c.334_335delAA ; NM_004004.5(GJB2):c.551G>C ; NM_004004.5(GJB2):c.235delC ; NM_004004.5(GJB2):c.365A>T ; NM_004004.5(GJB2):c.139G>T ; NM_004004.5(GJB2):c.299_300delAT ; NM_004004.5(GJB2):c.169C>T ; NM_004004.5(GJB2):c.550C>T ; NM_004004.5(GJB2):c.230G>A ; NM_004004.6(GJB2):c.299A>T ; NM_004004.5(GJB2):c.239A>C ; NM_004004.5(GJB2):c.617A>G ; NM_004004.5(GJB2):c.231G>A ; NM_004004.5(GJB2):c.358_360delGAG ; NM_004004.5(GJB2):c.250G>T ; NM_004004.6(GJB2):c.465T>A ; NM_004004.5(GJB2):c.176_191del16 ; NM_004004.6(GJB2):c.439G>A

GENE

HBA1 / HBA2

DISEASES
Alpha-thalassemia-intellectual disability syndrome linked to chromosome 16
SUMMARY

A rare developmental defect during embryogenesis, a contiguous gene deletion syndrome, is a form of alpha-thalassemia characterized by microcytosis, hypochromia, normal hemoglobin (Hb) level or mild anemia, associated with developmental abnormalities.

CLINICAL DESCRIPTION

ATR-16 is a congenital disease. Patients present with either alpha-thalassemia trait or mild hemoglobin H disease (HbH disease) associated with a mild to profound (in most cases) intellectual disability and, in some cases, with mild, nonspecific dysmorphic features (mild hypertelorism, down slanted palpebral fissures, broad or prominent nasal bridge, small ears, short neck), microcephaly and short stature. Genital abnormalities (hypospadias and cryptorchidism) have been reported in males. Club foot is common.

SUMMARY

A rare developmental defect during embryogenesis, a contiguous gene deletion syndrome, is a form of alpha-thalassemia characterized by microcytosis, hypochromia, normal hemoglobin (Hb) level or mild anemia, associated with developmental abnormalities.

CLINICAL DESCRIPTION

ATR-16 is a congenital disease. Patients present with either alpha-thalassemia trait or mild hemoglobin H disease (HbH disease) associated with a mild to profound (in most cases) intellectual disability and, in some cases, with mild, nonspecific dysmorphic features (mild hypertelorism, down slanted palpebral fissures, broad or prominent nasal bridge, small ears, short neck), microcephaly and short stature. Genital abnormalities (hypospadias and cryptorchidism) have been reported in males. Club foot is common.

Hb Bart's hydrops fetalis
Hemoglobin H disease
SUMMARY

An intermediate form of alpha-thalassemia characterized by increased hemolysis and mild to severe anemia with marked microcytosis and hypochromia. Hemoglobin H disease (HbH) disease belongs to the group of nontransfusion-dependent thalassemia.

CLINICAL DESCRIPTION

Clinical features are highly variable and generally develop in the first years of life. Initial signs may be noticed only during routine hematologic analyses. Patients have variable microcytic hypochromic hemolytic anemia, requiring no or occasional blood transfusions during infectious episodes, exposure to oxidizing agents or pregnancy. Splenomegaly is frequently found. Non-deletional forms of alpha-thalassemia typically have more severe anemia, splenomegaly, hepatomegaly, cholelithiasis, growth retardation, decreased bone density; and have earlier and more frequent transfusion requirements. Skeletal changes mainly affecting the face can rarely occur in non-deletional forms. Iron overload develops secondary to increased intestinal iron absorption even in the absence of transfusion.

SUMMARY

An intermediate form of alpha-thalassemia characterized by increased hemolysis and mild to severe anemia with marked microcytosis and hypochromia. Hemoglobin H disease (HbH) disease belongs to the group of nontransfusion-dependent thalassemia.

CLINICAL DESCRIPTION

Clinical features are highly variable and generally develop in the first years of life. Initial signs may be noticed only during routine hematologic analyses. Patients have variable microcytic hypochromic hemolytic anemia, requiring no or occasional blood transfusions during infectious episodes, exposure to oxidizing agents or pregnancy. Splenomegaly is frequently found. Non-deletional forms of alpha-thalassemia typically have more severe anemia, splenomegaly, hepatomegaly, cholelithiasis, growth retardation, decreased bone density; and have earlier and more frequent transfusion requirements. Skeletal changes mainly affecting the face can rarely occur in non-deletional forms. Iron overload develops secondary to increased intestinal iron absorption even in the absence of transfusion.

Hemoglobin M disease
SUMMARY

A rare hemoglobinopathy characterized by the presence of hemoglobin variants with structural abnormalities in the globin portion of the molecule which lead to auto-oxidation of heme iron, resulting in methemoglobinemia. Patients present with cyanosis for which no treatment is necessary. Mode of inheritance is autosomal dominant.

CLINICAL DESCRIPTION

Methemoglobinemia is a clinical condition in which more than 1% of hemoglobin is oxidized to methemoglobin, a type of hemoglobin that contains the ferric (Fe3+) form of iron. Patients with hemoglobin M are cyanotic but otherwise asymptomatic. If the mutation occurs in the hemoglobin alpha subunit, cyanosis is apparent at birth, whereas if the beta chain is affected, cyanosis appears later or intensifies when beta subunit production increases. If a newborn carries a fetal M hemoglobin (gamma subunit), cyanosis disappears when the complete gamma-beta-switch occurs.

SUMMARY

A rare hemoglobinopathy characterized by the presence of hemoglobin variants with structural abnormalities in the globin portion of the molecule which lead to auto-oxidation of heme iron, resulting in methemoglobinemia. Patients present with cyanosis for which no treatment is necessary. Mode of inheritance is autosomal dominant.

CLINICAL DESCRIPTION

Methemoglobinemia is a clinical condition in which more than 1% of hemoglobin is oxidized to methemoglobin, a type of hemoglobin that contains the ferric (Fe3+) form of iron. Patients with hemoglobin M are cyanotic but otherwise asymptomatic. If the mutation occurs in the hemoglobin alpha subunit, cyanosis is apparent at birth, whereas if the beta chain is affected, cyanosis appears later or intensifies when beta subunit production increases. If a newborn carries a fetal M hemoglobin (gamma subunit), cyanosis disappears when the complete gamma-beta-switch occurs.

VARIANTS

--MED ; --SEA ; --THAI ; - α3.7 ; - α4.2 ; - α20.5 ; --FIL

GENE

HBB

DISEASES
Beta-thalassemia intermedia
SUMMARY

Beta-thalassemia (BT) intermedia is a form of BT (see this term) characterized by mild to moderate anemia which does not or only occasionally requires transfusion.

CLINICAL DESCRIPTION

BT intermedia encompasses a wide clinical spectrum with more severe cases presenting between 2 and 6 years of age with anemia, spleen and sometimes liver enlargement, as well as delayed growth and development. In other cases, patients are completely asymptomatic until adult life with only mild anemia. Hypertrophy of erythroid marrow, with the possibility of extramedullary erythropoiesis, is common and leads to characteristic deformities of the bone and face, osteoporosis with pathologic fractures of long bones and formation of erythropoietic masses primarily affecting the spleen, liver, lymph nodes, chest and spine. Less commonly, erythroid marrow hypertrophy may cause neurological problems (spinal cord compression with paraplegia). Patients may also develop leg ulcers and gallstones. An increased predisposition to thrombosis versus BT major has been reported, especially after splenectomy. Although patients are at risk of iron overload, hypogonadism, hypothyroidism and diabetes are not common. Cardiac involvement may also occur as a result of a high-output state and pulmonary hypertension, while systolic left ventricle function is usually preserved.

Beta-thalassemia major
SUMMARY

Beta-thalassemia (BT) major is a severe early-onset form of BT (see this term) characterized by severe anemia requiring regular red blood cell transfusions.

CLINICAL DESCRIPTION

Onset is during infancy with severe anemia, failure to thrive and progressive pallor. Feeding problems, diarrhea, irritability, recurrent bouts of fever, and progressive enlargement of the abdomen caused by splenomegaly and hepatomegaly may occur. Untreated or poorly transfused patients show growth retardation, pallor, jaundice, poor musculature, genu valgum, leg ulcers, formation of masses due to extramedullary hematopoiesis, and skeletal changes including deformities in the long bones of the legs and typical craniofacial changes such as bossing of the skull, prominent malar eminence, depression of the bridge of the nose, tendency to a mongoloid slant of the eye, and maxillae hypertrophy, which tends to expose upper teeth. In regularly transfused patients, growth and development tend to be normal but complications related to iron overload may develop, including growth retardation and failure or delay of sexual maturation. Later-onset iron overload complications include dilated myocardiopathy, arrhythmias, liver fibrosis and cirrhosis, diabetes mellitus, and insufficiency of the parathyroid, thyroid, pituitary, and, less commonly, adrenal glands. Other complications are hypersplenism, venous thrombosis and osteoporosis.

Delta-beta-thalassemia
SUMMARY

Delta-beta-thalassemia is a form of beta-thalassemia (see this term) characterized by decreased or absent synthesis of the delta- and beta-globin chains with a compensatory increase in expression of fetal gamma-chain synthesis.

CLINICAL DESCRIPTION

The heterozygous form of the condition is clinically asymptomatic with mild microcytosis and no elevation of HbA2 whereas the few homozygous patients have a mild clinical presentation. When inherited with heterozygous classical beta-thalassemia, patients usually have the thalassemia intermedia phenotype, but the thalassemia major phenotype has been described in some cases.

Dominant beta-thalassemia
SUMMARY

Dominant beta-thalassemia is a form of beta-thalassemia (see this term) resulting in moderate to severe anemia.

CLINICAL DESCRIPTION

Patients present with moderate to severe anemia, jaundice and splenomegaly.

Hemoglobin C disease
SUMMARY

Hemoglobin C disease (HbC) is a hemoglobinopathy characterized by production of abnormal variant hemoglobin known as hemoglobin C, with no or mild clinical manifestations (hemolytic anemia).

CLINICAL DESCRIPTION

Hemoglobin C-beta-thalassemia syndrome
SUMMARY

Hemoglobin C - beta-thalassemia (HbC - BT) is a form of beta-thalassemia (see this term) resulting in moderate hemolytic anemia.

CLINICAL DESCRIPTION

Patients are usually asymptomatic and diagnosed during routine tests. When present, clinical manifestations are moderate anemia and splenomegaly.

Hemoglobin D disease
SUMMARY

Hemoglobin D disease(HbD) is a hemoglobinopathy characterized by production of abnormal variant hemoglobin known as hemoglobin D, with no or mild clinical manifestations (splenomegaly, very mild anemia).

CLINICAL DESCRIPTION

Hemoglobin E disease
SUMMARY

Hemoglobin E disease (HbE) is a hemoglobinopathy characterized by production of abnormal variant hemoglobin known as hemoglobin E, with a generally benign, asymptomatic presentation.

CLINICAL DESCRIPTION

Hemoglobin E-beta-thalassemia syndrome
SUMMARY

Hemoglobin E - beta-thalassemia (HbE - BT) is a form of beta-thalassemia (see this term) that results in a mild to severe clinical presentation ranging from a condition indistinguishable from beta-thalassemia major to a mild form of beta-thalassemia intermedia (see these terms).

CLINICAL DESCRIPTION

Mild HbE - BT (about 15% of cases) is characterized by normal Hb levels (9-12 g/dl) and patients usually do not develop clinically significant symptoms. No treatment is required. Moderately severe forms (most cases) are characterized by decreased Hb levels (6-8 g/dl) and the clinical manifestations are similar to those of beta-thalassemia intermedia. Transfusions are not required unless infections precipitate further anemia. Iron overload may occur. Severe forms are characterized by very low Hb levels (4-5 g/dl) and patients present with manifestations similar to beta-thalassemia major and are treated as thalassemia major patients.

Hemoglobin Lepore-beta-thalassemia syndrome
SUMMARY

A rare beta-thalassemia associated with another hemoglobin anomaly characterized by the presence of the hemoglobin Lepore variant in association with beta-thalassemia. Clinical presentation is highly variable, depending on the type of beta-thalassemia, and ranges from severe hypochromic microcytic anemia and complete transfusion dependency to moderate, compensated anemia without a need for regular blood transfusions.

CLINICAL DESCRIPTION

Delta-beta thalassemia is a hemoglobin disorder characterized by decreased or absent synthesis of the delta- and beta-globin chains with a compensatory increase in expression of fetal gamma-chain synthesis from the affected chromosome. Individuals with delta-beta thalassemia have hypochromic, microcytic anemia and increased HbF, which may mitigate the anemia depending on the level of HbF. Delta-beta thalassemia and some forms of HPFH result from deletions within the beta-globin gene cluster on chromosome 11p15; this has been referred to as 'deletional' HPFH. HPFH can also result from point mutations in the promoter regions of the gamma globulin genes HBG1 and HBG2; this has been referred to as 'non-deletional' HPFH.

Hemoglobin M disease
SUMMARY

A rare hemoglobinopathy characterized by the presence of hemoglobin variants with structural abnormalities in the globin portion of the molecule which lead to auto-oxidation of heme iron, resulting in methemoglobinemia. Patients present with cyanosis for which no treatment is necessary. Mode of inheritance is autosomal dominant.

CLINICAL DESCRIPTION

Methemoglobinemia is a clinical condition in which more than 1% of hemoglobin is oxidized to methemoglobin, a type of hemoglobin that contains the ferric (Fe3+) form of iron. Patients with hemoglobin M are cyanotic but otherwise asymptomatic. If the mutation occurs in the hemoglobin alpha subunit, cyanosis is apparent at birth, whereas if the beta chain is affected, cyanosis appears later or intensifies when beta subunit production increases. If a newborn carries a fetal M hemoglobin (gamma subunit), cyanosis disappears when the complete gamma-beta-switch occurs.

Hereditary persistence of fetal hemoglobin-beta-thalassemia syndrome
SUMMARY

Hereditary persistence of fetal hemoglobin (HPFH) associated with beta-thalassemia (see this term) is characterized by high hemoglobin (Hb) F levels and an increased number of fetal-Hb-containing-cells.

CLINICAL DESCRIPTION

The association of HPFH with beta-thalassemia mitigates the clinical manifestations which vary from a normal state to beta-thalassemia intermedia (see this term).

Hereditary persistence of fetal hemoglobin-sickle cell disease syndrome
SUMMARY

Sickle cell anemia is a multisystem disease associated with episodes of acute illness and progressive organ damage. Hemoglobin polymerization, leading to erythrocyte rigidity and vasoocclusion, is central to the pathophysiology of the disease, but the importance of chronic anemia, hemolysis, and vasculopathy has been established.

CLINICAL DESCRIPTION

A rare, genetic, hemoglobinopathy characterized by generally mild clinical phenotype, high fetal hemoglobin levels and mild microcytosis and hypochromia. In some cases, acute sickle cell disease manifestations were reported, namely acute chest syndrome and acute pain crisis. The genotype is characterized by the combination of an HbS and HbF allele; symptoms depend on the degree of HbF:HbS expressivity with patients with more than 35% pancellular HbF expression being asymptomatic. Symptomatic patients have heterocellular expression of HbF.

Sickle cell anemia
SUMMARY

A severe form of sickle cell disease (SCD) characterized by homozygosity for the sickle hemoglobin (HbS) gene and which acutely manifests with severe anemia, susceptibility to severe bacterial infections, and ischemic vasoocclusive accidents (VOA). It is a red cell disease of genetic origin which manifests with hemolytic disease and loss of red cell deformability leading to other occlusive events.

CLINICAL DESCRIPTION

The disease does not manifest during fetal life or up to the first three months of life due to the presence of high levels of fetal hemoglobin. Clinical manifestations evolve with age and are extremely variable between individuals and at different times. In addition to anemia and bacterial infections, VOAs cause hyperalgic focal ischemia (and sometimes infarction) when they occur in the abdomen, chest or skeleton. Over the course of time, VOAs may compromise the integrity of tissues or organs.

Sickle cell-beta-thalassemia disease syndrome
SUMMARY

Beta-thalassemia is characterized by a reduced production of hemoglobin A (HbA, alpha-2/beta-2), which results from the reduced synthesis of beta-globin chains relative to alpha-globin chains, thus causing an imbalance in globin chain production and hence abnormal erythropoiesis. The disorder is clinically heterogeneous

CLINICAL DESCRIPTION

A rare, genetic hemoglobinopathy that affects red blood cells both in the production of abnormal hemoglobin, as well as the decreased synthesis of beta globin chains. Clinical manifestations depend on the amount of residual beta globin chains production, and are similar to sickle cell disease, including anemia, vascular occlusion and its complications, acute episodes of pain, acute chest syndrome, pulmonary hypertension, sepsis, ischemic brain injury, splenic sequestration crisis and splenomegaly.

Sickle cell-hemoglobin C disease syndrome
SUMMARY

A rare, genetic hemoglobinopathy characterized by anemia, reticulocytosis and erythrocyte abnormalities including target cells, irreversibly sickled cells and crystal-containing cells. Clinical course is similar to sickle cell disease, but less severe and with less complications. Signs and symptoms may include acute episodes of pain, splenic infarction and splenic sequestration crisis, acute chest syndrome, focal segmental glomerulosclerosis, ischemic brain injury, peripheral retinopathy, and osteonecrosis.

CLINICAL DESCRIPTION

VARIANTS

NM_000518.5(HBB):c.217dup (p.Ser73Lysfs) ; NC_000011.10:g.5226765_5226768del ; NM_000518.5(HBB):c.92+5G>A ; NM_000518.5(HBB):c.85dup (p.Leu29Profs) ; NM_000518.5(HBB):c.82G>T (p.Ala28Ser) ; NM_000518.4(HBB):c.364G>A (p.Glu122Lys) ; NM_000518.5(HBB):c.315+1G>A ; NM_000518.4(HBB):c.135delC (p.Phe46Leufs) ; NM_000518.5(HBB):c.118C>T (p.Gln40Ter) ; NM_000518.4(HBB):c.112delT (p.Trp38Glyfs) ; NM_000518.5(HBB):c.93-21G>A ; NM_000518.5(HBB):c.92+6T>C ; NM_000518.5(HBB):c.92+5G>C ; NM_000518.5(HBB):c.92+1G>A ; NM_000518.5(HBB):c.79G>A (p.Glu27Lys) ; NM_000518.5(HBB):c.59A>G (p.Asn20Ser) ; NM_000518.5(HBB):c.52A>T (p.Lys18Ter) ; NM_000518.4(HBB):c.27dupG (p.Ser10Valfs*14) ; NM_000518.5(HBB):c.20A>T (p.Glu7Val) ; NM_000518.4(HBB):c.19G>A (p.Glu7Lys)

GENE

IDS

DISEASES
Mucopolysaccharidosis type 2, attenuated form
SUMMARY

Mucopolysaccharidosis type 2, attenuated form (MPS2att), the less severe form of MPS2 (see this term), leads to a massive accumulation of glycosaminoglycans and a wide variety of symptoms including distinctive facies, short stature, cardiorespiratory and skeletal findings. It is differentiated from mucopolysaccharidosis type 2, severe form (see this term) by the absence of cognitive decline.

CLINICAL DESCRIPTION

MPS2att is clinically heterogeneous and its rate of progression is highly variable. Patients appear healthy at birth, with subtle initial symptoms appearing between 18 months and 4 years of age or even later, in particular umbilical or inguinal hernia. A distinctive facies (thickening of lips and nostrils, enlarged and protruding tongue), forms slowly and may first be observed at 2-4 years of age (often not evident until late). Swelling of the upper respiratory tract may be responsible for frequent infections, in particular otitis media; excessive snoring and sleep apnea; a distinctive hoarse voice and progressive loss of hearing. During early childhood growth is stunted and patients have a short stature with dysostosis multiplex and stiff joints that may make movement painful, hip dysplasia may also occur. Phalangeal joints are universally contracted resulting in claw-like hands; carpal tunnel syndrome is common. Spastic paresis due to spinal cord compression at the cranio-cervical region may also occur. Pressure exerted on the optic nerve may lead to loss of vision and retinal degeneration has also been reported in some cases. MPS2att patients, in general, have no cognitive impairments.

Mucopolysaccharidosis type 2, severe form
SUMMARY

Mucopolysaccharidosis type 2 (MPS2, see this term), severe form (MPS2S), is associated with a massive accumulation of glycosaminoglycans and a wide variety of symptoms including a rapidly progressive cognitive decline; it is most often fatal in the second or third decade.

CLINICAL DESCRIPTION

MPS2S presents with the spectrum of symptoms observed in all MSP2 (see this term) cases, often with an earlier presentation. MPS2S patients have a decrease in growth rate in early to mid-childhood, along with respiratory difficulties and a thickening of lips and nostrils as well as an enlarged and protruding tongue (distinctive facies), which may become evident between 2-4 years of age. Psychomotor milestones are delayed, and regression often occurs. Between the ages of 2-6 years patients begin to exhibit aggressive behavior and hyperactivity, often lacking any sense of danger as they follow a course of progressive cognitive decline. Vision may be affected, and progressive hearing loss occurs in most cases. Myocardial thickening and cardiac valve dysfunction are common. Approximately 60-80 % of patients with MPS2 have the severe form of the disease with neurological implications.

VARIANTS

NM_000202.7(IDS):c.1505G>C ; c.278del ; NM_000202.7(IDS):c.317_318insTCAA ; NM_000202.6:c.388_389insG ; NM_000202.7(IDS):c.1122C>T ; NM_000202.7(IDS):c.597del ; NM_000202.7(IDS):c.208dupC ; NM_000202.7(IDS):c.1148delC ; NM_000202.7(IDS):c.514C>T ; NM_000202.7(IDS):c.690_691insT ; c.240+1G>A ; NM_000202.7(IDS):c.404A>G ; c.596_599del ; NM_000202.7(IDS):c.1508T>A ; NM_000202.7(IDS):c.998C>T ; NM_000202.7(IDS):c.587T>C

GENE

IL2RG

DISEASES
Omenn syndrome
SUMMARY

Omenn syndrome (OS) is an inflammatory condition characterized by erythroderma, desquamation, alopecia, chronic diarrhea, failure to thrive, lymphadenopathy, and hepatosplenomegaly, associated with severe combined immunodeficiency (SCID; see this term).

CLINICAL DESCRIPTION

OS presents during the first year of life with features of SCID including chronic diarrhea, pneumonitis and failure to thrive. In addition, patients present with inflammatory symptoms including lymphadenopathy, hepatosplenomegaly and generalized erythroderma, which may often cause alopecia and loss of eyebrows and eyelashes; protein loss may lead to generalized edema and metabolic disturbances. The signs and symptoms of OS can evolve over time and may not appear simultaneously. Some patients present with some but not all of these symptoms and may be described as having atypical Omenn syndrome. OS may also be associated with syndromic disorders including cartilage-hair hypoplasia (CHH), adenosine deaminase (ADA) deficiency, monosomy 22q11, coloboma of the eye, CHARGE syndrome and ligase 4 deficiency (see these terms).

T-B+ severe combined immunodeficiency due to gamma chain deficiency
SUMMARY

Severe combined immunodeficiency (SCID) due to gamma chain deficiency, also called SCID-X1, is a form of SCID (see this term) characterized by severe and recurrent infections, associated with diarrhea and failure to thrive.

CLINICAL DESCRIPTION

SCID-X1 manifests during the first months of life with severe and often life threatening viral, bacterial or fungal infections (e.g. Pneumocystis jiroveci pneumonitis, disseminated BCG infection if previously vaccinated), and failure to thrive. Chronic diarrhea is a frequent finding. Some patients may have skin rashes and abnormalities of liver function. Materno-fetal transfusion-associated graft versus host disease is also associated with the disease. Immunological findings are lymphopenia with the absence of T and NK cells, hypogammaglobulinemia, and normal or increased B cell count.

VARIANTS

NM_000206.2(IL2RG):c.341G>A ; NM_000206.2(IL2RG):c.355A>T ; NM_000206.2(IL2RG):c.452T>C ; NM_000206.2(IL2RG):c.854G>A ; NM_000206.2(IL2RG):c.664C>T ; NM_000206.2(IL2RG):c.454+1G>A ; NM_000206.2(IL2RG):c.343T>C ; NM_000206.2(IL2RG):c.186T>A

GENE

MECP2

DISEASES
Atypical Rett syndrome
SUMMARY

A rare genetic neurological disorder characterized by the presence of two or more of the main criteria for classic Rett syndrome (loss of acquired purposeful hand skills, loss of acquired spoken language, gait abnormalities, stereotypic hand movements), a period of regression followed by recovery or stabilization, and five out of eleven supportive criteria (breathing difficulties, bruxism, impaired sleep pattern, abnormal muscle tone, peripheral vasomotor disturbances, scoliosis/kyphosis, delayed growth, small cold hands and feet, inappropriate laughter or screaming spells, decreased pain sensation, and intense eye communication). Like classic Rett syndrome, it almost exclusively affects girls, while the disease course may be either milder or more severe.

CLINICAL DESCRIPTION

Atypical forms may present with either a milder or more severe clinical picture than that seen in typical RTT. Several subvariants of atypical RTT have been defined. i) The early-onset seizure type (Hanefeld variant) is characterized by seizures in the first months of life with subsequent development of RTT features. ii) The congenital variant (Rolando variant) is the most severe form of atypical RTT, with onset of classic RTT features during the first three months of life. iii) The 'forme fruste' is a milder variant with onset in early childhood and an incomplete and protracted course. iv) The late childhood regression form is characterized by a normal head circumference and by a more gradual and later onset (late childhood) regression of language and motor skills. v) The preserved speech variant (PSD or Zappella variant) is marked by recovery of some verbal and manual skills.

Autism
SUMMARY

CLINICAL DESCRIPTION

Autism, the prototypic pervasive developmental disorder (PDD), is usually apparent by 3 years of age. It is characterized by a triad of limited or absent verbal communication, a lack of reciprocal social interaction or responsiveness, and restricted, stereotypic, and ritualized patterns of interests and behavior. 'Autism spectrum disorder,' sometimes referred to as ASD, is a broader phenotype encompassing the less severe disorders Asperger syndrome and pervasive developmental disorder, not otherwise specified (PDD-NOS). 'Broad autism phenotype' includes individuals with some symptoms of autism, but who do not meet the full criteria for autism or other disorders. Mental retardation coexists in approximately two-thirds of individuals with ASD, except for Asperger syndrome, in which mental retardation is conspicuously absent. Genetic studies in autism often include family members with these less stringent diagnoses. 

Rett syndrome
SUMMARY

A rare severe, X-linked, neurodevelopmental disorder characterized by rapid developmental regression in infancy, partial or complete loss of purposeful hand movements, loss of speech, gait abnormalities, and stereotypic hand movements, commonly associated with deceleration of head growth, severe intellectual disability, seizures, and breathing abnormalities. The disorder has a progressive clinical course and may associate various comorbidities including gastrointestinal diseases, scoliosis, and behavioral disorders.

CLINICAL DESCRIPTION

Classic or typical Rett syndrome (RTT) primarily affects girls and is characterized by apparently normal psychomotor development during the first 6-18 months of life followed by developmental stagnation with rapid regression in language and motor abilities, and subsequent long-term plateauing of skills. Repetitive, stereotypic hand movements replace purposeful hand use. Additional findings include autistic features, panic-like attacks, bruxism, episodic apnea and/or hyperpnea, gait ataxia and apraxia, tremors, seizures (60-80%), and acquired microcephaly. There is a wide variability in the rate of disease progression and severity. A number of males with a phenotype comparable to females with classical RTT have been described.

Severe neonatal-onset encephalopathy with microcephaly
SUMMARY

Severe neonatal-onset encephalopathy with microcephaly is a rare monogenic disease with epilepsy characterized by neonatal-onset encephalopathy, microcephaly, severe developmental delay or absent development, breathing abnormalities (including central hypoventilation and/or respiratory insufficiency), intractable seizures, abnormal muscle tone and involuntary movements. Early death is usual.

CLINICAL DESCRIPTION

The MECP2 gene is mutated in Rett syndrome (RTT), a severe neurodevelopmental disorder that almost always occurs in females. Although it was first thought that MECP2 mutations causing Rett syndrome were lethal in males, later reports identified a severe neonatal encephalopathy in surviving male sibs of patients with Rett syndrome.

Systemic lupus erythematosus
SUMMARY

Systemic lupus erythematosus (SLE) is a complex autoimmune disease characterized by production of autoantibodies against nuclear, cytoplasmic, and cell surface molecules that transcend organ-specific boundaries. Tissue deposition of antibodies or immune complexes induces inflammation and subsequent injury of multiple organs and finally results in clinical manifestations of SLE, including glomerulonephritis, dermatitis, thrombosis, vasculitis, seizures, and arthritis.

CLINICAL DESCRIPTION

Trisomy Xq28
SUMMARY

Distal Xq duplications refer to chromosomal disorders resulting from involvement of the long arm of the X chromosome (Xq). Clinical manifestations vary widely depending on the gender of the patient and on the gene content of the duplicated segment. The prevalence of Xq duplications remains unknown.

CLINICAL DESCRIPTION

The most frequently reported distal duplications involve the Xq28 segment and yield a recognizable phenotype including distinctive facial features (premature closure of the fontanels or a ridged metopic suture, a broad face with full cheeks, epicanthal folds, large ears, a small and open mouth, ear anomalies, a pointed nose, an abnormal palate and facial hypotonia), major axial hypotonia, severe developmental delay, severe feeding difficulties, abnormal genitalia and susceptibility to infections.

X-linked intellectual disability-psychosis-macroorchidism syndrome
SUMMARY

An X-linked syndromic intellectual disability characterized by developmental delay, variable degree of intellectual disability, speech delay or absent speech, pyramidal signs, tremor, macroorchidism and variable mood and behavior problems, including psychosis and autistic-like behavior. Males are predominantly affected, some females show lower cognitive abilities.

CLINICAL DESCRIPTION

The MECP2 gene is mutated in Rett syndrome (RTT), a severe neurodevelopmental disorder that almost always occurs in females. Males with non-RTT mutations in the MECP2 gene can demonstrate a wide variety of phenotypes, including X-linked mental retardation with spasticity and other variable features, described here, and Lubs X-linked mental retardation syndrome (MRXSL). Males with RTT-associated MECP2 mutations have neonatal severe encephalopathy that is usually lethal (300673).

X-linked non-syndromic intellectual disability
SUMMARY

MECP2 duplication syndrome is an X-linked neurodevelopmental disorder characterized by severe to profound mental retardation, infantile hypotonia, mild dysmorphic features, poor speech development, autistic features, seizures, progressive spasticity, and recurrent infections. Only males are affected, although female carriers may have some mild neuropsychiatric features, such as anxiety. Submicroscopic Xq28 duplications encompassing MECP2 are considered nonrecurrent events, because the breakpoint locations and rearrangement sizes vary among affected individuals.

CLINICAL DESCRIPTION

VARIANTS

NM_004992.3(MECP2):c.964C>T ; NM_004992.3(MECP2):c.916C>T ; NM_004992.3(MECP2):c.215dupC ; NM_004992.3(MECP2):c.611C>G ; NM_004992.3(MECP2):c.502C>T ; NM_004992.3(MECP2):c.763C>T ; NM_004992.3(MECP2):c.730C>T ; NM_004992.3(MECP2):c.965C>T ; NM_004992.3(MECP2):c.674C>T ; NM_001110792.1(MECP2):c.916C>T ; NM_004992.3(MECP2):c.806delG ; NM_004992.3(MECP2):c.808C>T ; NM_004992.3(MECP2):c.753delC

GENE

MTM1

DISEASES
X-linked centronuclear myopathy
SUMMARY

A rare X-linked congenital myopathy characterized by numerous centrally placed nuclei on muscle biopsy and that presents at birth with marked weakness, hypotonia and respiratory failure.

CLINICAL DESCRIPTION

The disease is characterized by a severe phenotype in males presenting at birth with marked weakness, hypotonia and respiratory failure. Signs of antenatal onset are frequent and comprise reduced fetal movements and polyhydramnios. Thinning of the ribs is observed on chest radiographs of the newborn. Birth asphyxia may be the presenting feature. A family history of either male neonatal deaths or miscarriages is common. Affected infants are often macrosomic, with a body length above the 90th centile and large head circumference. External ophthalmoplegia is commonly associated. Testes are frequently undescended. Pyloric stenosis and cavernous hemangiomas of the liver have been reported in some long-term survivors.

X-linked myotubular myopathy-abnormal genitalia syndrome
SUMMARY

X-linked myotubular myopathy-abnormal genitalia syndrome is a rare chromosomal anomaly, partial deletion of the long arm of chromosome X, characterized by a combination of clinical manifestations of X-linked myotubular myopathy and a 46,XY disorder of sex development. Patients present with severe form of congenital myopathy and abnormal male genitalia.

CLINICAL DESCRIPTION

Facial diplegia and often external ophthalmoplegia are frequent. The newborn cases resemble those of congenital myotonic dystrophy; the distinction can be made by examination of their mother who in the latter situation will invariably show mild facial weakness and clinical or electrical myotonia. Polyhydramnios is a feature of both forms of congenital myopathy, i.e., myotonic dystrophy and X-linked myotubular myopathy. 

VARIANTS

NM_000252.2(MTM1):c.1261-10A>G ; NM_000252.2(MTM1):c.969del ; c.461T>G ; NM_000252.2(MTM1):c.70C>T ; c.780T>A ; NM_000252.2(MTM1):c.595_599delCCTGC ; NM_000252.2(MTM1):c.1306_1310dupCCTAT ; NM_000252.2(MTM1):c.670C>T ; NM_000252.2(MTM1):c.721C>T ; NM_000252.2(MTM1):c.969dup ; NM_000252.2(MTM1):c.1357_1358delCC ; NM_000252.2(MTM1):c.1415_1416delGT ; NM_000252.2(MTM1):c.420C>G

GENE

NR0B1

DISEASES
46,XX testicular disorder of sex development
SUMMARY

A rare disorder of sex development (DSD) associated with a 46, XX karyotype and characterized by male external genitalia, ranging from normal to atypical with associated testosterone deficiency.

CLINICAL DESCRIPTION

The clinical phenotype is variable, with features that include: normal male external to atypical genitalia, undescended testes with absent Müllerian structures and infertility. Presentation depends on the presence of the SRY gene (sex determining region of the Y chromosome). SRY positive cases (80-90%) are usually otherwise normal men who present after puberty with short stature, normal pubic hair and penile size but small testes, gynecomastia and azoospermia-related sterility. Undescended testes and hypospadias are also reported. There are usually no concerns about gender role and identity. SRY negative individuals (10-20%) usually present at birth with features such as penoscrotal hypospadias and undescended testes. Long-term complications due to male hypogonadism include: low libido, erectile dysfunction, decreased secondary sexual characteristics, osteopenia and depression.

46,XY complete gonadal dysgenesis
SUMMARY

A rare disorder of sex development (DSD) associated with anomalies in gonadal development that result in the presence of female external and internal genitalia despite the 46,XY karyotype.

CLINICAL DESCRIPTION

Patients present during adolescence or early adulthood with normal female external genitalia but lack pubertal development although adrenarche is normal. Completely undeveloped streak gonads are present and are associated with an increased risk of abdominal tumours (most commonly dysgerminoma; see this term), which may be the presenting feature in some cases. Stature is normal or above normal, and features of Turner syndrome (see this term) are absent.

46,XY partial gonadal dysgenesis
SUMMARY

46,XY partial gonadal dysgenesis (46,XY PGD) is a disorder of sex development (DSD) associated with anomalies in gonadal development that results in genital ambiguity of variable degree ranging from almost female phenotype to almost male phenotype in a patient carrying a male 46,XY karyotype.

CLINICAL DESCRIPTION

46,XY PGD is characterized by ambiguous external genitalia with or without Müllerian structures. The degree of genital ambiguity varies along a spectrum, ranging from an almost female phenotype with clitoromegaly at one extreme to an almost male phenotype with isolated hypospadias at the other. Many patients present ambiguous genitalia or severe micropenis associated with complete regression of testicular tissue in one or both sides. Embryonic Testicular regression syndrome (ETRS; see this term) is considered as part of the clinical spectrum of PGD. Depending on the mutation, patients can have adrenal insufficiency or renal involvement (i.e. Wilms tumors or nephrotic syndrome). Gonadoblastomas or invasive germ cell tumors occur in around 20-30% of patients.

X-linked adrenal hypoplasia congenita
SUMMARY

A rare genetic adrenal disease characterized by primary adrenal insufficiency (AI) and/or hypogonadotropic hypogonadism (HH). Male patients typically present with AI with acute onset in infancy or insidious onset in childhood. Clinical features of AI include hyperpigmentation, vomiting, poor feeding, failure to thrive, seizures, vascular collapse, and sometimes sudden death. HH manifests later as delayed or arrested puberty. In rare cases, patients become symptomatic in early adulthood with delayed-onset AI, partial HH, and/or infertility. Histologically, the adrenal glands lack the permanent adult cortical zone. The remaining cells are larger than fetal adrenal cells (''cytomegalic'') and contain characteristic nuclear inclusions.

CLINICAL DESCRIPTION

Congenital adrenal hypoplasia (AHC) is a rare disorder that can be inherited in an X-linked or autosomal recessive pattern. In X-linked AHC, primary adrenocortical failure occurs because the adrenal glands lack the permanent adult cortical zone. The remaining cells are termed 'cytomegalic' because they are larger than typical fetal adrenal cells. Patients with AHC usually present in early infancy with primary adrenal failure. Hypogonadotropic hypogonadism (HHG) is a hallmark of the disorder, and is recognized during adolescence because of the absence or interruption of normal pubertal development. Abnormal spermatogenesis has also been observed in these patients. Milder forms of the disease have been described, with adrenal insufficiency sometimes occurring in childhood or even early adulthood.

VARIANTS

NM_000475.4(NR0B1):c.788T>A ; NM_000475.4(NR0B1):c.704G>A ; NM_000475.4(NR0B1):c.591C>A ; NM_000475.4(NR0B1):c.847C>T ; NM_000475.4(NR0B1):c.513G>A ; NM_000475.4(NR0B1):c.873G>C ; c.388_389del ; NM_000475.4(NR0B1):c.813C>G ; NM_000475.4(NR0B1):c.1319A>T ; NM_000475.4(NR0B1):c.1316T>G ; NM_000475.4(NR0B1):c.800G>C ; NM_000475.4(NR0B1):c.1107G>A ; NM_000475.4(NR0B1):c.890T>C ; NM_000475.4(NR0B1):c.273C>A

GENE

OCRL

DISEASES
Dent disease type 2
SUMMARY

Dent disease type 2 is a type of Dent disease in which patients have the manifestations of Dent disease type 1 associated with extra-renal features.

CLINICAL DESCRIPTION

All of them had hypercalciuria and low-molecular-weight (LMW) proteinuria. In addition, these patients may also have nephrocalcinosis, nephrolithiasis, hematuria, hypophosphatemia and/or renal insufficiency. Only a minority (approximately one fourth) of these patients have been observed to have mild intellectual deficit, hypotonia and sub-clinical cataract. The presence of intellectual impairment and sub-clinical cataract were so mild as to dissuade the clinicians from considering a diagnosis of Lowe syndrome (see this term), which is characterized by congenital cataracts, delayed motor milestones, some degree of intellectual impairment in almost all affected males, growth retardation, rickets and renal proximal tubulopathy. Moreover, the patients with Dent disease type 2 and mild intellectual deficit were adults, who had not, over time, developed more overt features of Lowe syndrome.

Oculocerebrorenal syndrome of Lowe
SUMMARY

A rare multisystem disorder characterized by congenital cataracts, glaucoma, intellectual disabilities, seizures, postnatal growth retardation and renal tubular dysfunction with chronic renal failure.

CLINICAL DESCRIPTION

Oculocerebrorenal syndrome of Lowe (OCRL) is a congenital disorder characterized by ocular abnormalities (bilateral congenital discoid cataracts, glaucoma with or without buphthalmos, strabismus, hypermetropia and corneal and conjunctival cheloids), neurological involvement (developmental delay, seizures, hypotonia present at birth typically with absence of deep tendon reflexes), stereotypic behavior (temper tantrums, aggressiveness and obsessive compulsive behavior), postnatal growth retardation, mild to severe intellectual disability (mean IQ 40-50), stereotypic hand movements, renal dysfunction of the Fanconi type (proximal tubular acidosis; phosphate wasting leading to renal rickets, osteomalacia and pathological fractures) and progressive decline in kidney function leading to end-stage renal failure in adulthood. Subtle cataracts are obligate findings in female carriers after puberty. Other clinical manifestations include facial dysmorphism (frontal bossing, deep-set eyes, chubby cheeks, fair complexion), destructive teno-synovitis in older patients, short stature, mucocutaneous anomalies (eruptive vellus hair cysts, tricoepithiloma, excess skin folds and eruption cysts in oral cavity), dental malformations, cryptorchidism and bleeding tendency due to platelet dysfunction.

VARIANTS

NM_000276.3(OCRL):c.2530C>T ; NM_000276.3(OCRL):c.1499G>A ; c.2379dup ; c.2511del ; NM_000276.3(OCRL):c.909_910delAG ; NM_000276.3(OCRL):c.2299C>T

GENE

OTC

DISEASES
Ornithine transcarbamylase deficiency
SUMMARY

A rare, genetic disorder of urea cycle metabolism and ammonia detoxification characterized by either a severe, neonatal-onset disease found mainly in males, or later-onset (partial) forms of the disease. Both present with episodes of hyperammonemia that can be fatal and which can lead to neurological sequelae.

CLINICAL DESCRIPTION

Males with the severe, neonatal-onset type are normal at birth but develop poor sucking, hypotonia and lethargy after a few days, rapidly progressing into somnolence and coma. Seizures and hyperventilation may also be present. If untreated, severe encephalopathy will develop with a high risk for death. Patients with a milder form can present at any age. In infants, symptoms can be induced when switching from breast milk to whole milk. In children and adults, environmental stressors (i.e. fasting, high protein diet, pregnancy and the postpartum period, intercurrent illness, surgery) can trigger episodes of hyperammonemic encephalopathy along with nausea, vomiting, headaches, erratic behavior, delirium and combativeness. These episodes can also result in hyperammonemic coma. Neurological complications of hyperammonemic coma include developmental delay and, sometimes, severe cognitive impairment. Many female carriers are asymptomatic; however, they can be affected to the same extent as males if the degree of X-inactivation of the disease allele is unfavorable. Coagulopathy is a frequent finding during metabolic decompensation and sometimes evolves into acute liver failure.

VARIANTS

NM_000531.5(OTC):c.238A>G ; NM_000531.5(OTC):c.460G>T ; NM_000531.5(OTC):c.275G>A ; NM_000531.5(OTC):c.674C>T ; NM_000531.5(OTC):c.118C>T ; NM_000531.5(OTC):c.259G>A ; NM_000531.5(OTC):c.148G>T ; NM_000531.5(OTC):c.119G>A ; NM_000531.5(OTC):c.245T>G ; NM_000531.5(OTC):c.563G>T ; NM_000531.5(OTC):c.332T>C ; NM_000531.5(OTC):c.617T>G ; NM_000531.5(OTC):c.77G>A ; NM_000531.5(OTC):c.646C>G ; NM_000531.5(OTC):c.134T>C ; NM_000531.5(OTC):c.829C>T ; NM_000531.5(OTC):c.421C>T ; NM_000531.5(OTC):c.717+2T>C

GENE

PDHA1

DISEASES
Leigh syndrome with leukodystrophy
SUMMARY

Leigh syndrome is a clinically and genetically heterogeneous disorder resulting from defective mitochondrial energy generation. It most commonly presents as a progressive and severe neurodegenerative disorder with onset within the first months or years of life, and may result in early death. Affected individuals usually show global developmental delay or developmental regression, hypotonia, ataxia, dystonia, and ophthalmologic abnormalities, such as nystagmus or optic atrophy. The neurologic features are associated with the classic findings of T2-weighted hyperintensities in the basal ganglia and/or brainstem on brain imaging. Leigh syndrome can also have detrimental multisystemic affects on the cardiac, hepatic, gastrointestinal, and renal organs. Biochemical studies in patients with Leigh syndrome tend to show increased lactate and abnormalities of mitochondrial oxidative phosphorylation.

CLINICAL DESCRIPTION

Pyruvate dehydrogenase E1-alpha deficiency
SUMMARY

A disorder that is the most frequent form of pyruvate dehydrogenase deficiency (PDHD) characterized by variable lactic acidosis, impaired psychomotor development, hypotonia and neurological dysfunction.

CLINICAL DESCRIPTION

Patients present with a range of classic signs and symptoms of PDHD, including lactic acidosis, poor feeding, lethargy, tachypnea, developmental delay, growth retardation, poor acquisition or loss of motor milestones, hypotonia, seizures, ataxia and dystonia. Structural brain lesions including cortical atrophy, dilated ventricles, and incomplete corpus callosum, absence of the medullary pyramids and ectopia of the olivary nuclei are commonly observed, especially in female patients heterozygous for the disease-causing mutations that result in complete deficiency of E1-alpha subunit protein in cells expressing the gene mutation.

VARIANTS

NM_000284.3(PDHA1):c.773A>C ; NM_000284.3(PDHA1):c.787C>G

GENE

PRPS1

DISEASES
Lethal ataxia with deafness and optic atrophy
SUMMARY

Lethal ataxia with deafness and optic atrophy (also known as Arts syndrome) is characterized by intellectual deficit, early-onset hypotonia, ataxia, delayed motor development, hearing impairment and loss of vision due to optic atrophy.

CLINICAL DESCRIPTION

Other manifestations included floppiness, susceptibility to infections, and later, flaccid tetraplegia and areflexia.

Severe phosphoribosylpyrophosphate synthetase superactivity
SUMMARY

A severe form of phosphoribosylpyrophosphate (PRPP) synthetase superactivity, an X-linked disorder of purine metabolism, characterized by early onset hyperuricemia and hyperuricosuria, and clinically manifesting with urolithiasis, gout and neurodevelopmental anomalies consisting of variable combinations of sensorineural hearing loss, hypotonia, and ataxia.

CLINICAL DESCRIPTION

The phenotype varies greatly among patients. The severe form manifests in infancy or early childhood (but may occur earlier) usually with uric acid crystalluria and urinary stones (kidney and/or bladder), followed by the development of gouty arthritis and eventually renal failure as a result of obstructive uropathy from uric acid crystal deposition. This form also shows neurologic impairment, mainly sensorineural hearing loss, hypotonia, ataxia, developmental delay, and /or intellectual disability. Axonal neuropathy with demyelination is also possible (reported in one family).

X-linked Charcot-Marie-Tooth disease type 5
SUMMARY

The phenotype of X-linked Charcot-Marie-Tooth disease-5 typically comprises the triad of optic atrophy, deafness, and polyneuropathy.

CLINICAL DESCRIPTION

X-linked Charcot-Marie-Tooth disease type 5 is a rare, genetic, peripheral sensorimotor neuropathy characterized by an X-linked recessive inheritance pattern and the infancy- to childhood-onset of: 1) progressive distal muscle weakness and atrophy (first appearing and more prominent in the lower extremities than the upper) which usually manifests with foot drop and gait disturbance, 2) bilateral, profound, prelingual sensorineural hearing loss and 3) progressive optic neuropathy. Females are asymptomatic and do not display the phenotype.

X-linked intellectual disability-limb spasticity-retinal dystrophy-diabetes insipidus syndrome
SUMMARY

X-linked intellectual disability-limb spasticity-retinal dystrophy-diabetes insipidus syndrome is a rare genetic neurometabolic disease characterized by severe intellectual disability, spastic quadraparesis, Leber's congenital amaurosis and diabetes insipidus. Additional manifestations include facial dysmorphy (dolichocephalic skull, hypertelorism, deep-set eyes, hypoplastic nares, low-set ears), short stature, truncal hypotonia and axial hypertonia. Brain anomalies (e.g. thin corpus callosum with lack of isthmus and tapered splenium, hypoplasia or atrophy of the optic chiasm, prominent lateral ventricles, diminished white matter), described on magnetic resonance imaging, have been reported. High prenatal α-fetoprotein and intrauterine growth restriction is observed in routine pregnancy examination.

CLINICAL DESCRIPTION

X-linked non-syndromic sensorineural deafness type DFN
SUMMARY

Deafness is the most frequent form of sensorial deficit. In the vast majority of cases, the deafness is termed nonsyndromic or isolated and the hearing loss is the only clinical anomaly reported. In developed counties, 60-80% of cases of early-onset hearing loss are of genetic origin.

CLINICAL DESCRIPTION

The majority of cases presenting at birth concern perceptive deafness (with a neurosensory origin associated with the inner ear) rather than conductive deafness (anomalies in the amplification of sound waves between the middle ear - tympanum and auditory ossicles - and the outer ear). Autosomal dominant forms are characterised by very early onset and bilateral hearing loss with varying degrees of severity (ranging from mild to profound). No malformations of the inner ear can be detected by CT scan. Mutations in the PDS gene are responsible for 7% of cases of childhood deafness. In these cases, the deafness is marked by early-onset, usually bilateral (but sometimes asymmetric) hearing loss with autosomal recessive transmission. This form of deafness is always associated with malformations of the inner ear that can be detected by CT scan. In rare cases, thyroid gland disease may also be present. For the autosomal dominant forms of deafness, mutations in the COCH gene result in progressive postlingual deafness associated with severe attacks of vertigo and subjective tinnitus. This form of deafness should be distinguished from Meniere's disease (see this term). Autosomal dominant mutations in the WFS1 gene cause either a form of hearing loss affecting mainly low frequency sounds or deafness associated with optic atrophy.

VARIANTS

NM_002764.3(PRPS1):c.193G>A ; NM_002764.3(PRPS1):c.344T>C ; NM_002764.3(PRPS1):c.916G>A ; NM_002764.3(PRPS1):c.398A>C ; NM_002764.3(PRPS1):c.869T>C

GENE

SLC6A8

DISEASES
X-linked creatine transporter deficiency
SUMMARY

X-linked creatine transporter deficiency (CRTR-D) is a creatine deficiency syndrome characterized clinically by global developmental delay/ intellectual disability (DD/ID) with prominent speech/language delay, autistic behavior and seizures.

CLINICAL DESCRIPTION

The onset of symptoms occurs during infancy, usually before the age of 2 years. Males are mainly affected, but females can also have various combinations and severities of disease manifestations. CRTR-D is consistently characterized by mild to severe intellectual deficit, and expressive speech and language delay. Behavioral disorders (mainly autism and hyperactivity) are present in all affected individuals. Affected individuals often experience seizures and may present low weight gain, muscular hypotonia, and poor muscle mass. Subtle dysmorphic features such as midface hypoplasia, long face, and prominent chin have been reported in various affected male patients. Epilepsy and extrapyramidal symptoms may also occur occasionally. In adult patients, cardiac and gastrointestinal disorders have been reported. Carrier females are typically asymptomatic, but learning disabilities have been described in some.

VARIANTS

NM_005629.3(SLC6A8):c.1540C>T ; NM_005629.3(SLC6A8):c.1222_1224delTTC ; NM_005629.3(SLC6A8):c.1011C>G ; NM_005629.3(SLC6A8):c.1141G>C ; NM_005629.3(SLC6A8):c.321_323delCTT ; NM_005629.3(SLC6A8):c.395G>T

GENE

SMN1

DISEASES
Proximal spinal muscular atrophy type 1
SUMMARY

A rare, genetic proximal spinal muscular atrophy characterized by degeneration of alpha motor neurons in the anterior horns of the spinal cord and lower brain stem manifesting with onset of severe and progressive muscle weakness in the first 6 months of life and presenting with severe, generalized hypotonia and weakness,. Dysphagia and respiratory impairment may also be present at presentation or appear at a later stage. Classically, before the advent of recent therapies, type 1 patients never achieved sitting without support.

CLINICAL DESCRIPTION

Disease onset occurs before 6 months of age. The severe, symmetrical muscle weakness affects predominantly proximal limbs but often also involves the extremities. Cries are weak. Poor sucking ability and reduced swallowing are frequent, leading to feeding difficulties. Deep tendon reflexes are absent. Patients have paradoxical breathing, a bell shaped chest and develop respiratory failure. Mild contractures (of the knees and, more rarely, of the elbows), and scoliosis may be present. Classically, patients were not able to achieve sitting without support but this has changed following the availability of new treatments.

Proximal spinal muscular atrophy type 2
SUMMARY

A rare, genetic proximal spinal muscular atrophy characterized by degeneration of alpha motor neurons in the anterior horns of the spinal cord and lower brain stem manifesting with onset between 6 to 18 months of age with progressive, proximal muscle weakness, mild to moderate hypotonia and finger polymyoclonour tremor, with areflexia. Motor milestones are classically limited to independent sitting or standing.

CLINICAL DESCRIPTION

Disease onset occurs between the ages of 6 and 18 months. Classically, before the advent of the new therapies, affected children achieve sitting independently and may acquire standing but do not acquire independent walking. Progressive proximal muscle weakness is symmetrical and greater in the legs than the arms. Finger trembling is frequent. Scoliosis, joint contractures and ankyloses of the mandible are very common . Progressive respiratory muscle weakness can lead to restrictive lung disease. Cognition is normal.

Proximal spinal muscular atrophy type 3
SUMMARY

A rare, genetic proximal spinal muscular atrophy characterized by degeneration of alpha motor neurons in the anterior horns of the spinal cord and lower brain stem manifesting with onset of progressive proximal muscle weakness (legs greater than arms) between 18 months and adulthood. Motor development is heterogeneous but walking is typically acquired.

CLINICAL DESCRIPTION

The disease manifests between 18 months of age and adulthood, typically presenting with frequent falls, difficulty climbing steps and proximal weakness. Patients are subdivided based on age of onset: early onset is between 18 months and 3 years of age (type 3a) and is associated with a plateau in motor development, reduced or absent reflexes, finger polymyoclonus tremor and, frequently, loss of ambulation before or around puberty. Later onset (type 3b), between 3 and 21 years of age, is associated with comparatively milder decline in gross motor function. The muscle weakness predominantly affects the legs and hip muscles and then progresses to the shoulders and arms. Abnormal gait characteristics are common in order to compensate for weakness. Typically, patients are spared scoliosis and respiratory muscle weakness but these may be a feature after loss of ambulation. Cognition is normal.

Proximal spinal muscular atrophy type 4
SUMMARY

A rare, genetic proximal spinal muscular atrophy characterized by degeneration of alpha motor neurons in the anterior horns of the spinal cord and lower brain stem manifesting with adult onset, slowly progressive, mild proximal muscle weakness.

CLINICAL DESCRIPTION

Disease onset is typically in the second or third decade of life. The muscle weakness predominantly affects the legs and hip muscles and then progresses to the shoulders and arms. Waddling gait is common. Finger trembling, fasciculation and calf hypertrophy may occur. The clinical picture is similar to that seen in SMA type 3 but the motor weakness is less severe. Cognition is unaffected.

VARIANTS

functional copy number loss

GENE

WAS

DISEASES
Wiskott-Aldrich syndrome
SUMMARY

A primary immunodeficiency disease characterized by microthrombocytopenia, eczema, infections and an increased risk for autoimmune manifestations and malignancies.

CLINICAL DESCRIPTION

WAS usually manifests in infancy but onset may also occur during the neonatal period. In most cases the first clinical features are hemorrhagic manifestations with petechiae, bruising, purpura, epistaxis, oral bleeding, bloody diarrhea and intracranial bleeding. Acute or chronic eczema is the second characteristic finding of WAS. Due to combined immunodeficiency, most patients also have airway, gut or skin infections caused by regular or opportunistic germs. Autoimmune manifestations are seen in approximately 40% of cases and include autoimmune hemolytic anemia, neutropenia, vasculitis, inflammatory bowel disease, renal disease, and arthritis. WAS patients have a higher risk of developing tumors (mainly B-cell lymphomas) at any age.

X-linked severe congenital neutropenia
SUMMARY

X-linked severe congenital neutropenia is an immunodeficiency syndrome characterized by recurrent major bacterial infections, severe congenital neutropenia, and monocytopenia. It has been described in five males spanning three generations of one family. It is transmitted as an X-linked recessive trait and is caused by mutations in the WAS gene, encoding the WASP protein.

CLINICAL DESCRIPTION

X-linked immunodeficiency syndrome characterized by recurrent major bacterial infections, severe congenital neutropenia, and monocytopenia. Although X-linked inheritance and shifts in lymphocyte subsets were not known to be features of severe congenital neutropenia, affected males in this pedigree had increased numbers of activated CD8+ T cells in the peripheral blood resulting in decreased CD4+/CD8+ ratios of 0.5 or less. Immunoglobulin levels and T-lymphocyte activation were normal. Platelets were not decreased, and there was no history of eczema in affected individuals. Bone marrow examination demonstrated a maturation arrest at the promyelocyte/myelocyte stage, without gross abnormalities in megakaryopoiesis or erythropoiesis.

X-linked thrombocytopenia with normal platelets
SUMMARY

Hereditary nonsyndromic thrombocytopenia is characterized by decreased numbers of platelets and bleeding tendency

CLINICAL DESCRIPTION

VARIANTS

NM_000377.2(WAS):c.814T>C ; NM_000377.2(WAS):c.173C>G ; NM_000377.2(WAS):c.881T>C ; NM_000377.2(WAS):c.1442T>A ; NM_000377.2(WAS):c.134C>T ; NM_000377.2(WAS):c.809T>C

GENE

FMR1

DISEASES
Fragile X syndrome
SUMMARY

A rare genetic disease associated with mild to severe intellectual deficit that may be associated with behavioral disorders and characteristic physical features including a high forehead, prominent and large ears, hyperextensible finger joints, flat feet with pronation and, in adolescent and adult males, macroorchidism.

CLINICAL DESCRIPTION

Fragile X syndrome (FXS) presents with a variable clinical phenotype. In males, the disease presents during childhood with delayed developmental milestones. Intellectual deficit can be of variable severity and may include problems with working and short-term memory, executive function, language, mathematics and visuospatial abilities. Behavioral anomalies can be mild (e.g. anxiety, mood instability) to severe (e.g. aggressive behavior, autism). Autistic-like behavior can include hand flapping, poor eye contact, hand biting, gaze avoidance, social phobia, social and communication deficits and tactile defensiveness. In females, intellectual and behavioral disorders are typically mild and usually consist of shyness, social anxiety, and mild learning problems with a normal IQ, although 25% of girls have an IQ less than 70. Attention deficit hyperactivity disorder (ADHD) is present in over 89% of males and 30% of females and behavioral disinhibition is very common. Recurrent otitis (60%) and seizures (16 to 20%) can also be observed.

Fragile X-associated tremor/ataxia syndrome
SUMMARY

Fragile X-associated tremor/ataxia syndrome (FXTAS) is a rare neurodegenerative disorder characterized by adult-onset progressive intention tremor and gait ataxia.

CLINICAL DESCRIPTION

The age of onset of tremor and/or ataxia in males is about 60 years. The clinical presentation is heterogeneous with variable dominant manifestations including: intention tremor, progressive cerebellar gait ataxia, frontal executive dysfunction, cognitive decline, peripheral neuropathy, and dysautonomia. Other signs include mild parkinsonism and psychiatric manifestations (depression, anxiety, agitation) with possible progression to dementia. Carrier females generally have less severe manifestations than males but also have an increased risk of primary ovarian insufficiency, chronic muscle pain, and hypothyroidism.

Symptomatic form of fragile X syndrome in female carrier
SUMMARY

A rare genetic disease characterized by a variable clinical phenotype which includes similar features but is typically less severe than in affected males. Patients may present with mild to borderline intellectual disability, anxiety, social phobia, selective mutism, attention deficit hyperactivity disorder, language deficit, neurologic signs and symptoms (such as seizures, hypotonia, and clonus), ophthalmologic anomalies (strabismus, refractive errors), and facial dysmorphism (including long face, prominent forehead, large, prominent ears, and mandibular prognathism).

CLINICAL DESCRIPTION

.

Xq27.3q28 duplication syndrome
SUMMARY

Xq27.3q28 duplication syndrome is a recently described syndrome characterized by short stature, hypogonadism, developmental delay and facial dysmorphism.

CLINICAL DESCRIPTION

Facial features include deep-set eyes, bulbous nasal tip and thin lips. Hypogonadism is due to primary gonadal failure. Patients also had some features which are probably caused by testosterone deficiency such as a high-pitched voice, sparse body hair and small hands and feet. Carrier females present with a short stature and early menopause.

VARIANTS

Premutation allele (CGG)n

900 828 420